a class 1 integron present in a human commensal has a hybrid

JOURNAL OF BACTERIOLOGY, Aug. 2008, p. 5318–5327 Vol. 190, No. 150021-9193/08/$08.00�0 doi:10.1128/JB.00199-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

A Class 1 Integron Present in a Human Commensal Has a HybridTransposition Module Compared to Tn402: Evidence of Interaction

with Mobile DNA from Natural Environments�†M. Labbate,* P. Roy Chowdhury, and H. W. Stokes

Department of Chemistry and Biomolecular Sciences, Macquarie University, Sydney, Australia

Received 7 February 2008/Accepted 15 May 2008

In a survey of class 1 integrons from human stools, an unusual class 1 integron from a strain of Enterobactercloacae was isolated and characterized in detail. Sequence analysis of a fosmid containing the class 1 integronrevealed a complex set of transposons which included two Tn402-like transposons. One of these transposons,Tn6007, included a class 1 integron with two non-antibiotic-resistance-type gene cassettes and a completetransposition module. This tni module is a hybrid with a boundary within the res site compared to Tn402,implying that a site-specific recombination event generated either Tn6007 or Tn402. The second Tn402-liketransposon, Tn6008, possesses neither a mer operon nor an integron, and most of its tni module has beendeleted. Tn6007, Tn6008, and the 2,478 bases between them, collectively designated Tn6006, have transposedinto a Tn5036/Tn3926-like transposon as a single unit. Tn6006, Tn6007, and Tn6008 could all transpose asdiscrete entities. Database analysis also revealed that a version of Tn6008 was present in the genome ofXanthomonas campestris pv. vesicatoria. Overall, the E. cloacae isolate further demonstrated that functionalclass 1 integrons/transposons are probably common in bacterial communities and have the potential to addsubstantially to the problem of multidrug-resistant nosocomial infections.

The extensive use of antibiotics in clinical and agriculturalsettings has been a driving force for the spread of antibioticresistance genes (8). One significant method for the spread ofantibiotic resistance commonly found on resistance plasmidsand transposons is facilitated by a genetic element called theclass 1 integron (12, 44). The class 1 integron includes a site-specific recombination system capable of integrating and ex-pressing open reading frames contained in structures calledmobile gene cassettes. The components of this system includean integrase gene (intI1), whose product is a site-specific inte-grase, and an attachment site (attI1) at which mobile genecassettes are inserted. While not part of the site-specific re-combination system, class 1 integrons possess a promoter (Pc)that expresses genes within the cassettes. Class 1 integrons, dueto their ability to accumulate multiple resistance gene cas-settes, play a big role in the dissemination of antibiotic resis-tance genes in pathogens (46). For the same reason they alsocontribute greatly to the problem of drug-resistant nosocomialinfections (22, 24, 56).

Class 1 integrons are one example of relatively ancient ge-netic elements that are common in the proteobacteria. Whilemany integron classes show evidence of lateral gene transfer(LGT) over long evolutionary time periods (4, 28), these inte-grons are not generally immediately mobilizable. All class 1integrons recovered from clinical isolates, however, are linkedto a specific set of transposition functions, the best exemplar of

which is Tn402 (40). This family of transposons comprises asuite of four transposition genes (tniR, -Q, -B, and -A; alsoreferred to as the tni module), a resolution site located be-tween tniR and tniQ, and a pair of inverted repeats, designatedIRi and IRt, that define the ends of the transposon and arerequired for transposition (19) (Fig. 1). Transposition of mem-bers of this family shows a high level of target site selection.Specifically, the transposition system targets the res sites thatare important in the biology of many other transposon typesand of many conjugative plasmids. For this reason Tn402 andits relatives have been referred to as res site hunters (29). Theability to target sites characteristic of many transposons andplasmids facilitates the spread of this transposon family byLGT. Thus, members of this family are relatively common inenvironmental isolates, where they most frequently have a meroperon that confers mercury resistance linked to them (29).When class 1 integrons are recovered from clinical isolates, theintegron effectively has replaced the mer operon, and theformer is found at the same relative location as the latter (40).Consistent with this res site targeting ability, clinical class 1integrons have been found to be embedded in a number ofdifferent (non-Tn402-like) transposons and/or in a number ofdifferent plasmids (25, 34, 37).

Tn402 is the best example of a class 1 integron that is also afunctional transposon (40) since it has all the transposon func-tions described above. Most class 1 integrons from clinicalisolates were clearly derived from a structure related to Tn402as they possess many of the features associated with this type oftransposon. However, various genetic events, including acqui-sition of other DNA sequences, deletions, and rearrangements,have resulted in the loss of some transposition functions. Con-sequently, in a clinical context, a typical class 1 integron is adefective transposon (5). Nonetheless, most of these defectivetransposons retain IRi and IRt and can still potentially trans-

* Corresponding author. Mailing address: Department of Chemistryand Biomolecular Sciences, Macquarie University, Sydney, NSW 2109,Australia. Phone: 612 9850 8209. Fax: 612 9850 8245. E-mail: [email protected].

† Supplemental material for this article may be found at http://jb.asm.org/.

� Published ahead of print on 23 May 2008.

5318

on March 24, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

pose where appropriate transposition proteins are provided intrans (5).

Until recently, it was generally assumed that the Tn402-likeclass 1 integron arose by a possibly unique event in which achromosomal integron became integrated into the transposon.With the advent of the antibiotic era, strong selection forantibiotic resistance genes captured by the integron led to veryrapid global and promiscuous spread of this element and itsdescendants. Recent studies have shown that class 1 integronsare very broadly disseminated in bacterial communities (10, 13,45) and that the lateral spread is not uniquely driven by Tn402-like transposition (45). Notwithstanding this observation, it isstill clear that the linkage of a class 1 integron to a Tn402-liketransposon was a critical step that contributed greatly to thecontemporary problem of multidrug-resistant pathogens anddifficult-to-manage nosocomial infections.

Class 1 integrons of the type recovered from clinical isolatesare also very common in other environments. Thus, multidrug-resistant class 1 integrons that are defective transposons areroutinely recovered from many environments, including waste-water treatment plants (44), meat and produce (7, 51), andeven environments relatively remote from the human foodchain (26). These observations make it clear that the same class1 integrons that mediate multidrug-resistant nosocomial infec-tions have become generally widespread, largely as a result ofhuman activities. This broad dispersal of Tn402-like class 1integrons provides logical routes and mechanisms by whichnew resistance genes can be recruited from the general envi-ronment into the hospital setting (41), although the in situevidence for this remains largely circumstantial.

In a survey of human stool isolates, a class 1 integron froman Enterobacter cloacae strain was identified. This class 1 inte-

gron, designated Tn6007, is one of the few examples of anelement that contains a full transposition module and a class 1integron. However, Tn6007 is a chimera compared to Tn402,meaning that one of these transposons arose from recombina-tion between the other transposon and a so-far-unidentifiedthird member of the res hunter family. The Tn6007 integroncontains no antibiotic resistance cassettes but does contain agene cassette with an unknown function. It also contains asecond cassette containing a gene, qacE2b, which encodes re-sistance to quaternary ammonium compounds. A second trans-poson (Tn6008) belonging to the Tn402 family with most of thetni module deleted was found adjacent to Tn6007. This ele-ment has neither a mer module nor an integron module. Weshow here that Tn6008 is mobilizable and is present in thegenome of the plant pathogen Xanthomonas campestris pv.vesicatoria. Finally, we report that Tn6007 and Tn6008 havetransposed into the clinically important transposon Tn5036/Tn3926 or a very close relative as a composite transposon heredesignated Tn6006. While numerous examples of a class 1integron inserted into this backbone have been found clini-cally, the insertion point found here is different than thatdescribed previously. These findings provide direct evidence ofmixing of genetic information between clinical and environ-mental contexts and reinforce the point that clinical pathogenscontinue to have access to a large environmental genetic re-source.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions. A list of all strains andplasmids used in this study is provided in Table 1. Bacterial isolates containingclass 1 integrons were isolated from healthy human fecal samples using a methodmodified from the method of Barlow et al. (2). Briefly, 5 g of human fecal

FIG. 1. Alignment of Tn402 and Tn6007. From IRi on, Tn6007 is 99.9% identical to Tn402 until a point between tniR and tniQ, where the levelof nucleotide identity drops to 89%. This indicates that there was recombination between two disparate tni modules, with the recombinationbreakpoint (RBP) occurring at or before the first nucleotide mismatch. The further away from the mismatch, the less likely the recombinationbreakpoint (indicated by shading in the arrow). The gene cassette entry point into the integron is indicated by filled triangles, and gene cassetteswere not included in the alignment. Boxes indicate inverted repeats r1 to r6 in the resolution region, with the recombination point occurring withinTT between r1 and r2 (arrow labeled RS).

VOL. 190, 2008 UNIQUE Tn402-LIKE INTEGRON TRANSPOSITION MODULE 5319


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

material was homogenized in 50 ml of buffered peptone water (BPW) andenriched for 6 h at 37°C without agitation. A 100-�l aliquot of an enrichment wasreenriched in 100 ml of BPW overnight at 37°C without agitation. Enrichmentswere screened by PCR for the presence of intI1 as described by Barlow et al. (2).Dilutions of intI1-positive enrichments were plated onto MacConkey agar (AmylMedia, Australia), and between 100 and 200 single-colony boiled lysates werescreened for the presence of intI1 by PCR. E. cloacae JKB7 was isolated from aBPW fecal enrichment using no antibiotic selection. All Escherichia coli strainsused in the transposition assay and for fosmid library construction were routinelygrown at 37°C under aerobic conditions in Luria-Bertani (LB) broth (43).

Antimicrobial agents and antibiotic susceptibility assay. The following con-centrations of antimicrobial agents were used: spectinomycin (Fluka), 50 �g/ml;chloramphenicol (Sigma), 12.5 �g/ml; nalidixic acid (Sigma), 25 �g/ml; kanamy-cin (Sigma), 50 �g/ml; and HgCl2 (BDH Chemicals), 4 �g/ml. The antibioticsusceptibility assays for E. cloacae JKB7 were conducted using the BD Phoenixautomated susceptibility system.

Conjugation assays. Conjugation to create the donor strains for transpositionassays was performed by concentrating mid-log-phase cells of the donor and therecipient threefold, mixing them at a ratio of 10:1, and incubating the mixedculture at 37°C for 2 h. Transconjugants were selected by plating 150 �l of themating mixture on an LB agar plate supplemented with appropriate antibiotics.Conjugation experiments to select for transposition events were performed byplating 200-�l aliquots of a 1:1 (vol/vol) mixture of saturated donor and recipientstrain cultures onto LB agar and incubating the plates at 37°C for 24 h. Subse-quently, the mating mixture was recovered from the plates with 1 ml of LB broth,collected in an Eppendorf tube, and vortexed to resuspend the mating mixture.Serial dilutions of the mating mixture were then plated onto LB agar platescontaining the appropriate antibiotic(s).

PCR and sequencing methods. All primers used in this study are shown inTable 2. The standard PCR was performed using the PCR master mixture(Promega) containing 25 U/ml of Taq DNA polymerase, 200 �M of each de-oxynucleoside triphosphate, and 1.5 mM MgCl2. Primers were used at a finalconcentration of 0.5 �M. All PCRs were performed by using 30 cycles of dena-

turation at 94°C for 30 s, annealing at the appropriate temperature for 30 s, andextension at 72°C for 1 min. The intI1 PCR was conducted by using an annealingtemperature of 60°C. Mapping of transposition events into pUB307 was con-ducted by PCR utilizing primers that target the resolution region (Table 2) andends of the transposon(s) (Table 2) at an annealing temperature of 59°C. The E.cloacae isolate was typed by sequencing a portion of the rpoB gene using primerscm7 and cm31b (31). PCR products were purified using the Wizard SV gel andPCR clean-up system (Promega) prior to sequencing. DNA sequencing reactionswere performed at the Macquarie University sequencing facility using dye ter-minator technology.

Fosmid library construction and screening. A fosmid library was constructedfrom E. cloacae JKB7 genomic DNA using a CopyControl fosmid library pro-duction kit (Epicentre). Genomic DNA (gDNA) was extracted from overnightcultures using the XS buffer protocol (49), treated with RNase A (Sigma), andfurther purified by phenol-chloroform extraction. Fosmid library productionrelies on shearing of the gDNA into approximately 40-kb fragments due to thesize restriction of the packaging phage capsids. After gDNA purification, pulsed-field gel electrophoresis was performed using a 1% agarose gel to ensure that thegDNA was sheared sufficiently to obtain approximately 40-kb fragments.Sheared DNA was then end repaired, ligated into the fosmid vector, packagedinto phage capsids, and transferred into E. coli EPI300-T1R as recommended bythe CopyControl fosmid library production kit manual. E. coli clones carryingfosmids were plated on LB agar plates containing chloramphenicol. Screening ofthe fosmid library for intI1 was carried out as previously described (45). Fosmidsfrom positive clones were extracted using a Wizard Plus SV Minipreps kit(Promega), and the terminal ends of the insert were sequenced using the FP andRP vector primers. The insert from one positive fosmid, pJKB7eC5, was fullysequenced by Macrogen (Korea).

Cointegrate construction. To test the transposition mobility of the integron-containing transposon Tn6007 and composite transposon Tn6006, a spectinomy-cin-selectable marker was introduced into the Tn6007 module. This was accom-plished by creating a cointegrate fusion between the integron in pJKB7eC5 andthe plasmid pRMH236, which contains three copies of the aadA2 gene cassette.

TABLE 1. Strains used in this study

Strain or plasmid Relevant characteristics Reference or source

Enterobacter cloacae JKB7 Isolated from a healthy human fecal sample This study

Laboratory strainsEscherichia coli EPI300-T1R F� mcrA �(mrr-hsdRMS-mcrBC) �80dlacZ�M15 �lacX74 recA1

endA1 araD139 �(ara leu)7697 galU galK �� rpsL nupG trfA tonAdhfr Strr Tpr

Epicentre Biotechnologies

Escherichia coli UB5201 F� pro met recA56 gyrA Nxr

PlasmidspJKB7eC5 pCC1FOS vector containing 29,859-bp insert from E. cloacae JKB7;

the insert contains Tn6005 and surrounding sequenceThis study

pUB307 Tcr Kmr 3pRMH236 Spr 6pSU2056 Apr 27

TABLE 2. Primers used in this study

Primer Sequence (5�–3�) Target

HS463A CTGGATTTCGATCACGGCACG intI1HS464 ACATGCGTGTAAATCATCGTCG intI1FP GGATGTGCTGCAAGGCGATTAAGTTGG pCC1FOS sequencing primerRP CTCGTATGTTGTGTGGAATTGTGAGC pCC1FOS sequencing primerHS902 AATCCTGGCGGATTCACTAC IRi end of Tn6006/Tn6007HS903 TCGAGATTGGTGCAGATGAC IRt end of Tn6007HS904 TGGACAAGGCTGAGTCAGTG IRi end of Tn6008HS905 ACCAGGCGTTACATCCAGTC IRt end of Tn6006/Tn6008HS906 TAACGGTCGGTGTCCTTCTC res region of pUB307HS907 TGAGCTTGTGGAAGTGTGCT res region of pUB307HS908 AGTTCCCGCTCGAATTGC tniBHS909 GACGGTCACCAGAAGAACCC JK008HS910 GGTGCTGGGTTTGTGACG tniA (sequencing primer)

5320 LABBATE ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

E. coli EPI300-T1R carrying pJKB7eC5 was transformed with pSU2056 andpRMH236 to induce cointegrate formation. Total plasmid DNA was extractedand packaged using MaxPlax lambda packaging extracts from Epicentre Bio-technologies. Since pJKB7eC5 exclusively contained the cos phage binding site,only pJKB7eC5 and cointegrates could be packaged. The packaged phage wasused to infect E. coli EPI300-T1R cells according to the manufacturer’s instruc-tions, and transformants were plated onto LB agar containing spectinomycin andchloramphenicol for selection of cointegrates.

Transposition assay. The broad-host-range plasmid pUB307 was conjugatedinto E. coli EPI300-T1R bearing the pJKB7eC5/pRMH236 cointegrate. PlasmidpUB307 contains a resolution site that is a known suitable target for transposonswith Tn402-like transposition functions (18). Since pJKB7eC5 is nonmobile,transposition into pUB307 was detected by conjugation of pUB307 harboring thetransposon derivatives into nalidixic acid-resistant E. coli strain UB5201. Selec-tion for pUB307 carrying the desired transposon insertion(s) was carried out onmedia containing HgCl2 (for Tn6005), spectinomycin (for Tn6006/Tn6007, al-though movement of Tn6005 containing these transposons was also selected for),kanamycin (for pUB307), and nalidixic acid (for the recipient strain). The trans-position frequency was calculated by comparing the rate of transposition with therate of conjugation by selecting the entire population of transconjugants gener-ated in the course of the transposition assay on plates supplemented with onlykanamycin and nalidixic acid.

Nucleotide sequence accession numbers. The rpoB sequence of E. cloacaeJKB7 has been deposited in GenBank database under accession numberEU591508. The sequence of the insert of the JKB7eC5 fosmid has been depos-ited in the GenBank database under accession number EU591509.

RESULTS

Class 1 integrons are common in commensal bacteria in thehuman intestinal tract. As part of a broad survey of the pres-ence of class 1 integrons in human commensal bacteria, fecalsamples were provided by 15 healthy volunteers, enriched inmedia, and screened for the presence of intI1 by PCR. Fecalenrichments from at least nine individuals were positive asdetermined by this PCR, suggesting that class 1 integrons arecommon in human commensal populations. One intI1-positiveclone was isolated from seven of the nine enrichments andtyped by rpoB sequence analysis. Two isolates had identicalsequences, resulting in six distinct intI1-positive clonal typesidentified. Five of the isolates were identified as E. coli, andone was identified as E. cloacae.

E. cloacae is a cause of many types of nosocomial infections,is often multidrug resistant (23), and has a high incidence ofintegron carriage (52). Also, E. cloacae-mediated infectionscan be difficult to manage in a hospital context (33), and theyhave high rates of mortality (17). For these reasons we exam-ined the E. cloacae isolate (designated JKB7) to determine itsintegron and surrounding genetic context in detail. This wasdone by construction of a fosmid library from genomic DNAand complete sequencing of an intI1-positive clone.

The class 1 integron from E. cloacae JKB7 is a Tn402-liketransposon. Sequence analysis of fosmid clone JKB7eC5 re-vealed that the class 1 integron in E. cloacae JKB7 is locatedwithin a structure that is analogous to Tn402 in a structuralsense and is designated Tn6007 here (Fig. 1). Tn6007 isbounded by the inverted repeats IRi and IRt, which are char-acteristic of the Tn402 family. A complete tni module ispresent; however, a single base pair deletion in tniA was ob-served, implying that this gene was nonfunctional. This dele-tion in the fosmid clone was independently confirmed by per-forming PCR of the relevant region and resequencing.However, the mutation appears to have occurred at a stageduring or after fosmid library production since the sequence of

the Tn6007 tniA gene amplified by PCR from the original E.cloacae JKB7 genomic DNA did not contain the same basepair deletion. So, while the fosmid clone does not have afunctional tniA gene, the original source strain does. InTn6007, the sequence beginning at IRi, excluding the incorpo-rated gene cassettes and extending to approximately the mid-dle of the res site (that is, including tniR but not tniQ), displays99.9% identity (1-bp difference) with Tn402. From the middleof the res site to the end of IRt, however, the level of DNAidentity with Tn402 is approximately 89% (Fig. 1). When thesequence from tniQ to IRt is considered in isolation, this re-gion is different from the sequences of all other known mem-bers of the Tn402 family, although it shows the highest level ofsimilarity to the mer operon containing Tn5718 (96%) (Table3). In contrast, tniR is 100% identical to the correspondinggene in Tn402 (Table 3). Thus, Tn6007 is a chimera comparedto Tn402, with one half essentially identical to Tn402 and theother half derived from an element whose closest known rel-ative is Tn5718.

The cassette array in the Tn6007 integron comprises twocassettes. The first of these cassettes, designated JK007, in-cludes a gene whose predicted product has conserved domainsrelated to NADPH-dependent flavin mononucleotide reducta-ses, a family of enzymes involved in the reduction of quinones.The biological significance of JK007 in this context is unclear,although in the case of Helicobacter pylori, an NADPH-depen-dent flavin mononucleotide reductase (not related to the JK007predicted protein) does provide protection from oxidativestress (54). This may be significant since there is emergingevidence that accessory proteins that help cells defend againstoxidative damage may assist pathogens in colonizing theirhosts (9). No cassette of this type has been observed in class 1integrons previously. The second cassette is 99% identical (itdiffers at two positions) to another cassette which includes agene designated qacE2 (accession number DQ462520). Highlysimilar versions of this cassette have been recovered previouslyfrom clinical isolates (16, 21, 48). Here we designate the geneqacE2b. The predicted protein, QacE2b, is 77% identical and87% similar to QacE encoded by Tn402. The Tn402 qacE geneproduct has been demonstrated to provide resistance to anti-septics and disinfectants by active transport (39). Since the E.coli strain carrying fosmid clone JKB7eC5 was resistant to 25�g/ml cetyltrimethylammonium bromide (a detergent) and nogrowth of the control strain was observed (data not shown), itis highly likely that QacE2b also provides protection fromantiseptics and disinfectants. However, the fosmid containsmany genes, and thus this conclusion should be validated byfurther experiments.

TABLE 3. Percent identities of the tniR gene and the tniQBAregion for different res hunter-type transposons

Transposon

% Identity

Tn402 Tn6007 Tn5053 Tn5718

tniR tniQBA tniR tniQBA tniR tniQBA tniR tniQBA

Tn6007 100 89Tn5053 77 83 77 84Tn5718 77 89 77 96 88 84Tn5058 76 89 76 92 87 83 98 95



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Tn6007 is part of a larger complex transposon. Tn6007 ispart of a larger transposon designated Tn6006 here (Fig. 2).Within Tn6006 is a region in addition to Tn6007 that isbounded by second copies of IRi and IRt and is designatedTn6008. Tn6007 and Tn6008 are separated from each other by2,478 bp. The first 100 bases of Tn6008, beginning at the startof IRi, are identical to the bases of Tn402-like class 1 inte-grons/transposons. After the first 100 bases, the subsequent3,933 bases, up to a point 1,966 bases from the end of IRt,contain four genes not related to the Tn402 family of trans-posons. The remaining 1,966 bases include a complete tniAgene related to other members of the Tn402 family of tniAgenes. Over its 1,680-bp length, this gene is 99% identical (3-bpdifference) to the tniA gene of the mercury resistance transpo-son Tn5053 (20). The four intact genes in Tn6008 (Fig. 2) arean araC-like transcriptional regulator gene (JK010), an alkyl-hydroperoxidase-like gene (ahpD), a gene with an unknownfunction (JK011), and a lysR-like transcriptional regulator gene(JK012). Homologues of ahpD have been demonstrated toassist in protection from oxidative stress and survivability inmacrophages (14, 38).

Tn6006 is presumed to have inserted into its identified lo-cation as a single module; that is, Tn6007, Tn6008, and thesequence between these transposons moved as a single unit.This is the inferred outcome since IRi and IRt of Tn6006 arebounded by a 5-bp duplication of the target site (DR2) (Fig. 2).The order of events leading to the creation of Tn6006 is lessclear. Perhaps the most likely explanation, however, is thatTn6007 inserted upstream of JK008 first. Subsequent to this,Tn6008 transposed into a sequence downstream of JK009with transposition proteins provided in trans by the preex-isting Tn6007.

Tn6006 is inserted into a Tn5036/Tn3926-like transposon.In E. cloacae JKB7, Tn6006 is inserted into the res site of atransposon that is 99% identical to a transposon belonging tothe Tn3 family designated Tn5036/Tn3926. Here, we definethis transposon along with its Tn6006 insert, Tn6005. Like

Tn6005, the multidrug resistance transposon Tn1696 containsa class 1 integron inserted into the res region between the tnpRand merE genes (11, 42). Previous studies have determinedthat Tn1696 was generated from insertion of the integron In4into Tn5036/Tn3926 or into a close relative (34).

In addition to Tn1696, many other examples of a class 1integron inserted into a Tn5036/Tn3926 backbone are known.These other examples (Fig. 3) have different (mostly) antibi-otic resistance cassette arrays. They are similar, however, in

FIG. 2. Genetic map describing the insert sequence of fosmid JKB7eC5. Tn6006 is a transposon consisting of two modules bound by theTn402-like inverted repeats IRi and IRt, one of which is a Tn402-like class 1 integron (Tn6007). The entire Tn6006 module is inserted into aTn5036/Tn3926 transposon (Tn1696 ancestor) which is inserted into a plasmid. See the text for more information. IR, inverted repeat; DR, directrepeat. Striped arrows indicate tni genes, dark gray arrows indicate mercury resistance genes, and the black arrow indicates intI1.

FIG. 3. Insertion of class 1 integrons into the res region of theTn1696 ancestor Tn5036. Most of the Tn1696-like clinical class 1integrons have the same insertion point, indicating that they are allrelated and descendants of a common ancestor. The class 1 integronfrom E. cloacae JKB7 is inserted at a position distinct from Tn1696-like integrons, indicating that there was a separate insertion event.There is evidence for a third class 1 integron insertion event in theTn1696 ancestor in plasmid t-st4. The number in parentheses indicatesthe length of a sequence not shown. The underlined CAA tripletindicates the TTG start codon (complementary strand) for tnpR. Ar-rows indicate class 1 integron insertion points.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

that the associated integron is the clinical type with partial lossof tni genes downstream of the cassette array. In addition, inthese examples, the point of insertion of the integron into thebackbone is the same (Fig. 3). It is probable that these differentisolates are descended from a single integron transpositionevent since the different isolates are for the most part differentonly in their cassette arrays. Given the bias of transpositiontoward res sites, however, the possibility that the site seen hereis a preferred insertion site cannot be formally excluded.Tn6005, however, must have been derived from a differentintegron capture event since the insertion point is six basesaway from the insertion point seen previously (Fig. 3). There isone other example of an integron inserting into a differentposition in a Tn5036/Tn3936 context, and that is the class 1integron in plasmid t-ST4 from Salmonella enterica serovarTyphimurium (accession no. AJ746361) (53). In this case, theintegron is inserted 9 bp from the point of insertion in Tn1696and 3 bp from the point of insertion in Tn6005 (Fig. 3). Clearly,Tn5036 and Tn3926 and their relatives are continuing to ac-quire Tn402-like integrons, which presumably then increasesthe potential for the lateral transfer of class 1 integrons intoother mobile elements. In strain JKB7, Tn6005 appears to haveinserted into the backbone of a plasmid since terminal se-quencing of one other intI1-positive fosmid from the E. cloacaeJKB7 library revealed genes involved in conjugative transfer(data not shown). However, further experimental evidence isrequired to definitively confirm a plasmid location for Tn6005.Insertion of Tn6005 into its current location occurred by trans-position since the element is defined by characteristic directrepeats (DR1), as indicated in Fig. 2.

Transposition activity of transposons in E. cloacae JKB7.The transposition frequency of Tn6005 was determined usingthe conjugative plasmid pUB307 as a target and Hgr as aselective marker (see Materials and Methods). The meantransposition frequency was 1.2 � 10�3 (three replicates).

Thus, the Tn5036/Tn3926-like transposition system in Tn6005is functional.

We were also interested in examining the transposition pro-ficiency of the Tn6007 transposition system given its chimericstructure compared to Tn402. While Tn6007 appears to have afully functional transposition module in E. cloacae JKB7, inpJKB7eC5 tniA contains a single base pair mutation. Unfor-tunately, pJKB7eC5 was the only intI1-positive fosmid clonethat contained the full Tn6007 module. Since Tn6008 containsa complete tniA gene, we hypothesized that this would com-pensate for the Tn6007 tniA mutation in trans. Assuming thattransposition is mediated in a way similar to that of othermembers of the Tn402 family, res sites are likely transpositiontargets. Despite the highly selective nature of transpositionevents, the frequency of movement can be very high whenthere is a suitable target. One such target is the res site asso-ciated with IncP plasmids, and pUB307 is an example of sucha plasmid. In the genetic context in which Tn6006/Tn6007 isfound, it was not possible to measure rates of transpositionsince the linkage to Tn6005 made distinguishing between me-diating transposition modules difficult in conduction assays.Nonetheless, we were able to demonstrate that the Tn6007transposition module is mobile. This was done, first, by creat-ing spectinomycin-resistant cointegrates between Tn6007 andthe aadA2 gene cassette carrying plasmid pRMH236 (see Ma-terials and Methods). The cointegrate donor then allowed se-lection for spectinomycin-resistant transposition events in theconduction assay. The mean rate of transposition was found tobe 1.3 � 10�3 (three replicates), although, as noted above, thiscould have been derived in part (or in whole) from the Tn5036/Tn3926-like transposition system. To assess the activity of theTn6007-associated transposition system, at least in a qualita-tive sense, a number of independent cointegrates were puri-fied, and derived DNA was subjected to PCR with a series ofPCR primer pairs designed to detect the presence of DNA

FIG. 4. Map of insertion of Tn6006, Tn6007, and Tn6008 into the “multiple resolution site” of pUB307. The boxes with vertical lines indicatethe IRi ends of the transposons, the boxes with horizontal lines indicate the IRt ends of the transposons, and the dotted boxes indicate the locationof the integrase in the transposons. The relative positions of IRi and IRt in the transposons relative to HS906 and HS907 determine the orientationin which the transposons have inserted into the pUB307. Arrows associated with the primers indicate the direction of amplification. The resolutionand site-specific recombination sequences are indicated by bold italics.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

inserted at the pUB307 res site (Fig. 4). PCR products consis-tent with insertion of both a Tn6006 module and a Tn6007module were readily detected. For one of each of these poten-tial events the PCR products derived from both ends weresequenced to obtain a single example of each type of event.The sequence generated was consistent with a Tn402-liketransposition event that included a direct repeat target siteduplication when both ends of the same cointegrate were com-pared. Thus, this hybrid transposition system is functional andcan mediate transposition of both the Tn6007 module aloneand the larger Tn6006 module.

In carrying out the PCR experiments with cointegrates,we found at least one example that, despite generating aproduct across the IRt boundary of Tn6006/Tn6008 usingthe HS905/HS907 primer pair, did not generate a productwith the Tn6006/Tn6007 IRi boundary primers (Fig. 4). Wetherefore designed an additional primer that targeted theIRi end of the Tn6008 module and carried out a PCR withthis primer (HS904) and primer HS906, from which a prod-uct was generated. Sequencing of the two products con-firmed that the Tn6008 module alone had transposed intothe pUB307 res site. A 5-bp duplication of the target siteconfirmed that a Tn402-like transposition event occurred.This was unexpected since it is the Tn6007 module, not theTn6008 module, that carries the aadA2 gene and thus en-codes spectinomycin resistance. Since the cointegrate wasalso Hgr, we presumed that Tn6005 must also be locatedsomewhere within pUB307. If this is so, Tn6008 is likely tohave transposed at some point after pUB307 moved to therecipient. Plate mating was carried out overnight (approxi-mately 16 h), so there was ample time for such events tooccur. Notwithstanding that we could not determine thefrequency of Tn6008 transposition, the fact that we couldobserve such events at all is interesting. Tn6008 lacks its ownfunctional transposition system and is dependent on Tn6007to provide the required proteins in trans. Thus, it is likelythat any sequences between intact IRi and IRt invertedrepeats have the potential to be mobilized in the appropri-ate circumstances. Further, the Tn6007 tni module is a hy-brid compared to Tn402, and this implies that this family oftransposons may be relatively promiscuous, potentially al-lowing transposition in trans even among different membersof the family.

A rearranged Tn6008 is present in the X. campestris pv.vesicatoria chromosome. The sequences comprising Tn6008are also present in the chromosome of X. campestris pv. vesi-catoria; however, they are split into two regions separated by20,700 bp, and one region is inverted with respect to the other(accession number AM039952; BLASTN hit to nucleotides2,652,713 to 2,656,474 and 2,677,175 to 2,679,416) (see Fig. S1in the supplemental material). Both of these regions from X.campestris pv. vesicatoria are 99% identical to Tn6008 (alto-gether there are differences in 48 bp). This region of the X.campestris pv. vesicatoria chromosome shows evidence of LGTgenerally, but, since Tn6008 has been identified, the relation-ship of the corresponding sequences in the chromosome canpotentially be explained by a series of transposition events, adeletion event, and an inversion event (see Fig. S1 in thesupplemental material). These data further demonstrate that

Tn6008 is mobile due to its presence in different genetic con-texts.

DISCUSSION

Class 1 integrons are a major medical problem since in aclinical context, they often help bacteria that cause nosocomialinfections to manifest a multidrug-resistant phenotype. Mostclinical-type class 1 integrons are descendants of a class 1integron that are associated with a specific suite of transposi-tion functions. These descendants have acquired features thathave concomitantly led to the loss of some transposition genes,thereby making them defective transposons (5). The referenceintegron/transposon that structurally resembles the functionalancestor is Tn402, which was first reported in 1994 (40) anduntil recently was the only such example. The Tn402 class 1cassette array includes a dfrB3 cassette that confers tri-methoprim resistance (40). Functional transposons/integronsare still quite rare, although several additional examples havebeen reported recently (47, 50). These examples were obtainedfrom clinical environments. They include the cassettes aacC7,blaVIM-2, dfrB5, and aacC6-II from an Indian Pseudomonasaeruginosa isolate and aacA7, blaVIM-2, and dfrB5 from P.aeruginosa isolates in the United States and Russia. In partic-ular, these clinical isolates highlight the fact that multidrug-resistant class 1 integrons that are also functional transposonsmay be spreading rapidly (50). It remains to be seen whetherthe recent, apparently rapid appearance of resistance cassettesin functional transposons/class 1 integrons indicates that thereis an emerging “new wave” of class 1 integron structures inclinical isolates.

Here we identified Tn6007, another example of a class 1integron that is also a functional transposon. This element isnoteworthy compared to those seen previously for a number ofreasons. First, the clone containing Tn6007 was recovered inthe absence of antibiotic selection. Consistent with this, theintegron does not contain antibiotic resistance cassettes andthe isolate is sensitive to all antibiotics tested except somemembers of the -lactam family (see Table S1 in the supple-mental material). However, the resistance profile is character-istic of the presence of ampC, a gene commonly located in thechromosome of Enterobacter strains (1), of which JKB7 is anexample. Second, Tn6007 and its surrounding sequence andcellular context have features that imply sourcing of DNA fromboth the natural environment and clinical type contexts. Thesefeatures include the fact that the host was isolated as a humancommensal, the fact that Tn6007 is in a species that is actuallya common commensal, and the fact that E. cloacae is a knownmediator of multidrug-resistant nosocomial infections. Al-though lacking antibiotic resistance gene cassettes, Tn6007does contain a cassette with a gene that encodes an antimicro-bial membrane Transporter. A highly similar version of thiscassette, qacE2b, has also been found inserted into clinical-type class 1 integrons. In contrast, the first of the two cassettesin the array is novel, has no obvious relatives, has not beenpreviously seen in integrons, class 1 or otherwise, and is moreconsistent with the cassette “type” likely to be recovered fromchromosomal integrons or from metagenomic studies (15). Ingeneral, clinical-type class 1 integrons totally lacking antibioticresistance cassettes, where cassettes are present, are highly



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

unusual, if not undescribed. In contrast, cassette arrays withgenes that do not encode resistance are the norm in class 1integrons that are not associated with Tn402-like transpositionfunctions.

The broad family of res hunter-type transposons appears tobe widely dispersed in soil bacterial communities (29). Mostmembers of this broader family are generally associated with amer operon. Since the mer type of transposons has also beenrecovered from permafrost communities, it has been postu-lated that the association of mer genes with res hunter-typetransposition genes is an association that has been selected forover relatively long periods of time. This hypothesis is sup-ported by the observation that mer-associated transpositionmodules are relatively divergent (30). In contrast, until now,only two examples of res hunter-type transposition modules forwhich there is complete sequence information have been re-ported to be associated with class 1 integrons. These modulesare linked to the integrons in Tn402 and plasmid pTB11 (47).Although these two integrons have different resistance cassettearrays, the transposition backbones are identical, implying thatthey are likely descendants of a very recent common ancestor.In contrast, the tni module in Tn6007 appears to be a hybridcompared to Tn402. The transposon that has the tniQBA com-ponent of the transposition module in common with Tn6007has not been identified yet, but it clusters close to other mer-type members (96% DNA identity in the case of Tn5718).Thus, the so-far-unidentified relative probably also possessed amer operon. As a consequence, we speculate that the recom-bination event that led to the formation of the hybrid probablytook place in a soil bacterial community, but, irrespective ofthe actual location, it is clear that different members of the reshunter family are common in bacterial communities. The re-combination crossover point that brought the two parts of thehybrid together is located within the res site. It is likely, there-fore, that the mediating event was site specific and involvedTniR-mediated resolution of the two parents located in thesame replicon. Such an event has previously been suggested forevolution of some blaTEM-containing transposons (36) and forevolution of a transposon in pRMH760 (35). Based on theinformation available, we concluded only that Tn6007 is ahybrid compared to Tn402. However, it cannot be stated de-finitively which of these two transposons was one of the twoparents and which was the product of recombination.

Tn6007 is closely linked to a second, defective transposon,Tn6008. Tn6008 is of interest as it is linked to Tn6007 suchthat the two transposons can transpose as a single unit,Tn6006. This is clear from its location in Tn6005, since thesignature direct repeats of transposition in the Tn5036/Tn3926 backbone flank the Tn6006 module. The internalstructure of Tn6008 is unusual. Tn6008 does not contain anyknown antibiotic resistance or virulence genes, although itdoes contain four novel genes. Furthermore, this transposonhas never previously been observed in clinical isolates; itsonly other known location, albeit in rearranged form, is inthe genome of the plant pathogen X. campestris pv. vesica-toria. The presence of Tn6008 in two separate locations,however, demonstrates that it is mobilizable when the re-quired transposition proteins can be provided in trans, astransposition assays described here also demonstrated.These observations emphasize that the opportunity to mo-

bilize defective transposons belonging to the Tn402 family isgreat and helps to explain the broad distribution of theclinical type of class 1 integrons despite the fact that they aredefective transposons. Moreover, this type of transpositionin trans can probably occur between disparate members ofthe family since IRi and IRt tend to be relatively conserved.Transposition studies performed here reinforced this hy-pothesis, since transposition of Tn6007 and Tn6008 wasmediated by tni gene products from both modules and, inthe case of Tn6008, was detected even in the absence ofdirect selection.

Tn5036 and Tn3926 and their close relatives contribute sig-nificantly to multidrug-resistant nosocomial infections as theyhave been responsible for the capture and subsequent spreadof class 1 integrons and various resistance cassettes on multipleoccasions (25, 34). Interestingly, Tn5036 was isolated from anE. cloacae strain obtained from the intestine of a toad, andTn3926 was isolated from a Yersinia enterocolitica strain foundin milk in France (57). One of the major lineages of Tn5036/Tn3926 integron-containing derivatives is that typified byTn1696 (37), and numerous independent clinical isolates thatcontain an integron at the same point in the transposon back-bone, as observed for Tn1696, have been identified (Fig. 3).Tn6005 represents another example of a class 1 integron in thesame Tn5036/Tn3926 backbone; the single important differ-ence is that the insertion point is different, indicating that thistransposon must have been derived from a different lineagethan Tn1696. This similarly emphasizes the continued evolu-tion of transposition modules occurring outside the clinicalcontext and their ability to make their way into human com-mensals.

Antibiotic-resistant bacteria that we now know containclass 1 integrons were isolated in the earliest years of theantibiotic era and are still being isolated (32, 55). Largely asa result of this observation, it has been speculated that class1 integrons may have been widespread in bacteria prior tothe antibiotic era (37). It is only recently, however, thatmore direct evidence for this has been found (45). What isnonetheless still surprising is the possible scale of thisspread; the results of quantitative PCR with metagenomicDNA have implied that up to 10% of bacterial cells intypical communities could carry an intI1 gene (13). To date,only a subset of the class 1 integrons, specifically the inte-grons associated with Tn402-like transposons, have played akey role in the spread of antibiotic resistance. However,evidence that this class 1 subset is also prevalent in generalmicrobial communities continues to emerge, and this maynot be solely due to antibiotic era contamination. Complextransposons of the type described here provide more specificevidence that the origin of mobile DNA in clinical isolates,which is an ever-increasing global clinical problem, is thebroader environment.

ACKNOWLEDGMENTS

This work was supported by grant 331601 from the National Healthand Medical Research Council of Australia.

We thank Jon Iredell and Sally Partridge of the Centre for Infec-tious Diseases and Microbiology, Westmead Hospital, for antimicro-bial screening. We thank Vilma Stanisich for providing pUB307 andRuth Hall and Tina Collis for providing pRMH236.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

REFERENCES

1. Ambler, R. P. 1980. The structure of beta-lactamases. Philos. Trans. R. Soc.Lond. B 289:321–331.

2. Barlow, R. S., J. M. Pemberton, P. S. Desmarchelier, and K. S. Gobius. 2004.Isolation and characterization of integron-containing bacteria without anti-biotic selection. Antimicrob. Agents Chemother. 48:838–842.

3. Bennett, P. M., J. Grinsted, and M. H. Richmond. 1977. Transposition ofTnA does not generate deletions. Mol. Gen. Genet. 154:205–212.

4. Boucher, Y., M. Labbate, J. E. Koenig, and H. Stokes. 2007. Integrons:mobilizable platforms that promote genetic diversity in bacteria. TrendsMicrobiol. 15:301–309.

5. Brown, H. J., H. W. Stokes, and R. M. Hall. 1996. The integrons In0, In2 andIn5 are defective transposon derivatives. J. Bacteriol. 178:4429–4437.

6. Bunny, K. L. 1997. Expression of cassette-associated antibiotic resistancegenes in class 1 integrons. Ph.D. thesis. Macquarie University, Sydney, Aus-tralia.

7. Chen, S., S. Zhao, D. G. White, C. M. Schroeder, R. Lu, H. Yang, P. F.McDermott, S. Ayers, and J. Meng. 2004. Characterization of multiple-antimicrobial-resistant salmonella serovars isolated from retail meats. Appl.Environ. Microbiol. 70:1–7.

8. Davies, J. 1994. Inactivation of antibiotics and the dissemination of resis-tance genes. Science 264:375–382.

9. Ezraty, B., L. Aussel, and F. Barras. 2005. Methionine sulfoxide reductasesin prokayotes. Biochim. Biophys. Acta 1703:221–229.

10. Gillings, M., Y. Boucher, M. Labbate, A. Holmes, S. Krishnan, M. Holley,and H. W. Stokes. The evolution of class 1 integrons and the rise of antibioticresistance. J. Bacteriol. 190:5095–5100.

11. Hall, R. M., H. J. Brown, D. E. Brookes, and H. W. Stokes. 1994. Integronsfound in different locations have identical 5� ends but variable 3� ends. J.Bacteriol. 176:6286–6294.

12. Hall, R. M., and C. M. Collis. 1998. Antibiotic resistance in gram-negativebacteria: the role of gene cassettes and integrons. Drug Res. Updates 1:109–119.

13. Hardwick, S. A., H. W. Stokes, S. Findlay, M. Taylor, and M. R. Gillings.2008. Quantification of class 1 integron abundance in natural environmentsusing real-time PCR. FEMS Microbiol. Lett. 278:207–212.

14. Hillas, P. J., F. Soto del Alba, J. Oyarzabal, A. Wilks, and P. R. Ortiz deMontellano. 2000. The AhpC and AhpD antioxidant defense system ofMycobacterium tuberculosis. J. Biol. Chem. 275:18801–18809.

15. Holmes, A. J., M. R. Gillings, B. S. Nield, B. C. Mabbutt, K. M. H. Neva-lainen, and H. W. Stokes. 2003. The gene cassette metagenome is a basicresource for bacterial genome evolution. Environ. Microbiol. 5:383–394.

16. Houang, E. T., Y. W. Chu, W. S. Lo, K. Y. Chu, and A. F. Cheng. 2003.Epidemiology of rifampin ADP-ribosyltransferase (arr-2) and metallo-beta-lactamase (blaIMP-4) gene cassettes in class 1 integrons in Acinetobacterstrains isolated from blood cultures in 1997 to 2000. Antimicrob. AgentsChemother. 47:1382–1390.

17. Juanjuan, D., Z. Zhiyong, L. Xiaoju, X. Yali, Z. Xihai, and L. Zhenzhen.2007. Retrospective analysis of bacteremia because of Enterobacter cloa-cae compared with Escherichia coli bacteremia. Int. J. Clin. Pract. 61:583–588.

18. Kamali-Moghaddam, M., and L. Sundstrom. 2000. Transposon targetingdetermined by resolvase. FEMS Microbiol. Lett. 186:55–59.

19. Kholodii, G. Y., S. Z. Mindlin, I. A. Bass, O. V. Yurieva, S. V. Minakhina,and V. G. Nikiforov. 1995. Four genes, two ends, and a res region areinvolved in transposition of Tn5053: a paradigm for a novel family of trans-posons carrying either a mer operon or an integron. Mol. Microbiol. 17:1189–1200.

20. Kholodii, G. Y., O. V. Yurieva, O. L. Lomovskaya, Z. Gorlenko, S. Z. Mind-lin, and V. G. Nikiforov. 1993. Tn5053, a mercury resistance transposon withintegron’s ends. J. Mol. Biol. 230:1103–1107.

21. Koh, T. H., L. H. Sng, G. C. Wang, L. Y. Hsu, and Y. Zhao. 2007. IMP-4 andOXA beta-lactamases in Acinetobacter baumannii from Singapore. J. Anti-microb. Chemother. 59:627–632.

22. Leverstein-van Hall, M. A., H. E. M. Blok, R. T. Donders, A. Paauw, A. C.Fluit, and J. Verhoef. 2003. Multidrug resistance among Enterobacteriaceae isstrongly associated with the presence of integrons and is independent ofspecies or isolate origin. J. Infect. Dis. 187:251–259.

23. Leverstein-van Hall, M. A., H. E. M. Blok, A. Paauw, A. C. Fluit, A. Troel-stra, E. M. Mascini, M. J. M. Bonten, and J. Verhoef. 2006. Extensivehospital-wide spread of a multidrug-resistant Enterobacter cloacae clone,with late detection due to a variable antibiogram and frequent patient trans-fer. J. Clin. Microbiol. 44:518–524.

24. Leverstein-van Hall, M. A., A. Paauw, A. T. A. Box, H. E. M. Blok, J. Verhoef,and A. C. Fluit. 2002. Presence of integron-associated resistance in thecommunity is widespread and contributes to multidrug resistance in thehospital. J. Clin. Microbiol. 40:3038–3040.

25. Liebert, C. A., R. M. Hall, and A. O. Summers. 1999. Transposon Tn21,flagship of the floating genome. Microbiol. Mol. Biol. Rev. 63:507–522.

26. Literak, I., R. Vanko, M. Dolejska, A. Cızek, and R. Karpıskova. 2007.Antibiotic resistance Escherichia coli and Salmonella in Russian rooks (Cor-

vus frugilegus) wintering in the Czech Republic. Lett. Appl. Microbiol. 45:616–621.

27. Martinez, E., and F. de la Cruz. 1990. Genetic elements involved in Tn21site-specific integration, a novel mechanism for the dissemination of antibi-otic resistance genes. EMBO J. 9:1275–1281.

28. Mazel, D. 2006. Integrons: agents of bacterial evolution. Nat. Rev. Microbiol.4:608–620.

29. Minakhina, S. V., G. Kholodii, S. Mindlin, O. Yurieva, and V. Nikiforov.1999. Tn5053 family transposons are res site hunters sensing plasmidal ressites occupied by cognate resolvases. Mol. Microbiol. 33:1059–1068.

30. Mindlin, S., G. Kholodii, Z. Gorlenko, S. Minakhina, L. Minakhina, E.Kalyaeva, A. Kopteva, M. Petrova, O. Yurieva, and V. Nikiforov. 2001.Mercury resistance transposons of Gram-negative environmental bacteriaand their classification. Res. Microbiol. 152:811–822.

31. Mollet, C., M. Drancourt, and D. Raoult. 1997. rpoB sequence analysis as anovel basis for bacterial identification. Mol. Microbiol. 26:1005–1011.

32. Nakaya, R., A. Nakamura, and Y. Murata. 1960. Resistance transfer agentsin Shigella. Biochem. Biophys. Res. Commun. 3:654–659.

33. Paauw, A., J. Verhoef, A. C. Fluit, H. E. Blok, T. E. Hopmans, A. Troelstra,and M. A. Leverstein-van Hall. 2007. Failure to control an outbreak ofqnrA1-positive multidrug-resistance Enterobacter cloacae infection despiteadequate implementation of recommended infection control measures.J. Clin. Microbiol. 45:1420–1425.

34. Partridge, S. R., H. J. Brown, H. W. Stokes, and R. M. Hall. 2001. Trans-posons Tn1696 and Tn21 and their integrons In4 and In2 have independentorigins. Antimicrob. Agents Chemother. 45:1263–1270.

35. Partridge, S. R., and R. M. Hall. 2004. Complex multiple antibiotic andmercury resistance region derived from the r-det of NR1 (R100). Antimi-crob. Agents Chemother. 48:4250–4255.

36. Partridge, S. R., and R. M. Hall. 2005. Evolution of transposons containingblaTEM genes. Antimicrob. Agents Chemother. 49:1267–1268.

37. Partridge, S. R., G. D. Recchia, H. W. Stokes, and R. M. Hall. 2001. Familyof class 1 integrons related to In4 from Tn1696. Antimicrob. Agents Che-mother. 45:3014–3020.

38. Paterson, G. K., C. E. Blue, and T. J. Mitchell. 2006. An operon in Strepto-coccus pneumoniae containing a putative alkylhydroxyperoxidase D homo-logue contributes to virulence and the response to oxidative stress. Microb.Pathog. 40:152–160.

39. Paulsen, I. T., T. G. Littlejohn, P. Rådstrom, L. Sundstrom, O. Skold, G.Swedberg, and R. A. Skurray. 1993. The 3� conserved segment of integronscontains a gene associated with multidrug resistance to antiseptics and dis-infectants. Antimicrob. Agents Chemother. 37:761–768.

40. Rådstrom, P., O. Skold, G. Swedberg, J. Flensburg, P. H. Roy, and L.Sundstrom. 1994. Transposon Tn5090 of plasmid R751, which carries anintegron, is related to Tn7, Mu, and the retroelements. J. Bacteriol. 176:3257–3268.

41. Rowe-Magnus, D. A., A.-M. Guerout, and D. Mazel. 2002. Bacterial resis-tance evolution by recruitment of super-integron gene cassettes. Mol. Mi-crobiol. 43:1657–1669.

42. Rubens, C. E., W. F. McNeill, and W. E. Farrar, Jr. 1979. Transposableplasmid deoxyribonucleic acid sequences in Pseudomonas aeruginosa whichmediates resistance to gentamicin and four other antimicrobial agents. J.Bacteriol. 139:877–882.

43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

44. Schluter, A., R. Szczepanowski, A. Puhler, and E. M. Top. 2007. Genomicsof IncP-1 antibiotic resistance plasmids isolated from wastewater treatmentplants provides evidence for widely accessible drug resistance gene pool.FEMS Microbiol. Rev. 31:449–477.

45. Stokes, H. W., C. Nesbø, L. M. Holley, I. M. Bahl, M. R. Gillings, and Y.Boucher. 2006. Class 1 integrons potentially predating the association withTn402-like transposition genes are present in a sediment microbial commu-nity. J. Bacteriol. 188:5722–5730.

46. Summers, A. O. 2006. Genetic linkage and horizontal transfer, the roots ofthe antibiotic multi-resistance problem. Anim. Biotechnol. 17:125–135.

47. Tennstedt, T., R. Szczepanowski, I. Krahn, A. Puhler, and A. Schluter. 2005.Sequence of the 68,869 bp IncP-1alpha plasmid pTB11 from a wastewatertreatment plant reveals a highly conserved backbone, a Tn402-like integronand other transposable elements. Plasmid 53:218–238.

48. Thomas, L., B. Espedido, S. Watson, and J. Iredell. 2005. Forewarned isforearmed: antibiotic resistance gene surveillance in critical care. J. Hosp.Infect. 60:291–293.

49. Tillett, D., and B. A. Neilan. 2000. Xanthogenate nucleic acid isolation fromcultured and environmental cyanobacteria. J. Phycol. 36:251–258.

50. Toleman, M. A., H. Vinodh, U. Sekar, V. Kamat, and T. R. Walsh. 2007.blaVIM-2-harboring integrons isolated in India, Russia, and the United Statesarise from an ancestral class 1 integron predating the formation of the 3�conserved sequence. Antimicrob. Agents Chemother. 51:2636–2638.

51. Van, T. T., G. Moutafis, L. T. Tran, and P. J. Coloe. 2007. Antibioticresistance in food-borne bacterial contaminants in Vietnam. Appl. Environ.Microbiol. 73:7906–7911.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

52. van Belkum, A., W. Goessens, C. van der Schee, N. Lemmens-den Toom,M. C. Vos, J. Cornelissen, E. Lugtenburg, S. de Marie, H. Verbrugh, B.Lowenburg, and H. Endtz. 2001. Rapid emergence of ciprofloxacin-resistantEnterobacteriaceae containing multiple gentamicin resistance-associated in-tegrons in a Dutch hospital. Emerg. Infect. Dis. 7:862–871.

53. Villa, L., and A. Carattoli. 2005. Integrons and transposons on the Salmo-nella enterica serovar Typhimurium virulence plasmid. Antimicrob. AgentsChemother. 49:1194–1197.

54. Wang, G., and R. J. Maier. 2004. An NADPH quinone reductase of Helico-

bacter pylori plays an important role in oxidative stress and host colonization.Infect. Immun. 72:1391–1396.

55. Watanabe, T., and T. Fukasawa. 1960. “Resistance transfer factor,” an episomein Enterobacteriaceae. Biochem. Biophys. Res. Commun. 3:660–665.

56. Weldhagen, G. F. 2004. Integrons and beta-lactamases: a novel perspectiveon resistance. Int. J. Antimicrob. Agents 23:556–562.

57. Yurieva, O., G. Kholodii, L. Minakhina, Z. Gorlenko, E. Kalyaeva, S. Mindlin,and V. Nikiforov. 1997. Intercontinental spread of promiscuous mercury-resis-tance transposons in environmental bacteria. Mol. Microbiol. 24:321–329.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

a class 1 integron present in a human commensal has a hybrid

Documents