by mira a. raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/pqdd_0026/mq50863.pdf · mention to nazgol...
TRANSCRIPT
![Page 1: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/1.jpg)
Regulated Expression of the v-rel Oncogene In Vitro and In Vivo
BY Mira A. Rao
Department of Microbiology and Immunology
McGill University Montreal, Quebec
March 15, 1999
A thesis submitted to the Faculty of Graduate Studies and
Research in partial fulfillment o f the requirements for the degree of Master of Science.
Copyright O Mira A. Rao, 1999
![Page 2: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/2.jpg)
National Library Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or seii copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fkom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits saas son autorisation.
![Page 3: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/3.jpg)
Résumé
Le virus aviaire reticuloendothelial de type T (REV-T) est l'un des plus
transformant parmi les retrovirus connus et a été démontré capable de transformer une
large variété de lymphocytes. L'oncogène d'origine virale v-rel, un membre de la famille
Rel/NFkB, procure au virus REV-T le pouvoir de transformer les cellules. Bien que la
capacité transfomante de v-rel est associée a la perturbation du fonctionnement normal
de NF-KB, les mécanismes intracellulaires menant à la transformation sont inconnus.
Nous avons utilisé le système de vecteurs RCAS (Replication Competent Avian
Leukosis LTR With Splice Accepter) pour infecter les cellules du poulet et par
constiquent permettre la dissémination du gène cloné v-rel in vivo. De plus, le système de
vecteurs RCAS a été combiné à un système d'expression de gènes dépendant de la
tétracycline afin de permettre I'expression conditionnelle de l'oncogène viral v-rel des
poulets transgéniques.
A l'aide de ce nouveau système, nous avons réussi a étudier in-situ la
transformation par l'oncogène v-rel. En analysant les ceIlules affectées par la
transformation due à v-rel, nous espérions mieux comprendre le mécanisme menant a la
transformation cellulaire par v-rel. Nos résultats préliminaires suggèrent que les
lymphocytes B des poulets transgéniques pour l'expression de v-rel sont transformées.
L'analyse phénotypique de ces cellules a démontré que les cellules transformées ne
représentent pas toutes les étapes de la différentiation des lymphocytes B, mais plutôt
possèdent le phénotype des lymphocytes matures.
![Page 4: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/4.jpg)
Abstract
The avian reticuloendothelial virus strain T (REV-T) is among the most overtly
transforming of al1 known retrovimses, and has been shown to transfonn a wide range of
lymphocytes. The transforming ability of REV-T is attributed the v-rel oncogene, a
member of the R~VNFKB family of transcription factors. AIthough it is believed that v-
rel mediated transformation involves the disregulation of normal NF43 fiuiction, the
intracellular requirements for transformation are still unknown.
We have used the RCAS vectors (Replication Comptent Avian Leukosis LTR
with Splice Acceptor) for infection and dissemination of viral particles in chicken cells,
permitting sornatic transgenesis of the v-rel oncogene in vivo. In addition, the RCAS
system has been combined with a tetracycline regulated gene expression system, in order
to allow for conditional expression of the v-rel oncogene in transgenic birds.
Using this novei system, we have been able to study in siru transformation by the
i v e 1 oncogene. By addressing the questions pertaining to the cells targeted for
transformation by v-rel, we hoped to gain a better understanding of the mechanism for v-
rel mediated transformation. Preliminary data suggests that B cells were targeted for
transformation by v-rel in the truisgenic birds. Phenotypic analysis revealed that
transformed cells were not representative of al1 stages of B ce11 development, but rather
had a mature B ce11 phenotype.
![Page 5: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/5.jpg)
Ac knowledgements "The best does not corne alone.
It cornes with the Company of the ail." -Rabindranath Tagore
First and foremost, 1 would like to thank my supewisor, Dr. Michael J. FI.
Ratcliffe, not only for financial support, but also for his guidance. Thank you Mike, for
taking me into your lab, for teaching me how a scientist thinks and for sharing with me
your energy and enthusiasm for research.
I do not think it is possible to express how important my family is in my life.
Their unwavering love and support mean the world to me. My mother, Dr. Leticia G.
Rao, and my father, Dr. A. Venket Rao, have always encouraged me to reach for my
goals, and have supported me through every adventure 1 have embarked on. My sister
Maya, who probably knows me better than anyone else, is a major force in my Iife and
for the past 24 years I have admired and looked up to her.
During my time in Montreal 1 have met so many wondefi1 people who have had
a great impact on my life. My fnends in the Chicken Lab, past and present, include
Sandra Iacampo, Camil Sayegh, Ken McDonald, Karen Jacobson, Sandy Demaries and
Onaldo Martinez (fkom whom 1 inhented the project). Together we had some great
laughs. 1 have to thank each and every one of them for showing me the ropes in the lab.
Also, "Merci" à Carnil for the translation of my abstract.
Unfortmately, one page is not enough to nme al1 of the people who have been so
important to me during my Master's years. But, I d e f ~ t e l y have to give a special
mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John
Lewis, Madani Thiarn, Maricar Polintan and Chantal Abouchar. By lending me an ear or
a shoulder, or by sharing a joke and a laugh, these fnends have seen me at my best and at
my worst.
As Tagore said, "The best does not corne alone" ... These are the individuals who
make up rny "dl".
![Page 6: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/6.jpg)
Table of Contents
Page -. Resume ..... . -.... . .. . . . . -. . . . . . . . ..... . .. -. -. - -. - --. -- -. - .-. .-.-... -. . . -. - ---. . .. . - . . . . . . -. . . - . . . . . . . . . ... ... .. -. . ... .. -. .il
Introduction
A. The R e m - K B Family __.___-... ~._--__.*-.*-~*-.-.----.-....-*..-.........-.---....-.--.--..-.-......-...- 1
i. Function & Regdation ....-. . . .--. -. - .- - -. -. . . - - . . . . . .. . . . . . . . . - - - - - - - .. .. . . . .. . . . 1
ii. ReW-icB in Infiammatory & Acute Phase Responses ..---..-.-........-.---.-. 6 .-a
111. R~VNF-KB in Development -.... . . . . . -. -. -. - -. -. - -. . -. -. . . - - --. - -. . . . . . - -. - - - -- - - - - - - - - - - - - - - - - - - - 7
iv. ReljNF-d3 in Lymphocyte Activation & Proliferation --..-..-..-----*--...--*-*-- 8
The v-rel Oncogene .......... .--- .. ............................................ ..-.. -----..----- - ---.- -.-...-.-..-.. 1 O
i. RevT & the v-rel Oncogene ....................................................................... 10
ii. The Helper Virus Dichotomy: RevT vs, C W ..-*-----.-......----.--.-..-.--..-.----.- 11 * *.
111. v-Re1 vs. v-Rel* ...----.-.-.-...--..-.........-.--.-.-...--.-.-------.------....-----.-.-.-...---+--.----.- 12
Transformation by the v-rel Oncoprotein . - - - - -. - -. - - . - . - - - . - -. . . . . - -. . - - -. - - -. -. . . . . . . . . . . . . . . -. . - -. -. 13
i. v-Rel as a Domhant Negative Mutant- .-. ..-..-...-. -- - .. ... - --*- . .-- - - - -. - - - - -. - - - - --. .. .-. 14
ii. The Active Mode1 for v-Re1 Transformation ............................................ 14
iii. v-Re1 Mediated transformation ....--...-.-- .-.-.-..--..-.-.-.. .-.------.-.-.-.-.......-..-.--.-. 16
iv. Activation of AP- 1 genes by v-Rd. - - - . - - a . . . . . * .. . - a . - - -. . . . . - - - - - -. * - a . a - -. . . . .. - -. -. - - . - - - 17
v. v-Re1 & Apoptosis ...................................................................................... 18
B Ce11 Development in Chicken ............................................................................. 20
i- B Ce11 Development: M-als vs. Bir& ..--....-........-*--- -....-.-*..*.-....**. * * - - * 20
ii. BlJrsa of Fabriciw ---.-.-.-.-.-......--.-..--.--.-..-.-..--....-.-.*--...-..--..-.-.--..----.-..-- 21 .S .
111. The Fate of Bursal Cells ........................................................................... 22
22 iv. Summary of B Ce11 Development .-..-.-.---.--*-.---.**.....--.----..-. *
![Page 7: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/7.jpg)
24 ........................................................................................... 11 . Materials & Methods
III . Construction of the TRE/u-reï* Vector
A . Introduction ....................................................................................................... 37
B . Results ............................................................................................................... 44
C . Discussion ......................................................................................................... 56
IV . In Vitro Assays of the TRE/v-rel* Constructs
A . Introduction ....................................................................................................... 59
B . Results ............................................................................................................... 59
C - Discussion ......................................................................................................... 67
V . in Vivo Expression of v-Rel*
A . Introduction ..........................-............................................................................ 72
B . Results ............................................................................................................... 77
C . Discmsion.. ....................................................................................................... 87
ma GeneraI Codusions ........................... :: .............................................................. 93
VI1 . References ........................................................................................................... 96
![Page 8: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/8.jpg)
Ab breviations
ARB: Antigen Retrieval Buffer
BSS: Balanced Salt Solution
CEF: Chick embryo fibroblast
CS: Chicken serum
CSV: Chicken Spcit id Virus
D'PBS: Dubelcco's PBS
FCS: Fetal caif s e m
FITC: Flourescein isothiocyanate
H+E: Hernatoxylin & eosin
IMDiM: Iscove's Modified Dulbecco's Medium
IgH: lmmunoglobulin heavy chah
IgL: Immunoglobul in light chah
K: Kozak
NF-&: Nuclear Factor-kappa B
NLS: Nuclear Localization Signal
PBL: Peripheral Blood Lymphocyte
PBS: Phosphate BufTered Saline
PE: Phycoerithryn
PEG: Polyethylene Glycol
PA: Polyadenylation signal
PMA: Phorbol myristic acetate
R C M : &plication ompetent pian leukosis LTR & go splice acceptor
RCAS: Replication competent Man leukosis LTR & #ce acceptor
Rev T: Reticuloendothelial virus strain T
RHD: Re1 Homology Domain
Tet: Tetracycline
Tg: Transgene
TRE: Tetracycline responsive element
tTA: Tetracycline sensitive transactivator
vii
![Page 9: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/9.jpg)
List of Figures Page
Figure 1 . The Rel/NF-d Family of Transcription Factors .......................................... 3
Figure 2 . Activation of Rel/NF-icB Trawcription Factors ......................................... 5
Figure 3 . Curent Models for v-Re1 Mediated transformation ..................................... 15
.............................................. Figure 4 . The RCAS Retroviral Gene Transfer Cassette 40
Figure 5 . Somatic Tmgenesis by RCAS Vecton in viîro & in vivo ........................ 42
Figure 6 . Conditional Expression of Transgenes Using the RCAS System ................ 44
Figure 7- The RCAS:tTA Constmct ..... .. ....................................................................... 48
Figure 8 . M o w i n g Clal 2:T Shutîie Vector by Addition of a Kozak Sequencc ...... 49
Figure 9 . Modifying Clal2TP Shuttle Vector by Addition of a Kozak Sequence ..... 50
Figure 10 -nie Clal 23-K and C ~ a l ~ ~ ~ Shuale Vectors ......................................... 51
Figure 11 . Cloning TREK & TRE/WPA into RCAS(B) and RCAN(B) ................... 52
Figure 12 . n e PRAO 1 Adapter P ~ ~ s ~ i d ....................................................................... 53
Figure 13 . The pRA02 plasmid ... Cloning of v-rel* into pIWO 1 ................................ 54
Figure 11 . Cloning v-rel* into the RCAS Based Vectors ............................................. 55
Figure 15 . Transfected and Mected CEFs express High Levels of Viral Protein ...... 60
Figure 16- The tTA is Required for Expression of v-Rel* ............................................ 61
Figure 17 . Conditional expression of v-Rel* in vitro. ................................................... 63
Figure 18 . Screening for tTA transgenic birds by Flow Cytornetry ............................ 64
Figure 19 . Bursai Celis are Transformed by RevT(CSV) and not by pRA07 ............ 65
Figure 20- Splenic Lymphoc~tes are T r a n s f ~ ~ e d by pRA07 .................................... 66
Figure 21 . Cell Surface Markers on Avian B cells ....................................................... 73
Figure 22- SOITAC TraWFnesis of conditional v-rel* ............................................... 76
Figure 23 . v-Rel* is Expression in Lymphocytes by Transgenic Birds (- tet)... ......... 79
Figure 21 . In.6ltration of Lymphocytes in the Liver ........~............................................ 80
Figure 25 . Transfomed Cells in the Liver are B Lymphocytes ................................... 81
Figure 26 . B ce11 Tumors in the Liver of v-Rel* Transgenic Birds .............................. 83
Figure 27 . B u r d Cells fkom Transgenic Buds Have a Normal Phenotype ................ 84
Figure 28 . v-Rel* Transformed B Cells in the Spleen & Liver of Transgenic Birds,.85
Figure 29 . Transformed Celis Have a Mature B CeIl Phenotype ................................. 86
viii
![Page 10: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/10.jpg)
Chapter 1. Introduction
Several retrovinises have k e n implicated in cellular transformation, which is a
process that results in unuihibited ce11 growth and proliferation. Uncontrolled growth of
this nature ultimately gives rise to tumor formation. The reticuloendothelial virus strain
T (RevT) is an acutely transfonning retroviruses. In fact, RevT is arnong the mon
overtly transforming of al1 known retroviruses, and it rapidly induces fatal lymphomas in
young chickens (Barth and Humphries, 1988; Barth et al., 1990). The transforming
property of RevT is attributed the oncogene v-rel, a member of the ReVnuclear factor-d
(NF-KB) family of transcriptional regulators (Nuemann et ai., 1997). Transfomation by
v-rel is the subject of the work presented in this thesis.
In spite of the numerous studies on v-rel reported in the literature, the mechanism
for v-Rel-mediated transformation is still unclear. Due to the lethal nature of v-Re1 in
chickens, there has not been an effective method to study in siru transformation by this
oncogene. Therefore, a unique system has been developed in our laboratory to generate
chickens that are transgenic for v-rel, using retrovirai gene transfer cassettes. Essential
elements of the system as well as its construction will be discussed in this thesis.
Moreovi-r, specific questions regarding the target cells of v-rel mediated transformation
will be addressed.
A. The ReVlrci-KB Family
i. Function and Regulation
The importance of the ReVNF-KB family of transcriptional regulaton in s igding
has become increasingly evident. Although NF-KB was originally identified in mature B
cells as a tissue-specific factor involved in the expression of the irnrnunoglobulin K light
chah gene (Miyamoto et al., 1994), studies have revealed R e m - K . activity in virtually
al1 ce11 types including lymphocytes, hepatocytes and osteoclasts (Gerondakis et al.,
1998; Beg et al., 1995; Iotsova et al., 1997). These eukaryotic transcription factors
regulate genes that are involved in immune and inflarnmatory responses, as well as ce11
growth and differentiation (reviewed in (Ghosh et ai., 1998)). The Rei/hiF-~ family was
![Page 11: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/11.jpg)
founded by the v-Rel oncoprotein (Wilhelmsen et al., 1984) and has since grown to
include c-Rel, the cellular homologue of v-Rel, RelA (p65), Rem, NfKbl @50), and
Nficb2 @52) (Gilmore et al., 1996). The two latter gene products result fiom post-
translational processing of precursor proteins, p 105 and p l O0 respectively.
Characteristic of most transcription factors, NF-KB hc t ions as either a homo- or
heterodimer and these dimers, generally referred to as NF-KB, can be composed of any of
the ReVNF-KB proteins described above. The NF43 dimers bind to DNA at lOBp
sequences, known as KB sites, which are found in either the promoter or the enhancer
elements of target genes; the consensus KB sequence is: 5' 4GGGYNNCCY- 3' (Ghosh
et al., 1998). The combination of ReV NF-& subunits in the NF-& dimer determines
the specificity of target genes (Perkins et al., 1 992). The pSO/RelA dimer has k e n most
thoroughly characterized and represents the prototype NF-KB molecule.
Members of the ReVNF-d3 family are identified by a conserved region in their N
tennini, the Re1 Homology Domain (RHD) (Figure 1). Sequences in this stretch of 300
amino acids are responsible for dimerization, binding to DNA at KI^ sites, nuclear
localization (via a nuclear localization signal, NLS), as well as binding to the IKB family
of inhibitory proteins (Bose, 1992). On the other hand, C proximai sequences are
rnember specific, and it is the C temini that confer differential transactivating properties
to the ReÿNF-KB molecules (Smardova et al., 1995). While the C tennini of c-Rel,
p65/RelA and RelB contain strong tramactivation dornains (TAD), neither p50 nor p52
posses homologous structures (Siebenlist et ai., 1994). The C termini of the pl05 and
pl 00 precursors, on the other hand, are homologous to the IKB inhibitory proteins since
they contain several ankyrin motifs. For this reason, these C-termini has been designated
as IKB-y and IKB-6 respectively (Nuemann et al., 1997). Since the individual ReVNF-KB
molecules have different transactivating abilities, the combination of these subunits can
influence the specificity and efficacy of the NF-& dimer.
Although NF-KB is a constitutively active nuclear factor, it is normally
sequestered in the cytoplasm of cells where it is inactive (Miyamoto et al., 1994). The
IKB inhibitors are responsible for the cytoplasmic retention of these dimers. A whole
family of inhibitory proteins, the IKB family, has now been identified, and includes
![Page 12: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/12.jpg)
Figure 1. The ReUNF-icB Famiiy of Transcription Factors. a) Al1 members of the Rel/NF-d3 family share a consewed N terminal motif, the Re1 Homology Domain (RHD), which is responsible for dimerization, nuclear translocation, DNA binding and binding to I d 3 inhibitory proteins. C termini of these proteins are rnernber-specific. While the C termini of c-Rel & p65 have strong transactivation domains (TAD), the C terminus of p50 precursor (p105) encodes a d q m repeats, also found in the I d 3 inhibitors. The black arrow shows the site of post-translational cleavage of the p50 precursor. b) The v-Re1 oncoprotein is an W-Rel -ENV hsion protein. The env encoded amino acids are depicted by black boxes at the N and C tennini of v-Rel. There is a 1 18 amino acid truncation at the C terminal end of v-Rel; therefore, the oncoprotein lacks the strong TAD of its cellular homologue. The small stars represent intemal amino acid substitution found in v-Re1 as compared to c-Rel.
![Page 13: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/13.jpg)
![Page 14: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/14.jpg)
p40A~B-a, IKB-B, I d - y , 1~B-6, pl05 and Bcl-3 (Baldwin, 1996); the most recent
addition to the family is IKB-E (Whiteside et al., 1997). Up until now, IKB-a has been
the most thoroughly characterized member of the I d family, with respect to its structure
and function (Figure 1). The N terminus of IKBU contains residues that can be
phosphorylated or ubiquinated; the central domain encodes six ankyrin repeats,
homologous to the ones found in the pl05 and pl00 precursor proteins; and the C
terminus of the inhibitory protein is rich in negatively charged amino acids maldwin,
1 996).
Recentiy, mutationai analysis of the ReÿNF-KB subunits was carried out by Beg
et al (1992(Beg et al., 1992)) to demonstrate that N F 4 3 dimers interact with the
inhibitory proteins, such as IKB-a, through their RHD. Subsequently, similar mutational
anaiysis techniques were used to show that the IKB proteins interact with the RHD of
NF-KB via their a d y i n repeats (Luque and Gelinas, 1998). Binding of IKB to the RHD
is believed to mask the NLS of R ~ W - K B proteins, which is also found in the RKD.
Therefore, occlusion of the NLS by IKB-a prevents translocation of the NF-KB dimer
from the cytoplasm to the nucleus, rendering the dirners inactive (Gilmore and Morin,
1993).
A broad range of stimuli can activate the R e m - K B transcription factors; these
include cytokines, lipopolysaccharides and phorbol esters as well as lymphocyte
induction through engagement of B or T ce11 receptors (Zurovec et al., 1998). Molecular
targets of these stimuli are the inhibitory proteins, I d (Figure 2). Upon stimulation,
IKB-a is phosphorylated at two key serine residues (Gilrnore and Morin, 1993).
Recently, Roff et al. (1996) demonstrated that phosphorylated IKBU remains bound to
NF-KB dimers. This group also established that phosphorylated I d - a is ubiquinated
pnor to degradation. Therefore, the phosphorylated I d 3 - a protein serves as a substrate
for ubiquination. Only after ubiquination does the inhibitor fall away fiom the NF-KB
dimer, and is then targeted for degradation by îhe 26s proteosorne. Having been released
from the inhibitor, NF43 dimers are free to translocate across the nuctear membrane,
enter the nucleus where they bind to d3 sites, and ultimately alter transcription of
downstrearn genes (Ghosh et ai., 1998).
![Page 15: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/15.jpg)
Figure 2. Activation of ReVNF-d3 Transcription Factors. NF-& dirners are sequestered in the cytoplasm of cells as inactive dimers by binding to inhibitory proteins of the IKB family. Upon stimulation, inhibitory proteins are first phosphorylated, then ubiquinated, afier which they fa11 away fiom the dimer and are targeted for degradation by the 26s proteosorne. Once released, the NF-KB dimer is fiee to translocate across the nuclear membrane and bind to KB sites on the DNA, where it exerts its roIe as a transcriptional regulator.
![Page 16: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/16.jpg)
Activation -
Translocation to the nucleus \
Ubiquitination of IKB
kB site - IKB-a - c-Rel
- c-myc
Figure 2. Activation of ReVNF-KB Transcription Factors
![Page 17: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/17.jpg)
NF-KB activity is controlled by an auto-regdatory mechanism since activated
NF-KB promotes transcription of the inhibitor, 1KB-a (Kopp and Ghosh, 1995).
Recently, Arenzana-Seisdedos et ai. (1 995) showed that IKB-a c m be detected in the
nuclei of cells and, more importantly, that at high levels, IKB-a can negatively regulate
NF-KB b inding to DNA. Therefore, the ReVNF-tcB famil y of transcriptional regdators
provide a system that can rapidly alter the expression of a wide array of genes in
eukaryotic cells.
ii. ReViYF-KB in Inflammatory and Acute Pbase Responses
The activation of Rei/'W-icB dimers is independent of de novo protein synthesis.
Therefore, this system is ideal for rapid responses such as infiammatory, stress and acute
phase responses. Moreover, the auto-regdatory nature of NF-KB allows for a controlled
rcsponse to extemal stimuli. Localized areas of damage caused by stress, injury or
infection provide stimuli for NF-KB activation, which include reactive oxygen species,
LPS and TNF-a (Wulczyn et al., 1996). Consequently, genes involved in both acute
phase and pro-inflamrnatory responses are regulated by NF-KB.
In mice, damage to the liver ultimately leads to the up-regdation of acute phase
proteins (APP), which are important for the protection of host cells. Interestingly,
Baumann and Gauldie (1994) were able to detect high levels of activated NF-KB in the
damaged liver tissue. They also found that NF-KB activity was proportional to the level
of APP expression.
More recently, role of NF-KB in hepatocytes was studied in repenerating liver
tissue by Cressrnan et al. (1994). The mwine liver has a high propensity for regeneration
following physical damage, and in their study Cressman et al. found elevated levels of
activated NF-KB in the rapidly dividing cells of damaged liver tissue. Although hi&
levels of p65/RelA were detected in the nuclei of these hepatocytes, it is still unclear
whether the increased rate of ce11 division was the direct result of NF-KB activity. Genes
encoding IKB-a, pSO, p65lRelA and c-rel were induced in the damaged liver tissue.
Inflarnmatory responses are equally important for the protection of host tissue and
essential elements include cytokines and ce11 adhesion molecules. Cytokines that have an
![Page 18: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/18.jpg)
integral role in inflammatory responses are IL-1, IL-2, IL-6, IL-8, IFN-P and TNF-a.
The genes for these cytokines are up regulated by activated NF-KE~ (Bach et al., 1997).
GM-CSF and G-CSF, also under the control of NF-&, are important infiammatory
mediators because they stimulate the differentiation and proliferation of macrophages and
granulocytes (Kopp and Ghosh, 1 995). Another important immediate-earl y response to
tissue damage is the up-regulation of ce11 adhesion molecules. These proteins, produced
during an inflamrnatory response, help attract circuiating immune cells to the site of
injury (reviewed in (Kopp and Ghosh, 1995)). Genes encoding the ce11 adhesion
moIecules VCAM-1 and ICAM-1 pssess KB sites in their promoters and are, indeed,
under the control of N F - a .
iii. ReVNF-a in Development
In multi-cellular organisms, ReVNF-KB factors have an important role in tissue
development. This is exemplified by Dorsal, a transcription factor identified in
Drosophila. Dorsal is homologous to NF-&, implying an evolutionary importance for
these factors, and it is a dorsallventral morphogen that is found in early developmental
stages of the Drosophila embryo (Govind and Steward, 1991). More recently, other
Dorsal related, and therefore ReVNF-KB related, proteins have been identified in
Drosophila: these include Dif and Relish, both of which have been implicated in the
immune system of these organisms (Ghosh et al., 1998).
The importance of ReVNF-KB in vertebrate development has been studied in vivo
usine murine knockout models. One such mode1 is the p65RelA knockout (Beg et al.,
1995). In these mice, the absence of RelA resulted in high levels of embryonic death.
Autopsy of the embryos revealed that the deaths were predominantly due to severe
developrnental defects in the liver. Hepatocytes were targeted for apoptosis in the
absence of RelA.
The importance of NF-KB in lyrnpbid organs has long been acknowledged.
Although it was originaily proposed that NF-& was oniy important for maintenance of
the spleen, and not for its development (Schmidt-Ullrich et al., 1996), more recent
findings have disproved this hypothesis. Caamano et al. (1998) demonstrated that the
![Page 19: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/19.jpg)
development of spleen was abnormal in ~ S W - K B ~ knockout mice. The defects
obsewed in these mice were the resuit of developmental abnormalities in the
perifollicular and the marginal zones of the spleen; B ceIl compartrnents of the spleen
were also afTected. In addition to p52/NF-KB, RelB has also been implicated in normal
hematopoetic deveiopment since mice that are knocked out for RelB exhibit
splenomegaly, due to extramedullary hernopoiesis (Weih et al., 1996).
Using an avian model, Bushdid et ai. (1998) demonstrated that NF43 has a role
in embryonic development; inhibition of NF-KB activity in deveioping chick embryos
resulted in aberrant Iimb morphology. Although the exact rnechanism of NF-& activity
is still unclear, this group has proposed that these transcription factors regdate the
expression levels of growth factors. Furtherrnore, c-Re1 is expressed at high levels in
developing chick embryos and has been implicated in the differentiation and
development of lymphoid organs therein (Abbadie et al., 1993).
iv. R e m - K B in Lymphocyte Activation and Proliferation
Activation of lymphocytes results in ce11 division, differentiation or apoptosis.
The R e w - t c B members have been irnplicated in determining the final outcome of
lymphocyte induction. While the importance of RelB has been demonstrated for
lymphocyte development, knockout models for other R ~ N - K B members (c-Rel,
pSO/NF-KB1 and p65/ReIA) have also revealed the importance of these subunits in
lymphocyte activation (reviewed in (Gerondakis et al., 1998)). Although the B and T
cells in these knockout mice develop normaily, they exhibit a hypoproliferative response
to mitogenic, cytokine and LPS stimulation.
Interestingly, the composition of NF-KB dimers is not static throughout
lymphocyte developrnent. Liou and CO-workers (1994) were able to show that specific
combinations of Rem-KB members were preferentidy activated at different stages of
B ce11 development. At the pre-B cell stage, pSO/p65 was the main dimer, while in
mature B cells the c-ReVpSO dimer was predominantly activated. Finally, this poup
found that p52/RelB was the active NF-& dimer in terminally differentiated B cells.
Since previous studies have shown that NF-KB specificity is dependent on the
![Page 20: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/20.jpg)
combination of Rel/NF-~i3 subunits in the dimer (Perkins et al., 1992), these findings of
Liou et ai. imply that different genes are induced at the various stages of B ceil
development and activation.
Proliferation of activated B cells is a fimdamentai step in immune responses to
various stimuli, and the ReüNF43 famiiy were found to have a prominent role in this
process. Lymphocytes derived fiom mice lacking the c-rel proto-oncogene exhibit an
impeded proliferative response (Kontgen et al., 1995). These findings were also
observed in rnice that expressed a mutated form of c-Re1 that was vuncated for its C
terminus (Carrasco et al., 1998). Although the mutant c-Re1 still possessed an intact
RHD, it lacked the strong transactivating domain (TAD), demonstrating that the
transactivating property of c-Re1 is required for normal B ce11 proliferation.
In addition to impaired proliferative responses (described above), lymphocytes
with attenuated NF-KB activity exhibit defects in ce11 cycle progression. Following
mitogenic activation, B cells that were missing either Nkb-1 (NF439 or c-Re1 (c-Rel")
were arrested in the G1 stage of ce11 cycle (Grumont et al., 1998). Other studies have
demonstrated that the activity of RelA in lymphocytes is intimately Iuiked to the cyciine-
dependent kinase (cdk) 2 (Perkins et al., 1997). These findings suggest that NF-KB
interacts with the ce11 cycle machinery in proliferating cells.
In an h u n e response, B lymphocytes ultimately undergo terminal
differentiation to pIasma cells. This process involves isotype switching of the
immunoglobulin heavy chah Murine knockout models have revealed that the Rel/NF-
KB proteins are involved in this process as well. Mice that lacked c-Re1 were severely
reduced in both memory and germinal center % ceil compartments (Tumang et al-? 1998).
This lack of mature B lymphocytes implicates a defect in terminal differentiation of these
cells. possibly at the level of imrnunoglobulin class switching. The c-Re1 knockout
mouse is not the only mode1 to exhibit this phenotype, and mice that are knocked out for
pSOMF-KB 1 also manifest defects in isotype switching (Snapper et al.96). The
possibility that R e W - K B transcription factors are involved in the process of isotype
switching is not measonable since d3 elements have k e n identified in the regions
responsible for Cy 1 and Cy3 expression (Tumang et al., 1998).
![Page 21: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/21.jpg)
The R e W - d family is involved in many aspects of cellular activation and
development at the level of transcriptional regdation. Therefore, the consequences of
dysregulated R e m - K B activity c m be severe. Indeed, aberrant expression of c-rel and
nfKbl due to chromosomal rearrangements have k e n observed in human tumors (Lu et
ai., 1991 ; Neri et al., 1991). While normal c-Re1 activity is essentid in eukaryotic cells,
expression of the viral homologue (v-Rel) can result in neoplastic growth. Although the
exact mechanism of v-rel mediated transformation has yet to be elucidated,
understanding how and what this oncogene transforms can ultimately enhance our
understanding of both aormai and altered ReVNF-d3 activity in general.
B. The v-rel Oacogene
i. RevT and the v-rel oncogene
The reticuloendothelial virus strain T (RevT) was initially isolated fiom a turkey
suffering from a reticular disease (Theilen et al., 1966)- Since then, it has been
detennined that RevT is among the most overtly transforming of al1 known retrovimses,
and when RevT was used to infect neonatal chicks, it resulted in fatal tumors and death
within two weeks (Barth and Humphries, 1988). RevT is a replication defective
retrovirus that encodes a single functional gene: v-rel (reviewed in (Nuemann et al.,
1997)). Both the gag and pu1 genes of RevT have been truncated and the env gene has
been substituted for the v-rel oncogene. The result of these modifications is a virally
encoded protein that is expressed at high levels fiom the strong RevT 5' LTR. Due to the
integration of v-rel into the env gene of RevT, there are sequences flanking the oncogene
that encode additional amino acids. The ENV-Rel-ENV fusion protein has 11 ENV
derived amino acids at the N terminus, and 18 at the C terminus. These residues are not
found in the cellular homologue, c-Rel.
The v-Re1 @59v'RC') oncoprotein possess an intact RHD at its N terminus,
confirming its membership in the ReVNF-KB family of transcription factors (Gilmore,
1992). However, v-rel is the only member of the R ~ ~ N F - K B family that is consistently
oncogenic both in vivo and in vitro (Gilmore et al., 1996). A structural importance has
![Page 22: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/22.jpg)
been implicated in the transforming property of v-Re1 since this oncoprotein differs fiom
its cellular homologue (~68''") in many ways. In addition to the ENV derived amino
acids that flank the oncoprotein, v-Re1 is missing two N terminal amino acids found in c-
Re1 and, more importantly, v-Re1 has a l 18 amino acid truncation at its C terminal end.
Therefore, v-Re1 lacks the strong transactivation domain (TAD) that is found in c-Re1
(Figure 1). Finally, there are a total of 18 intemal amino acid substitutions in v-Re1 as
compared to c-Re1 (Bose, 1992). The implications of these modifications in v-Re1
mediated transformation will be discussed subsequently.
ii. The Helper Virus Dichotomy: RevA vs. CSV
Since RevT is replication defective, it is dependent on a helper virus for
propagation, Le., for productive infection of target cells. RevT was first isolated in
conjunction with the replication competent retrovirus RevA, and initial characterization
of RevT transformation in chickens was carried out with RevT(RevA) (Hoelzer et al.,
1980). Although it was discemed that this viral pair could cause lymphomas in chickens
as well as transform cells in vitro, transformation studies in vivo were impeded by the
irnmunopathogenic nature of the helper virus. The RevA retrovirus causes
immunosuppresion, thymic and bursal atrophy in birds and cytopathic effects in chicken
embryo fibroblasts (CEFs) (Barth and Humphries, 1988). Therefore, it was supgested
that the range of target cells ûansfonned by RevT(RevA) was limited by the toxicity of
the RevA retrovirus (Gilmore, 1992). This led the Humphries group to develop a novel
system for studying RevT mediated transformation (Barth and Humphries, 1988).
RevT(RevA) was passaged through a myeloid ce11 line caq ing the chicken syncitiai
virus (CSV) and this ultimately led to the isolation of RevT in the contex? of CSV, a non-
c ytopathic helper vins. Subsequentl y, RevT(CSV) was used to characterize target cells
for v-rel mediated transformation. Interestingly, the RevT(CSV) transformed cells
differed fiom those transformed by RevT(Rev-4) (Barth and Humphries, 1988). This
difference is discussed in the following section.
![Page 23: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/23.jpg)
iii. V-Re1 vs. V-Rel*
Originally, infection of young birds with RevT(RevA) led to the transformation
of several ce11 species. When these cells were characterized by ce11 surface marker
expression, they were found to be predominantiy cells of the myeloid Iineage as weli as
immature lymphocytes (reviewed in (Gilmore, 1992)). On the other hand, infection of
neonatal chicks with RevT(CSV) resulted in polyclonal B ce11 turnors, suggesting that B
cells of a mature phenotype were king transformed (Barth and Humphries, 1988).
Therefore, it was argued that the differences in tumor formation following infection with
either RevTmevA), which gave rise to turnors of a more resîricted clonaiity, or
RevT(CSV) was most likely due to the differences in helper virus.
This hypothesis was challenged when the v-rel oncogene encoded by
RevTf CSV), herein referred to as v-rel*, was fully sequenced (Romero and Humphries,
1 995). It was observed that v-rel* possesses a key alanine to serine substitution at arnino
acid 40, near the DNA binding site in the 'RHD. Moreover, observations made in vitro
revealed that v-rel and v-rel* "0th bound to KB sites, but with different afhities. This
sugpested that the point mutation could have affected the transforming properties of the
oncogene (Romero and Humphries, 1995; Kabrun et al., 199 1).
Cells transformed by v-rel and v-rel* show similar characteristics including an
up-regulation of the major histocompatibility complex class II (MHC class II) expression
and a down reguiated expression of the of the Bu-1 antigen? which is a pan-B ce11 marker
(Hrdlickova et ai., 1994; Humphries and Zhang, 1992). Although aitered gene
expression is characteristic of v-rel and v-rel* transformed cells, a causal relationship
between oncogenesis and the up or down regulated expression of target genes has not yet
been established.
In conclusion, the two forms of RevT differ not only in their helper virus. RevA
vs. CSV, but in the actual oncogene itself, v-rel vs. v-rel*. Although cells transformed
by these two oncogenes exhibit similarities in the altered expression of certain genes, the
phenotype and clonality of the resulting tumors differ: v-rel* transforms lymphocytes of
a more mature phenotype. Therefore, it is necessary to study whether the state of
endogenous gene activation determines the consequence of v-rel expression. It also
![Page 24: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/24.jpg)
remains to be seen whether target cells are defmed by expression of ce11 surface receptors
for the ENV glycoprotein of the helper virus, or whether target ce11 specificity is defmed
by the oncogene itself. In order to comprehend the nature of the cells that are
transformed by v-Rel, it is first necessary to understand the mechanism by which v-Re1
transforms. A brief discussion of the current concepts of v-Re1 mediated transfonnation
is given below.
C. Transformation by the v-Re1 Oncoprotein
Although experiments carried out in vivo have revealed that RevT transfonns a
limited nurnber of ce11 types, this retrovirus was found to have a much wider target ce11
range in vitro. Splenic lymphocytes transformed by RevT in vitro gave rise to
immortaiized ce11 lines (Hannink and Temin, 1991). Immortalized cells that were not
rearranged for the immunoglo bulin heavy chah (IgH) did not undergo subsequent
rearrangement at these loci when grown in culture. On the other hand, transformed B
cells that were rearranged at one or both of the IgH loci, continued to grow in culture as
such. Therefore, it appears that cells transformed by v-Re1 are "fiozen in time" (Bose,
1992)-
Transfomed cells of the myeloid, lymphoid and erythroid lineages were
identified following infection of avian bone marrow cells, in virro, with a replication
competent retrovirus into which v-rel was cloned (Morrison et al., 2991). The
transformed bone marrow cells, however, were not immortaiized and eventually
succurnbed to senescence. In addition to hematopoetic cells, transformation assays also
revealed that v-rel was able to transform fibroblasts to a lirnited degree (reviewed in
(Gilmore, 1992)). Transformation by v-Re1 dramatically increased the 2 month life span
of chicken embryo fibroblasts (CEF) to 9 months, afier which time they senesced. CEFs
transformed by RevT expressed characteristic alterations in morphology due to
disruptions of the cellular cytoskeleton (Momson et al., 1991). Initially it was believed
that v-rel mediated transformation was limited to avian ceIls. Recent studies, however,
have demonstrated that transgenic mice expressing v-rel under the controI of a T ce11
![Page 25: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/25.jpg)
specific promoter developed fatal T cefl lymphomas, showing for the f m tirne that v-rel
activity was not species specific (Carrasco et al., 1996).
Thus far, the exact mechanisrn by which v-Re1 is able to transform cells either in
vitro or in vivo is sûll unclear. The fact that v-Re1 is a member of the ReVNF-d3 family,
however, implies that this oncogene could function at the leveI of transcriptional control.
It is known that in transfonned avian tells v-Re1 interacts with other members of the
R e m - K B family, including c-Rel, p50, pl 15, pl24 and p40 (the Iast three gene
products are the avian homologues to pl 00, pl05 and IKB-a respectively) (Davis et ai.,
199 1 ; Momson et aI., 1989; Capobianco et al., 1992). The structural differences between
v-Re1 and c-Re1 provide insight into the elusive mechanism of v-Re1 mediated
transformation. Over-expression of the c-rel proto-oncogene transforms cells with only
2% efficiency compared to v-rel (Mosialos et al., 1991). Therefore, v-Re1 m u t have
unique features that render it acutely transforming.
i. v-Re1 as a Dominant Negative Mutant
Originally, a dominant negative role was ascribed to v-Re1 (reviewed in
(Nueman. et al., 1997)). This was predominantly based on the C terminal truncation of
the oncoprotein as compared to its cellular counterpart; v-Re1 does not have the strong
transactivation domain (TAD) of c-Re1 (Richardson and Gilmore. 199 1). However, v-
Re1 still possesses an intact RHD, ailowing it to dimerize with other members of the
ReVNF-KB family, translocate to the nucleus and bind DNA at icB sites (Figure 3). For
this reason, it was argued that v-Re1 interacts with the ReVNF-KB subunits to forrn
transcriptionally inactive dimers that can bind to and occlude KB sites. In fact, early
experiments using reporter genes linked to KB sites showed that v-Re1 did in fact
suppress transcription (houe et al., 199 1).
ii. The Active Model for v-Rel Transformafion
More recentIy, the conception of v-Re1 as a dominant negative repressor of
transcription has been reconsidered. Sequence analysis of v-Re1 revealed that the
oncoprotein does possess transactivating motifs despite its lack of the C terminal TAD.
![Page 26: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/26.jpg)
Figure 3. Current Models for v-Rel Mediated Transformation. a) Under normal conditions, NF-KB dimers regulate transcription of target genes by fust binding to rB sites in either the promoter or enhancer regions. b) A Dominant Negative role was initially ascnbed to v-Rel, since the oncoprotein lacked the strong TAD of its cellular homologue, c-Rel. In this model, v-Re1 dimerizes with other members of the ReVNF-KB family to form inactive complexes that can still interact with KB sites. c) More recently, sequencing of v-Re1 revealed N o weak TADs in the C terminus of the oncoprotein, leading to an active role for v-Re1 in the transactivation of target genes.
![Page 27: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/27.jpg)
a) Induction of Targent Genes by ReVNF-rcB Dimers
dimer
b) v-Rel as a Dominant Negative Mutant of c-Rel
kB site -.= +
c ) v-Rel as a Transcriptional Activator
kB site
Figure 3. Current Models for v-Re1 Mediated transformation
![Page 28: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/28.jpg)
In fact, v-Re1 has two weak transactivation domains just downstream of the RHD
(Gilmore et ai., 1996). Moreover, a number of genes are up-regulated in v-Re1
transformed celIs; these include c-rel, nfkbl, i&a, c-jun, HMG-14b, and many others
(Nuemann et al., 1997). However, no definitive causal link has been made between the
up-regulation of many of these genes and transformation. The consequence of gene
induction by v-Re1 will be discussed subsequently.
iii. v-Re1 Mediated Transformation
Difficulty in detennining the exact mechanism for v-Re1 mediated transfonnation
is due, in part, to the fact that v-Re1 is found in both the cytoplasm and the nucleus of
transformed cells. V-Re1 is predominantly found in the cytoplasm of transfonned splenic
lymphocytes, in high molecular weight complexes with other cellular proteins (White et
al., 1996). However, in these cells a small proportion of v-Re1 is located in the nucleus
(Davis et al., 1990).
It has been suggested that the interaction between v-Rel and IKB-a in the
cytoplasm of cells couid titrate out the inhibitory protein, thereby releasing other Rel/NF-
KB dimers (Gilmore, 1992). The Iiberated dimers could then translocate to the nucleus
and aberrantly activate transcription. This is supported by the fmding that v-Re1
homodimers transforrn cells most efficiently than heterodimers that contain the
oncoprotein (Nehyba et al., 1997).
Even though the majority of v-Re1 is found in the cytoplasm of transformed cells,
it \vas recently determined that lymphocytes require a minimal level of v-Re1 in the
nucleus for efficient transfonnation to occur (Sachdev et ai., 1997). In order to show that
a threshold level of v-Re1 was required in the nucleus. mutants of v-Re1 that
contained artificial nuclear export signais (NES) were constructed. Transformation
assays revealed that these mutants had lost their oncogenicity suggesting that v-Rel, in
fact, carries out its transforming activity in the nucleus of cells rather than in the
cytoplasm.
Binding to DNA is a crucial step in v-Re1 mediated transformation. Mutations in
the RHD that interfere with the binding of v-Re1 to KB sites, negate the oncogenic nature
![Page 29: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/29.jpg)
of v-Re1 (Momson et al., 1992; Hrdiickova et ai., 1995). Mutational anaiysis of the
oncoprotein has provided additional hsight on the V-ReWa interaction (Nehyba et al.,
1997). Mutations within the RHD as weIl as those at the C terminal end of v-Re1 altered
the KB binding specificity of the oncogene. The loss in DNA binding ability by these v-
Re1 mutants was accompanied by a decrease in their transfonning ability.
Temperature sensitive mutants of v-Rel, fs v-Rel, were recently isolated (White
and Gilmore, 1993). These mutants were found to be transfomring at permissive
temperatures (37°C); however, shifiing to a non-permissive temperature (42°C) resulted
in a loss of fimction. Interestingly, at non-permissive temperatures the ts v-Re1 mutants
were unable to bind KE sites.
To study the mechanism of transformation by the oncoprotein, Wdker and
Enrietto (1996) developed a conditional version of v-Rel, v-ReiER. This conditionai
mutant is a fusion protein made up of v-Re1 and the hormone-binding domain of the
human estrogen receptor. Activation of v-ReER was estrogen dependent (v-RelER was
induced in the presence of estrogen) and coincidentaily, v-RelER binding to KB sites
occurred in an estrogen dependent fashion as well. Therefore, the transforming abilities
of both rs v-Re1 and the conditionai v-RelER are dependent on KB binding.
Although these studies show that the v-ReUd3 interaction is essential for
transformation, the exact role of the association is still not clear. On one hand, Ballard et
al. (1 990) have identified v-Re1 as a ~ £ 3 binding protein that inhibits NF-& fùnction, i.e.,
v-Rel is a dominant negative version of the cellular homologue, c-Rel. On the other
hand, the activation of target gene expression following v-Re1 binding to KB sites has
also been obsewed (Humphries and Zhang, 1992; Walker and E ~ e t t o , 1996).
Implications of aberrant gene activation by v-Re1 are discussed in the next two sections.
iv. Activation of AP-1 genes by v-Re1
It is generally understood that v-&l mediates transformation by modiQing
normal gene expression. As descrïbed above, v-Re1 can forrn dimers with other Rel/NF-
KB subunits and bind KB sites through the FüiD; for this reason, the dominant negative
mode1 for v-Re1 mediated transformation was proposed. Nevertheless, transformation
![Page 30: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/30.jpg)
assays using a series of v-Re1 mutants have demonstrated that the RHD alone is
insuficient to prornote oncogenesis of CEFs in vitro (Sarkar and Gilrnore, 1993). This
group demonstrated that sequences C-terminal to the RHD were indispensable to the
transformation process and recently, two weak TADs were identified in the C terminus of
the oncoprotein. These findings suggest that transformation by v-Re1 could be dependent
on both KB binding and transactivation of target genes.
Several genes are up-regulated as a consequence of v-Re1 mediated
transformation, including MHC class II and the hi& mobility group protein, HMG 14b
(Humphries and Zhang, 1992; Walker and Enrietto, 1996). In some cases, the eficiency
of v-Re1 transactivation differs fiom that of c-Rel. For example, v-Re1 does indeed
induce the IKB-a gene. However, v-Re1 activates transcription of the inhibitor less
efficiently than c-Re1 (Hrdlickova et al., 1995). This could mean that v-Re1 is less
sensitive to the autoregulatory loop than its cellular counterpart, c-Rel, thereby adding to
the oncogenic potentid of v-Rel.
Contrary to its effect on id-a v-Re1 can activate transcription fiom the c-jun
promoter more efficiently that c-Re1 (Fujii et al., 1996). This group also found that v-Re1
activated the c-jun promoter selectively in HeLa cells. More recently. Kralova et ai.
(1998) demonstrated that, in addition to induction of c-jun, c-fos was aiso up-regulate in
v-Re1 transformed CEFs and lymphocytes. Gene products of CM and c-fas are
members of the AP- 1 famil y of transcriptional regulators. Similar to Re1Nk.B
proteins, the AP- 1 transcription factors are responsible for expression of immediate early
response genes and ultimately promote ce11 proliferation (Karin et al., 1997). Therefore,
it is possible that the abnormal transactivation of AP-1 factors by v-Re1 is responsible for
uninhibited ce11 proliferation and tumorigenesis.
v. v-Re1 and Apoptosis
Normal development and tissue homeostasis are dependent on apoptosis, a
physiologicdly important process by which unwanted cells are eliminated @uke et al.,
1996). This form of inducible death is programmed into cells and is characterized by a
![Page 31: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/31.jpg)
common set of morphological alterations. Interference with apoptosis leads to
unrestricted cellular proliferation and is conducive to cancer (Thompson, 1995).
Studies have revealed a Iink between the v-rel oncogene and a decrease in
apoptotic activity. For example, chicken bursal cells that aberrantly expressed v-Re1
were resistant to standard apoptotic stimuli (Neiman et al., 1991). The adverse effect of
v-Re1 on apoptosis has also k e n studied in other ce11 lines, and it was found that by over-
expressing the oncoprotein in HeLa cells, programmed ce11 death could be prevented
(Zong et al., 1997). Similar results w-ere observed in v-Re1 transformed chicken spleen
ceils (White et al., 1995).
The mechanism by which v-Re1 impedes the apoptotic process is still unciear.
However, temperature sensitive mutants of v-Re1 have been used to show the
involvement of Bcl-2 in this process (White and Gilmore. 1996). Bcl-2 is a family of
proteins that are able to suppress apoptosis. Using the v-Re1 mutants, White and Gilmore
demonstrated that over-expression of Bcl-2 could rescue cells £iom apoptosis at
temperatures that were non-permissive for v-Re1 activity. Whether the expression of bcl-
2 genes is regulated by v-Re1 has yet to be determined.
Very recently, another link was made between the transforming ability of v-Rel
and its anti-apoptotic activity (You et al., 1997). CEFs were first transformed by 2s v-Re1
mutants, and then the mRNA species present in CEFs at permissive and non-permissive
temperatures were compared. In this fashion, You er al. found that at permissive
temperatures, transformed cells expressed high levels of message coding for a protein
that is known to inhibit apoptosis, ch-IAP. This message was not expressed under non-
permissive conditions. The Inhibitors of Apoptosis, IAP, make up a novel family of
proteins that are known to block apoptosis normally triggered by a wide array of stimuli
(reviewed in (LaCasse et al., 1998)). The chicken homologue to IAP is ch-IAP. Up-
regulated expression of ch-IAP by v-Re1 could be the mechanism by which the oncogene
interferes with ce11 death, and ultimately lead3 to transformation of CEFs.
The v-Re1 oncoprotein has not been formally linked to the induction of anti-
apoptotic genes. However, mutational analysis of the C terminus of v-Re1 has revealed
that key serine residues in the transactivating domains of v-Re1 are indispensable for the
![Page 32: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/32.jpg)
anti-apoptotic and the transforming properties of the oncogene (Chen et ai., 1999).
Therefore, interference with the transactivating ability of v-Re1 also hampers the anti-
apoptotic activity, and ultimately the transfonning potential, of the oncoprotein.
D. B Cell Development in Chickens
Our laboratory is interested in characterizing the cells that succumb to v-rel*-
mediated transformation in vivo, in order to gain a better understanding of the mechanism
by which v-rel* transfonns cells. As discussed above, initial characterization by
RevT(RevA) and RevT(CSV) infection show that immature and mature B cells,
respectively, are the primary targets for these viruses. However, in order to appreciate
the difference between the target cells for v-rel and v-rel* mediated transformation, it is
necessary to understand avian B ce11 development. This section provides a brief
overview of B ceIl development in chickens.
i. B Cell development: Mammals vs. Birds
Rearrangements of the immunoglobulin (Ig) Iight and heavy Ioci are required to
eenerate functional Ig genes in rnarnmals and birds alike. However, the process by which C
Ig diversity is obtained differs significantly between the two species. In marnmals, the
immunoglobulin locus encodes multiple variable (V), diversity (D) and joining (J)
elements; recombination can occur between any one of the above elements to give a
functional V@)J region for the Ig heavy chain gene, or a functional VJ region for the Ig
light chain gene (Tonegawa, 1983). Owing to the multiple V, D and J elements found at
the Ig locus, the combinatonal possibilities provide the first step in generating a varied
set of Ig molecules. The Ig repertoire is fùrther expanded through junctionai diversity,
which includes the addition of non-templated 'N' nucleotides by terminal
deoxynucleotidyl tramferase (tdt), and the presence of 'P' nucleotides that result fiom
hairpin resolution (Lieber et al., 1994). Anoaer level of diversity is achieved by pairing
of the iight and heavy chains. In rnammals, diversity is an ongoing event throughout the
Iifetime of an animal.
![Page 33: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/33.jpg)
On the other hand, avian species have developed a different way to generate a
diverse Ig repertoire (reviewed in (Ratcli ffe and Jacobsen, 1 994)). S imilar to mammals,
birds have a prerequisite for rearrangement of the Ig locus for comrnitment of a ce11 to the
B lymphocyte lineage. However, uniike mamrnais, birds only have one functional gene
segment for the V and J regions of both the heavy and light chain loci, aithough there are
multiple copies of non-fûnctional gene segments at these loci, YVD, and YVL
respectively (Reynaud et al., 1989). In B cells, rearranged genes must include both the
fùnctional V and J elements for successful induction of surface Ig expression, thereby
resulting in nearly identical V@)J and VJ regions at the heaw and light chah loci,
respectively (Reynaud et ai., 1985; Reynaud et al., 1987). In birds, this process only
occurs during embryo development. The resulting B cells express surface ig with a
limited diversity. However, through a process of somatic gene conversion, these B ce11
are able to diversi@ their Ig genes ((Thompson and Neiman, 1987); reviewed in (Funk
and Thompson, 1996)). In gene conversion, portions of the V pseudo-genes are copied
ont0 the rearranged V gene segment in a unidirectionai fashion. Multiple gene
conversion events can occw for a single V gene segment. In this rnanner, gene
conversion accounts for a majority of the variability found in the chicken Ig repertoire.
ii. The Bursa of Fabricius
In avian species there is an organ located just above the cloaca that serves as the
primay site of B ce11 lyrnphopoesis; this organ is the Bursa of Fabricius. Development
of the bursa starts between days 8 and 14 of embryogenesis and continues until sexual
mitturity, at which time the organ starts to involute (Houssaint et al., 1976). The Bursa is
organized into approximately 10' follicles. These follicles are seeded by a minimum of
two to four B ce11 precursors, which undergo massive proliferation (Ratcliffe, 1989; Funk
and Thompson, 1996). Ultimately, each follicle can houe up to 10' B lymphocytes
(Olah and Glick, 1978).
Although the bursa is indispensable for B ce11 development, these lymphocytes
actually originate at extra-bursal sites. During embryonic development, cells are fvst
committed to the pre-bursai stem ce11 (pre-busc) lineage which then colonize the bursa
![Page 34: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/34.jpg)
(Neri et al.? 1991). These stem cells have a finite life span, and by the two weeks pst-
hatch the pre-buscs completely disappear fiom sites of hematopoesis (Weber and Foglia,
1980).
Early studies suggested that cells at the pre-busc stage are already committed to
the B ce11 lineage (Ratcliffe et al., 1986). PCR anaiysis has been used to c o n f i the
rearrangement of the immunogiobulin (Ig) loci in these stem cells (Mansikka et al.,
1990). As mentioned above, cells entering the bursa have a limited diversity, but
diversification of the Ig repertoire by gene conversion occurs therein. It is now clear that
the bursal microenvironment is essential for fidl gene conversion to take place. In
bursectomized birds, B ce11 numbers are severely compromised and serum antibodies are
of a limited specificity(Lassi1a et ai., 1988; Mansikka et al., 1990).
iii. The Fate of Bursal Cells
As birds age, light chah diversity of B cells in the bursal follicles increases
dramatically (Lassila et al., 1988). Ultimately, mature bursal cells are exponed nom the
bursa to penpheral organs such as the spleen, or to the blood, and can then give rise to
rnanire/mernory B cells (Funk and Thompson, 1996). Only about 5% of the bursal ceils,
however. actually migrate from the bursa and the rest are subjected to an apoptotic death
(Lassila 1989). Concurrent with bursal proliferation and gene conversion, is a process of
selection and it is possible that expression of surface Ig serves as a survival signal for
bursal cells. Our laboratory has demonstrated that down-regulation of Ig precedes
apoptotic death in the bursa (Pararnithiotis et al., 1995). Therefore, diversification events
that result in aberrant Ig genes, by generating premature stop codons or fiameshifi
mutants, and that lead to the down regulation of surface Ig expression, would also target
cells for apoptosis.
iv. Summary of Avian B Cell Developmen t
B celI deveiopment in chickens commences during embyogenesis. Once the pre-
busc cells colonize the bursa massive proliferation and diversification can occur.
Although the majority of B cells appear to apoptose in the bursa, diversified B cells
![Page 35: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/35.jpg)
immigrate to the periphery where they can ultirnately differentiate to mature/memory
cells. To date, it is known that B cells are the targets of v-Re1 mediated transformation.
However, whether B cells at al1 stages of development are susceptible to transformation
by v-rel is still unclear.
E. Specific Experimental Goals
Our laboratory is interested in studying the mechanism of v-rel* mediated
transformation. By determining which cells are targeted for transformation by v-rel*, we
can gain a better understanding of the intracellular requirements for v-Rel*- mediated
oncogenesis. Therefore, development of chickens that are transgenic for the v-rel*
oncogene would provide a mode1 to study in situ transformation. Moreover, generating
transgenic birds of this nature would obviate the prerequisite of cellular infection by
RevT, and therefore elirninate the need for a helper virus.
The work described in this thesis -involves the design and construction of the
vectors used for somatic transgenesis of v-rel* by retroviral cassettes, both in vitro and in
vivo. Since we hypothesized that hi& levels of oncogene expression couId have
detrimental effects on embryo development, the v-rel* oncogene was placed under
conditional expression. The conditional expression system used here was the tetracycline
repressiblr system described by Gossen and Bujard (Gossen and Bujard, 1992). Once the
vectors were constructed, tetracycline levels were optimized in vitro and in vivo for the
conditional expression of v-rel*. Finally, questions regarding target cells were addressed
by phenotyping cells that transformed in vivo under conditions permissive for the
expression of v-rel*.
![Page 36: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/36.jpg)
Chapter 2. Materials and Metbods
In vitro and in vivo work
Chicken Srrains
Chickens used in the work presented here were exclusively of the SC line
(Hyline International, Dallas Center, IA). These chickens are an F1 hybnd of the S and
C line chickens. Line O chickens, which are devoid of endogenous retrovirai loci, were
used as a source of chicken embryo fibroblasts (CEF) (RPRL, East Lancing). Birds
maintained on tetracycline received 100~1 of tetracycline (lOmg/ml in dH20) intra-
peritoneaily, every second day.
Preparation of Ceil Suspensions
Peripheral Blood Lymphocytes (PBLs) were prepared firom fiesh blood drawn
from the chickens and into heparin (lOu/til in saline). Cells were washed in 3 volumes of
Hanks Bdanced Salt Solution (Hanks BSS) and centrifuged at 32 1g for 10 minutes (al1
spins were carried out at 14OC unless othenvise specified). Pellets were then resuspended
in Hanks BSS. Ce11 suspensions were underiayered with Lympholyte M (Homby, ON)
to form a density gradient and then centrifuged at 1075g for 20 minutes. PBLs were
collected fiom the interface, washed three times with Hanks BSS (first at 385g and then
two time at 32 lg), and stored on ice.
Bursal, spleenic and thymic lymphocytes were prepared separately by fmt
mashing tissue through a fine wire mesh. The ce11 suspension was then transferred to a
tube containing Han!! BSS, placed on ice for 5 minutes and then decanted into a fresh
tube to remove any tissue debris. Cells were washed once (321g, 10 minutes) and
resuspended in Hanks BSS. Cell suspensions were underlayered with Lympholyte M and
red blood cells were rernoved by spinning at 1075g for 20 minutes. Lymphocytes were
collected from the interface and washed (see above). The same steps were carried out to
harvest lymphocytes fiom liver tissue. Ali steps described above were carried out under
sterile conditions.
![Page 37: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/37.jpg)
Tissue Culture
Transfonned cells lines and hybridomas were grown in 250mI tissue culture
flasks while chicken embryo fibroblasts (CEFs) were plated on lOOmrn tissue cuiture
plates (Nalgen Nunc I d . , ON ). Cells were cultured in Iscove's Modified Dulbecco's
Medium (IMDM) supplernented with 3.025 g/L NaHCO,, 100 U/ml penicillin, 100
pg/ml streptomycin, 5x1 O-' M 2-ME, 5% heat inactivated fetal calf senun (FCS) and
either 2% chicken s e m (CS) (GibcoBRL, Burlington, Ontario) for transformed cells,
1 % CS for chicken embryo fibroblasts (CEFs) or a total of 10% FCS for hybndomas.
Cells were grown at 37°C with 5% CO, in humidified air.
Thawing and Freezing of Cells
Cells that were fiozen down were washed three times in Dulbecco's PBS (DPBS)
supplemented with 2.5%FCS and viable cells were counted by trypan blue exclusion.
Cells were then resuspended to a final concentration of I07cells/ml in fieezing media
(69% RPMI media, 20% FCS, l%CS, 10% DMSO). 500pls of the ce11 suspension
(5x1 o6 cells) were aliquoted into cryo-tubes. Aliquotes were fiozen at -70°C for 16 hours
then transferred to -1 50°C.
Cells kept at -150°C were quickly thawed, immediately washed in 10 mls of
s t ede IMDW2%CS and resuspended in 2 mis of media. The ceIl suspension was
senally diluted 1 2 in 24 well tissue culture plates. After 24-48 hours, cultures were
ultimately passaged to larger culture flasks. Cells were re-fed every two days.
CEF Culture and Passage
Vials of CEFs were thawed quickIy and immediately washed in IMDM/l%CS
(32 1 g, 10 minutes) before plating on 100mm tissue culture plates. Cells were passaged
on average twice a week. The following procedure was used to harvest confluent CEFs:
Following aspiration of the media, CEFs were washed once with 5 rnls pre-\vanned PBS
A. 2 mls of pre-warmed trypsin solution (0.125% trypsin, 0.7 mM EDTA in PBS A)
were added to the plates and incubated for two minutes with tapping to Ioosen adherent
cells. 5 mls of IMDM/l%CS were added to the plates. Ce11 were then transfemed to
![Page 38: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/38.jpg)
sterile tubes and washed (321g, 10 minutes). These CEFs were resuspended in 2 m l s of
ILMDM/I%CS; viable cells were counted by trypan blue exclusion before k i n g re-plated.
Calcium Phosphate Mediated Transfection
Plasmid DNA was fmt precipitated in the foiiowing manner: 220 pL sterile DNA
(40pg/ml in O. 1 X TE pH8) was mixed with 250 pL of 2X HEPES-buffered saline (KF3S).
3 1 pL of 2M CaCl, was slowly added with bubbling to ensure proper mixing. Following
a 20 minute incubation at room temperature, the calcium phosphate-DNA CO-precipitate
was resuspended by pipetring up and down 3 times and then added dropwise onto a plate
of CEFs containhg 5 mis of pre-warmed IMDM/l%CS. After a 4 hour incubation at
37"C, media was aspirated. CEFs were washed once with pre-warmed PBS A and then
glycerol shocked (IMDM/1%CS/IS% glycerol) for 2 minutes at 37°C. Cells were L
washed once with PBS A and cultured in IMDM/l%CS. Al1 of the above steps were
carried out under stenle conditions. CEFs were transfected when they were at 20%
confluence.
Generation and Testing of RCAS based Viral Stocks
Transfected CEFs were used as a source of virus. Confluent CEFs were washed
with pre-warrned IMDM/I%CS. 5 mis of pre-wmed IMDM/2%CS was then added and
cells were incubated for 4 hours at 37OC. Following the incubation, supernatants were
harvested and cellular debris was removed by centrifugation (321g. 10 minutes).
Supernatants were aliquoted and stored at -70°C. To test for viability of the virai stocks,
nai've CEFs were cultured with 5-7.5 mls of virus, in a total of 10 mis of media- CEFs
were 50-75% confluent upon infection and were grown to confluence in the presence of
vins (2-3 days). CEFs were then harvested, as described above, and analyzed for viral
protein expression by flow cytometry. Expression of c-Re1 and v-Re1 by CEFs was
monitored by Western blot (see below).
![Page 39: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/39.jpg)
Infection of Chick Embryos
Viral stocks were used to infect chick embryos. At day 13 of embryogenesis,
eggs were candled to detemine viability and to mark veins for virus injection. Widows
were cut at the marking with a srnaIl hobby saw and the shell was carefully removed so
as not to distub the shell membrane. Sterile Icc syringes were used to inject -100pL of
viral supematant directly into the exposed vein. Windows were sealed with paraffin wax
before retuming the eggs to the incubator. The injected eggs were candled withui 48
hours of injection to check for viability.
When required 50pl of filter sterilized tetracycline (IOrn~ml in dH20) was
injected through the paraffin window using a sterile lcc syringe. Eggs maintained on
tetrac ycIine received injections every 2 days.
Antibodies
Al1 hybndomas were cultured in IMDWIO%FCS as described above. Once cells
had grown to confluence, supematants were harvested by spinning cultures at 32 1g for 10
minutes to pellet cells. Supernatants were adjusted to a final of pH 8 with TE pH 8,
aliquoted and stored at -30°C. Al1 of the above steps were carried out under sterile
conditions. Monoclond antibodies were either purified by af3nit.y chromatograpby or
used as hybridoma supematants. A list of monocIona1 antibodies that were used is given
Antibody
1
I
W orking Concentration
(Flow Cytomeâry)
Antigen
(Ratcliffe and Tkaiec, 1 990) (RatditTe and Tkaiec, 1990)
4-22 l 1C6
Diluted hybndoma supematant (1 5 ) Diluted hybndorna supematant (1 5) NIA Undiluted hybridoma
Source
supernatant NIA NIA
Chicken IgM Chicken I d -
E. Humphries
E. Humphries
E. Humphries E. Humphnes
HY2 1
Hy23
RCAS viral protein
RCAS Wal protein
HY87 HY18
c-Re1 & v-Re1 Chicken IgM
![Page 40: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/40.jpg)
1 Opg/ml
1 L J
F Io w C ytornetry
For the andysis of cellular antigens, cells were fmt washed three times in pre-
chilled Dubelcco's PBS (D'PBS). 0.Sx106 or 106 CEFs or lymphocytes, respectively,
were used when staining for ce11 surface antigens, while IO6 or 2x106, respectively, were
(Pafamithiotis et al., 1 995) EP25
Bul mix: Fu5 21-1A4 CT3
used when staining for intracellular proteins. The primary antibodies used are descnbed
Chicken MHC class n
1 lA9 LT2
above. Goat anti-mouse secondary antibodies conjugated to either fiourescein
isothiocyanate (FITC) or phycoerithryn (PE) (Southem Biotechnology Associates,
(Houssaint et al., 199 1) (Paramithiotis & Ratcliffe,
Chicken C M 12 Chicken LT2
Chicken Bu1
Chicken CD3
Birmingham, AL) were used.
10cidd 0.2pghnl
During the staining procedure, al1 washes were at 321p for 2 minutes for non-
1995) (Veromaa et al., 1988)
(Chen et al., 1986)
stenle stains. Moreover, live cells were kept on ice throughout the staining procedure.
1 O ~ k w l o ~ g ! d Diluted hybndoma supernatant ( 1 : 1 0)
Cells stained for cytoplasmic antigens were fmt fixed by incubation in ice cold ethanol
(70%) for 30 minutes and then washed with cold D'PBS an additionai three times before
incubation with the primary antibody. Both live and f~ved cells were blocked in D'PBS
+ 2.5%FCS on ice for 15 minutes. Cells were then incubated in SOpl of a primary
antibody for 15 minutes and then washed three times before resuspending in 50p1 of
appropriate goat anti-mouse FITC conjugate for 15 minutes. After three wshes. celis
were resuspended in 400pl DtPBS/2.5%FCS and then analyzed on a FACScan (Becton
Dickinson, Mountain View, CA) by gating of forward and side scatter. For two-colour
analysis of ce11 surface antigen expression, primary antibodies with different isotypes
were used and followed by c o p t e secondary antibodies. One of the secondary
antibodies was conjugated to FITC and the other to PE, allowing sirnultaneous analysis
of the two markers by flow cytometry.
![Page 41: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/41.jpg)
RevT(CSV) Viral Stocks & Transformation of Lymphocytes Ex Vivo
The avian myeloid ceil line, S2A3, was used as a source of the RevT retrovirus in
the context of the CSV helper virus, RevT(CSV). S2A3 cells were cultures at a
concentration of 5x10~ for 4 hours at 37°C in IMDM/2%CS. Supernatants were fmt
harvested by pelleting the unwanted cells, then filtered through a 0.22pm filter and
finaily aliquoted and stored at -70°C.
The RevT(CSV) viral stocks were used for ex vivo transformation of bursal,
splenic and thymic lymphocytes isolated fiom SC chickens (E3enatar et al., 1991)
Western Blots
Protein expression in CEFs and lymphocytes was analyzed by SDS-PAGE.
Whole ce11 lysates fkom 106 CEFs or 3x106 lymphocytes were prepared as follows: cells
were harvested fiom tissue culture plates (CEFs and ce11 lines) or fiom chickens as
described above. m e r washing, cells were pelleted in microfuge tubes and resuspended
in 40pl of protein loading buffer (10% glycerol, 1OmM Tris pH 6.8, 2.3% SDS, 0.1%
bromphenol blue). 2-ME was added to a fmal concentration of 5%. Samples were boiled
for 5 minutes at 95-100°C and then spun at top speed in a microfuge for an additional 5
minutes to sediment large debns. Protein lysates u7ere separated under denaturing
conditions by SDS-PAGE (7.5% acrylamide) for 16 hours at 35volts using a SE 600
Vertical Slab Gel Unit (Hoefer Scientific Instniments, San Francisco). A semi-dry
transfer apparatus (Tyler Research Instruments, Edmonton, Alberta) was used for
transferring proteins to Ntrocellulose membranes (Schleider and Schuell, NH). The
tram fer was carried out at 1 5OmA for 1 hour in transfer buffer (20mM Tris base, 1 50mM
glycine, 20% MeOH). Membranes were blocked in TBS-T pH 7.6 (2OmM Tris base,
1 3 7mM NaCl supplemented with O. 1 % Tween-20) with 5% skim milk for 1 hour at room
temperature. BIots were then washed three times. Al1 washes were carried out in 50 mls
of TBS-T for 5 minutes with shaking. Membranes were immersed in 25 mls of primary
antibody (HY87 hybridoma supernatant) diluted 1 :5 in TBS-T + 5% milk, incubated for
one hour at room temperature with shaking, and then washed three times. The secondary
antibody was a goat anti-mouse coupled to horse radish peroxidase, and was diluted
![Page 42: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/42.jpg)
1:3500 in TBS-T + 5% milk. Blots were incubated in 20 mis of secondary antibody for
45 minutes and then washed three times. M e r the f d wash, blots were developed by
the ECL chemiluniinescence system (Amersham, Oakville, ON).
Histology of Organ Tissue
Liver tissues fiom sacnficed birds were fmed in' 10% buffered forrnalin (buffered
with PBS A). Sarnples were embedded in paraffm wax within 48 hours and thin sections
were prepared for histological examination (Department of Pathology, McGill
University, QC). Hematoxylin & eosin (H+E) stains of the tissue samples were carried
out at the Department of Pathology, McGill University, QC.
For the immunohistochemistry, tissue sections were depdnized in 100%
xylene and re-hydnted over a ten minute interval decreasing concentrations of ethanol
(100%, 90%, 70%, 30% EtOH) and fmally immersed in dH20. Sections were
equilibrated in 600 mls of Antigen Retrievai Buffer (ARB) (18mM citric acid, 82mM
sodium citrate in dH20) and then boiled at high power in a microwave for 5 minutes. An
additional 100 mls of ARB were added and the sections were boiled again for 5 minutes.
Sections were then washed twice in Tris Buffered Saline pH 7.4. Al1 washes were
carried out in 50 rnls of TBS for 5 minutes with shaking.
Endogenous peroxidase activity in the tissue was quenched with 3% H202 (30
minutes ~ 4 t h shaking). Sections were washed 3 times prior to the blocking step.
Blocking of non-specific proteins was performed by incubating the tissue sections for 40
minutes in the blocking b a e r (TBS with 1% goat se-) in a hurnidified chamber
(Dimensions Laboratories Inc., ON). Sections were then incubated for 1.5 hours in the
presence of the primary antibody. Pnmary antibodies were used at a concentration of
30pg/ml in the blocking buffer. Sections were then developed usinç the Vectastain ABC
kit (please refer to manufacturers manual: Vector Laboratones Inc., CA). Finally,
sections were counter-stained with eosin.
![Page 43: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/43.jpg)
Molecular Techniques
DNA Extractions fiom Eukaryotic Cells
Cells were washed three times in PBS A resuspended to give a final of 5x106 cells
per 1 .Sm1 eppendorf tube. Cells were pelleted at top speed in a microfuge for 1 minute
and supernatants were discarded. Pellets were resuspended in 1 ml RSB bufTer (lOmM
TrisNCi pH 7.4, lOmM NaCl, 5mM MgC12, 0.5% NP40) and incubated on ice for 30
minutes. Tubes were then spun at top speed in a rnicrofùge for 10 minutes and
supernatants were discarded. Pellets were solubilized in 500p1 Nuclei B d E r (0.5% SDS,
300mM NaCl, lOmM Tris/HCl pH 7.4,SmM EDTA pH 8) and Protehase K moehringer
Mannheim, Geermany) was added to each tube to a finale concentration of 250pg/ml.
Tubes were incubated overnight in a 37°C waterbath. Protein was removed from the
samples by phenol extraction and the aqueous upper phase was transferred to a fiesh
1 Sm1 tube. Sarnples were M e r extracted with an equal volume of ether and this t h e
the bottom layer was retrieved and transferred to a fresh tube. Ether was boiled off by
placing open tubes in a 60°C waterbath for 5 minutes. DNA was precipitated as follows:
125~1 of 10M ammonium acetate and 625pl of isopropanol were added to samples and
tubes were incubated for 20 minutes at -30°C. DNA was recovered by spinning tubes at
top speed in a microfiige for 10 minutes. Pellets were washed twice with 70% ethanol +
5.6~1 of 5M NaCl and then lyophilized. Ultimately, DNA was resuspended in 100~1 TE
pH 8, quantitated by spectrofiuorimetery and stored at -30°C.
Table of OIigonucleotides
Primer Name
JC (FI
K/E
WE'
pMJ1.0 3'
Sequence (5' + 3')
5'- AGAGCTCGAGCACATTTTCTGGTCAA -3'
5'- GCGGCCGCCACGATATC -3'
5'- CTAGGATATCGTGGCGGCCGCAGCT -3'
5'- GGCCAGTGAATTGTAATACG -3'
pMJ1.0 5' 5'- TCACACAGGAAACAGCTATG -3'
![Page 44: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/44.jpg)
( Rel3' STOP 1 5'- ACGTTTCCTCGCGACAAGGTC -3' 1 I
VL5' (2) 1 5'- ACGCGTCAGGTACTCGTTGCGCCTGGTC -3' 1
Polymerase Chain Reaction (PCR)
Typically, 50ng of eukaryotic DNA template was used in the PCR reactioa.
When PCR amplification was carried out with either TAQ or PFU polymerase
(Strategene, CA) was also used for PCR amplification; in this case the reaction is the
same as descnbed above. Amplification was carried out in 0.5 mi tubes and reactions
were cycled in a Hypercell Biological Thermal Cycler (Chalk River, ON). The PCR
reaction is described below. Denaturation: 1.5 minutes, 95°C; annealing: 1 minute, 60-
65°C; elongation: 1 minute, 72°C. This cycle was repeated 30 times. The reaction was
completed with a final elongation step of 20 minutes at 72°C to minimize background.
2 5 4 aliquots of the PCR reaction were analyzed on 1% agarose gels containine
OSmg/ml of ethidium bromide. Ail primers were manufactured at the Sheldon
Biotechnology Center at McGill University. The following primers were used in this
work.
v-reI 5' start (2)
Transformation of Competent Bacteria
DHSa E. coli cells were rendered competent by rubidium chloride and competent
bacteria were stored at -70°C as glycerol stocks. A 5 0 ~ 1 aliquot of competent bactena
was incubated with 50-75ng of plasmid DN4 for 30 minutes on ice in 1.5 ml epindorph
tubes. Cells were heat-shocked at 42°C for 90 seconds and then immediately placed on
ice for 2 minutes. 500~1 of pre-warmed 1X LB broth was added to each tube and cells
were incubated for 1 hour at 3PC with shaking. Cells were pelleted at top speed (13
000g) in a microfige, resuspended in lx LE3 broth, and then plated onto 1X
LB/1 .S%bacto-agar plates supplemented with 1 OOpg/ml of ampicillin. Plates were
incubated in an inverted position overnight at 37°C.
5'- GGACTTTCTCACCAACCTCCG -3'
![Page 45: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/45.jpg)
Plasmid Isolation by Mini-preparation
Individual bacterial colonies were selected from agar plates (see above) for
plasmid amplification and iso!ation. These colonies were used to seed 5rnl ovemight
cultures. Ovemight bacterial cultures were grown in 1X LB supplemented with
100pg/ml of ampicillin. Cells were pelleted in 1.5 ml tubes at top speed in a microfuge
and resuspended in 2 0 0 ~ 1 TEG buf5er (25mM Tris pH 8, lOmM EDTA, 50mM glucose)
supplemented with 4mg/ml lysozyme (Boehringer Mannheim, Germany) and incubated
for 5 minutes at room temperature. 400pl of alkaline solution (0.2N NaOH, 1% SDS)
was added to the bacterial suspension. Tubes were inverted several times to ensure
proper mixing and then kept on ice for 5 minutes. 300pl of 7.5M ammonium acetate was
added to each reaction to precipitate high molecular weight debris (protehs,
chrornasomal DNA, etc...). Following a 10 minute incubation on ice, tubes were
centnfuged at 13 OOOg for 10 minutes and supernatants were transferred to fiesh 1 Sm1
tubes. 0.6 volumes of isopropanol were added to the supernatants and plasmid DNA was
allowed to precipitate out of solution over a 10 minute interval at room temperature.
Plasmid DNA was isolated by centrifugation at top speed in a microfuge for 10 minutes
and supematants were discarded. DNA pellets were washed once with 70% ethanol and
ultirnately resuspended in TE pH 8 supplemented with 1 u g / d RNase A.
Maxi-Prep of Plasmid by Precipitation with Polyethylene Glycol (PEG)
i. High Copy Number Plasmids
250ml overnight cuitures of transformed DH5a E. coli were grown in lXLB with
100p,e/ml ampicillin (37°C with vigorous shaking). Bacterial cells were harvested by
centrifugation (SOOOg, 15 minutes at 4°C) and washed once in ice cold STE (0.1 M NaCl,
lOmM TrisNC1 pH 8, 1rnM EDTA pH 8). Cells were then resuspended in 9 mls of
solution I (SOmM glucose, 25mM tris/HCI pH 8, lOmM EDTA pH 8) and 1 ml of
lOmg/ml lysozyme (in Tris/HCI pH 8) was added. 20 mls of solution II (0.2N NaOH,
1 % SDS) were added and cells were lysed over a 10 minute interval at room temperature.
10 mls of ice cold solution III (3M Potassium acetate, 2M glacial acetic acid) were added
to precipitate high molecular weight materials. M e r a IO minute incubation on ice,
![Page 46: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/46.jpg)
cellular debris was pelleted (5000g, 20 minutes, no break) and supematants was filtered
through four layers of cheesecloth into a clean centrifuge bottles. 0.6 volumes of
isopropanol were added to the filtered supematants and following a 10 minute incubation
at room temperature, nucleic acids were recovered by centrifugation (6000g, 10 minutes).
Pellets were washed once with 70% ethanol and when sufficiently dried, they were
resuspended in 3 mls of TE pH 8. 3 mls of ice cold Sm LiCl were added and the
resulting mixtures were spun in the Sorvall for 10 minutes at 20 OOOg (4°C).
Supematants were transfemed to fiesh lSml centrifuge tubes and equal volumes of
isopropanol were added to the supematants. The resulting mixtures were resentrifuged
(20 OOOg, 10 minutes, 4°C) and the supematants discarded. Pellets were washed once
with 70% ethanol, air-dried and resuspended in 5 0 0 ~ 1 TE supplemented with 20pghnl
RNase A. Afier a 30-minute incubation at room temperature mixtures were transferred to
1 Sm1 tubes. Plasmid DNA was precipitated fiom solution by addition of 5 0 0 ~ 1 of 1 -6M
NaCl containing 13% PEG 8000. Mer thorough mixing, plasmid DNA was recovered
by spinning at top speed in a microfûge. Pellets were dissolved in 4 0 0 ~ 1 TE pH 8.
Phenol. phenol-chloroform and chloroform extractions were canied out respectively on
the DNA solution; at each step of the extraction the aqueous upper phase was kept.
Ultimately plasmid DNA was precipitated by addition of 1 Op1 IOM ammonium acetate to
the aqueous phase, dong with 2 volumes of 100% ethanol. Tubes were incubated for 10
minutes at room temperature. DNA was retrieved by centrifugation at top speed in a
microfige. Pellets were washed once with 70% ethanol, air-dried and f d l y
resuspended in 5 0 0 ~ 1 of TE pH 8. Plasmid DNA was quantitated by the
spectro fluorimetry.
ii. Low Copy Number Plasmids (Clal 2 based piasmids)
In the event of a low copy number plasmid, chlorarnphenicol was added to
bacterial cultures to maximize plasrnid amplification. Isolated colonies fiom transfonned
bacteria were used inoculate 10 ml overnight cultures (lx LB with 100pgM ampicillin).
Cultures were incubated at 37°C with rotation. 100p1 of the overnight culture was used
to inoculate 25 mls of 1X LB media with 100pg/d ampicillin. 25 mls cultures were
![Page 47: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/47.jpg)
incubated at 37°C with shaking until bacterial growth reached late log phase (OD,*0.6).
25 mis of late log culture was used to inoculate 500 rnls of LB media with 100pghni
ampicillin and cells were grown at 37°C. Once cells reached log phase of growth, OD,
20.4, chloramphenicol \vas added to a final concentration of 170pg/ml. Chlorarnphenicol
treated cultures were grown overnight at 37°C with shaking.
Plasmid DNA was isolated fiom overnight cultures as described above for hîgh
copy number plasmids with the following adjustments: 10 mls of Solution 1, 1 rnls of
lysozyme ( I Omg/ml), 20 rnls of Solution II, 15 mls of Solution III.
Restriction Analysis of Plasmid DNA
In general, 10 units of restriction enzyme were used with the recommended b a e r
per pg of plasmid DNA to be cut. Digests reactions were incubated for 1-5 hours and
heat inactivated at 65°C or 85"C, for IO or 20 minutes respectively, as recommended by
the manufacturer's directions. Digests were analyzed by electrophoresis on 1% agarose
gels supplemented with 0.5pghl ethidium bromide at -120V. The buffer used for
electrophoresis was TBE buffer pH 8 (0.89M Tris Base, 0.89M boric acid, 0-OSM EDTA
PH 8)-
Isolation of DNA Fragments fiom Agarose Gels
In order to isolate a DNA hgment, -10pg of plasmid DNA was digested with
the appropriate enzyme. DNA fragments were separated by gel electrophoresis, as
described above. Important DNA fragments were excised fiom the geI and then purified
using the QIAEX II Gel Extraction Kit (please refer to the manufacturer's manual:
QIAGEN Inc., ON).
Ligation Reactions
Ligation reactions were with a using a 1 :3 or 1:l ratio of vector to ligand for
sticky or blunt end ligations, respectively. Al1 ligations were perfonned in ligase buffer
(1 OrnM Tris-acetate, 1 0mM magnesium acetate, 50mM magnesium acetate supplemented
with 1mM A n ) . In general, 2-3 Weiss uni& of T4 DNA ligase were added to each
![Page 48: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/48.jpg)
reaction (Pharmacia Biotech., Baie D'Urfe, QC). Sticky end ligation reactions were
carxied out for 16 hours at 15°C and heat inactivated for 20 minutes at 65°C prior to
transformation of competent bacteria. Blunt end reactions were incubated at 15°C for 16
hours and then at room temperature for 4 hours before heat inactivation at 65°C.
Sequences that were PCR amplified with PFU polymerase were cloned into
shuttle vectors via blunt end ligation. It was necessary to phosphorylate these DNA
fragments at the 5' end prior to ligation.
DNA Sequencing
Sequencing of DNA tempIates was carried out at the Sheldon Biotechnology
Center of McGill University. The automated DNA sequencing was performed using T7
DNA polymerase in conjunction with internai labeling with fluorescine-15-dATP.
Primers used for sequencing were VLSY(2) and JC(F).
![Page 49: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/49.jpg)
Cbapter 3. Construction of TRElv-rel* Vectors
The mechanism for v-rel-mediated transformation is still unclear. On one hand,
the v-Re1 oncoprotein has been described as a dominant negative version of the cellular
homologue, c-Rel. On the other hand, a role of transcriptional activator has also been
ascribed to this oncoprotein. Nevertheless, is believed that expression of the v-Re1
oncoprotein, a member of the ReiNF-icB farnily of transcription factors, results in the
dysregulated transcription of genes normdly controlled by NF-&, and ultimately leads
to uninhi bited ce11 proli feration and tumor formation.
RevT, the replication incompetent retrovirus that codes for v-rel, has been
isolated in the context of both the RevA and the CSV helper viruses. These wo forms of
RevT differ not oniy in their helper virus, .but also in the actual oncogene itself: v-rel*,
coded by RevT(CSV), has a substitution at position 40 fiom alanine to serine (Romero
and Humphries, 1995). Initial characterization of the cells targeted for transformation by
v-rel* are predomiaantly IgW B cells of a mature phenotype (Barth and Humphries,
1988; Barth and Humphries, 1988). This suggests that the molecular requirements for v-
rel* mediated transformation are found in B cells only d e r maturation.
In order to comprehend fully the mechanism of v-rel*-mediated oncogenesis, as
well as the cellular requirements for transformation, it is first necessary to know which
ce11 lineages are susceptible to transformed by the oncogene. I t is stiil not clear whether
v-rel* mediated transformation is restricted to mature B cells due to the requirement for
cellular infection by RevT. Since RevT is dependent on the CSV helper virus for
successful infection of host cells. This implies that infection by RevT is most likely
Iimited to ce11 lineages that express receptors for the ENV protein of CSV. CurrentIy, the
RevT(CSV) receptor is undefmed.
In order to circumvent the need for infection of cells by RevT, we have designed
a systern to generate chickens that are somatically transgenic for a conditional forai of the
v-rel* oncogene. This system, which ailows for expression of the v-rel* oncogene in a
![Page 50: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/50.jpg)
helper fiee marner, is based on the RCAS vecton developed by Steve Hughes (Hughes
et al., 1987). The RCAS vecton have been successfully used in our laboratory for
expression of transgenes, such as Bcl-2, in vitro and in vivo (Jacobsen et al., 1996).
Since we wanted to use this system to generate chickens that are somatically
transgenic for v-rel*, we were concemed that expression of the oncogene early in
embyogenesis might be fatal in developing chicks. For this reason, we chose to place the
oncogene under conditional expression, and the tetracycline repressible system developed
by Gossen and Bujard (1992) was uicoprated into the retroviral gene transfer cassettes,
together with the v-rel* oncogene. Our goal was to use this system to determine the ce11
lineages that are transformed by v-rel* in situ. Results of our experiments would provide
insight on the mechanism by which v-Rel* mediates transformation.
A. FEATURES OF THE RCAS V ~ c r o ~ s
i. The RCAS Vector
The Replication Comptent Mian Leukosis LTR with Splice Acceptor @CAS)
vectors were used for somatic transgenesis of developing chicks. These vectors were
developed by Steve Hughes (Fredenck, MD) for the purpose of retroviral-mediated gene
transfer into chicken cells both in vitro and in vivo. The prototype virus, the SR-A strain
of Rous Sarcoma Vinis (RSV), was modified in many ways to give the resulting RCAS
vector (Figure 4) (Hughes et al., 1987). The RCAS vectors have fully functional gag,
pol and env genes encoded by the parental RSV, however, the 5' and 3' LTRs found in
these vectors were derived fkom the avian leukosis vins ( U V ) . Encoded within the
proviral vector is a single splice donor (SD) that is found within the gag gene, and two
splice acceptors (SA) that flank the env gene.
The key to the RCAS vector is that it has been engineered to have a unique Cla
1 site downstream of the env gene, into khich any transgene (Tg) can be cloned.
Transcription of the viral gag, pol and env genes and the Tg inserted at the Cla 1 site is
initiated fiom the strong 5' LTR of the RCAS virus. Post-transcriptional processing of
![Page 51: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/51.jpg)
the RCAS transcript occun fiom the splice donor to either one of the downstrearn splice
acceptors. Processing of the transcnpt in this fashion gives rise to a functiond message
encoding either the envelope protein (ENV) or the trasgene (Tg) depending on the splice
acceptor used.
The RCAS vectors encode productive viruses that are tropic to a wide array of
avian cells. Moreover, the RCAS virus is non-pathogenic to chicken cells. Therefore,
infection of chickens with the RCAS virus at early stages of ernbryonic development,
Ieads to the dissemination of infectious viral particles throughout the animal. Taken
together, the RCAS vector is ideal for generating somatically transgenic chickens: not
only does RCAS have the ability to infect multiple ce11 lineages in vivo, but also,
retroviral encoded genes, including the transgene, are expressed in the infected cells.
ii. The RCAN Vector: An Alternate Form of RCAS
Another form of the RCAS vector exists: the Replication sompetent Avian
Leukosis LTR with &O Splice Acceptor (RCAN) (Figure 4). Both RCAS and RCAN are
identical in al1 aspects, except that RCAN is missing the second splice acceptor, which is
just upstream of the Cla 1 cloning site. This means that transcripts driven fiom the 5'
LTR of RCAN c m be processed fiom the SD to the first SA to give a functional message
coding for the ENV protein. However, due to the absence of the second SA, the
transcnpt cannot be processed for the production of functional Tg message. ïherefore,
genes cloned into the Cla 1 site of the RCAN vector are not expressed at the protein
level. This property of RCAN makes it possible to clone a transgene dong with its own
promoter into the Cla 1 cloning site of the vector, such that expression of the transgene is
not controlled by the 5' LTR of the vecror, but rather by the promoter associated with the
transgene.
In addition to the viral genes and the cloning sites, both RCAS and RCAN
vectors carry an ampicillin resistance gene (Amp?, as well as an origin of replication
denved from Escherichia coli (On). These elements allow for proviral amplification in
bactena as a high copy number plasmid.
![Page 52: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/52.jpg)
Figure 4. The RCAS Retroviral Gene Trnnsfer Cassette. The RCAS vectors are based on the SR-A strain of the Rous Sarcoma Virus. There is a unique Cla 1 cioning site located downstream of the viral encoded env gene. A spiice donor (SD) is found within the gag gene. The RCAN provinis only contains one splice acceptor (SA) while K A S has a second SA immediately upstrearn of the cloning site. These vectors possess a strong ALV 5' LTR and the Bryan "hi& titer" polymerase. The E. coli replicon (Ori) and the ampicillin resistance gene (Amp 7 allow for amplification of the provirus in bacteria. RCAS and RCAN vectors with different ENV regions allow for super-infection of ceils with multiple viral vectors.
![Page 53: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/53.jpg)
RCAS
SD SA Cla 1
Figure 4. The RCAS Retrovinl Gene Transfer Cassette
![Page 54: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/54.jpg)
iii. Multiple Sub-Groups of the RCAS Vecton
The env gene encodes the viral envelope protein, ENV, which is expressed at the
surface of viral particles. Expression of ce11 surface receptors specific to the ENV protein
determines whether a ce1 is susceptible to a particular viral infection. Furthemore, cells
cannot be infected with multiple virai particles bearing the same ENV protein.
Therefore, cells infected with a RCAS virus of one sub-family cannot by infected with
other RCAS viruses of the same family. Differences in the env regions do allow for
super-infection of cells by more that one type of virus. Two families of the RCAS
vector, having different ENV regions, exist. These are UCAS(A) and RCAS(B).
Similarly, the same sub-grouping of the RCAN vectors exists: RCAN(A) and RCAN(B).
Any combination of viruses fiom the two different sub-families (A + B) can be used to
doubly infect chicken cells. The existence of two sub-groups of RCAS and RCAN
vectors has been exploited in the work presented in this thesis.
B. USINC THE RCAS SYSTEM FOR SOMATIC TRANSGENESIS
The RCAS provirus is used to transfect naïve line O CEFs in vitro by calcium
phosphate precipitation (Figure 5). The plasrnid integrates into CEF DNA, and
ultimately results in the production of replication competent retroviral particles; the
transgene cloned into the RCAS vector is also included in the virus. Approximately three
days post-transfection, proviral DNA has integrated into the host genome and viral
proteins are expressed in the cytoplasm of the CEFs. The transgene originally cloned
into K A S is also produced by CEFs at this time. Both viral and Tg protein can be
detected by flow cytometry or by western blot. Our laboratory has successfully used the
RCAS system to express the BcI-2 protein in CEFs. Since the line O strain, fiom which
CEFs were derived, are free of exogenous and endogenous retroviral genomes (Astrin et
al., I979), RCAS transfected CEFs serve as a source of RCAS virai stocks, which are
collected as supernatants (Figure 5) .
Viral supernatants obtained fiom transfected CEFs can be used to idect naïve
CEFs. More importantly, injection of viral supernatants into the eggs of chick
![Page 55: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/55.jpg)
Figure 5. Somatic Tnnsgenais by RCAS Ut vitro & in vivo. Naïve line O CEFs that are transfected with RCAS provirus express viral and Tg proteins. Supernatants fiom these CEFs serve as infectious viral stocks, and are injected in ovo for the generation of somatically transgenic chickens.
![Page 56: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/56.jpg)
Transfect with Harvest viral SIN - or RCAS provirus Transgenic CEFs
Naïve CEF
Day 2 1
Inject 1 OOplof virus S/N
Transgenic B ird
Figure 5. Somatic Transgenesis by HCAS Vectors itz vitro & in vivo
![Page 57: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/57.jpg)
embryos leads to the dissemination of infectious viral particles, encoding the transgene,
to many different tissues of the developing cbick, including al1 lymphoid organs
(f etropoulos and Hughes, 1991 ; Petropoulos et al., 1992). Therefore, by hatch the chick
is essentially transgenic for the transgene originally cloned into the RCAS vector (Figure
5). RCAS vectors of different sub-families can be used together to doubly infect either
CEFs or chick enbryos.
Expression of genes that are linked to minimal promoters under the control of
tetracycline operator sequences (TE) can be induced in the presence of a strong
transactivator. A tetracycline sensitive transactivator, tTA, was made as a fusion protein
between the transactivating domain of Herpes Sirnplex Virus VP 16 and the tet-repressor
that regulates the TnlO tet-resistance operon of E. coli (Gossen & Bujard, 1992).
Constitutive tTA expression in the absence of tetracycline alIows for binding of the
transactivator to the TRE, and this activates transcription of a downstream gene.
However, in the presence of tetracycline, the tTA is sequestered away from the TRE,
preventing expression at the level of transcription.
D. INTEC~UTINC THE TETRICYCLINE RESPONSIVE SYSTEM WITH THE RCAS VECTORS
In generai, transcription of genes cloned into the Cla 1 site of either RCAS or
RCAN is controlled by the 5' LTR. However, pst-transcriptional processing of the
transcript from the splice donor to the second splice acceptor is essentiai for translation of
the message. Processing of the transcript in this fashion oniy occurs for RCAS, since
RCAN lacks the second splice acceptor. Expression in RCAN can be manipulated by
introducing a novel promoter dong with the tmnsgene into the Cla 1 cloning site. This
has been successfùlly carried out with both the chicken p-actin and the mouse
metallothionein promoters linked to the CAT gene (Petropoulos and Hughes, 1991). The
![Page 58: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/58.jpg)
Figure 6. Conditional Expression of -Traesgeoe Using the RCAS System. The tetracycline sensitive transactivator (tTA), which was cloned into the RCAS(A) vector, is constitutiveiy produced and induces expression of the transgene, cloned into RCAN(B), fiorn the tetracycline response element (TRE). In the presence of tetracycline tTA is sequestered away fiom the TRE, thereby inhibiting tramactivation.
![Page 59: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/59.jpg)
![Page 60: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/60.jpg)
chicken B-actin promoter was cloned with the CAT reporter gene into the Cla 1 site of
RCAN in both the sense and anti-sense orientations. Elevated levels of CAT were
detected in transfected cells, regardless of the orientation of the Tg in the RCAN vector.
This suggests that expression of CAT was independent of the 5' LTR of RCAS and
instead, was dependent on the chicken f3-actin promoter. Furthemore, when CEFs were
transfected with a RCAS construct that has the CAT reporter gene linked to the mouse
metallothionine promoter, ZnSO, was necessary for CAT expression. Therefore,
exogenous promoters have proven to be fùnctional when cloned into RCAS based
vectors.
ï h e tetracycline repressible system, described above, has two essential
components: the tetrac ycline sensitive transactivator, tTA, and the tetracycline response
element (TRE), which consists of tetracycline operator sequences linked to a minimal
promoter. Constitutive expression of the tTA is required for induction of genes linked to
the TRE. For this reason, tTA was cloned into an RCAS based vector (Figure 6). In the
RCAS virus, transcripts initiated fiom the 5' LTR are indeed processed to allow
expression of the transgene cloned into the Cla 1 site. Thus, the tTA, which is cloned
into RCAS, is constitutively expressed. On the other hand, conditiona1 expression of v-
rel* is dependent on the TRE. If tTA is cloned into a RCAS vectors of the A sub-group,
TRElv-rel* can be cloned into sub-group B members of the RCAS/N family. Therefore,
the two viral constmcts can be used together for double infection of cells both in virro
and in vivo (Figure 6).
Resui ts
A. CLONINC THE TETRACYCLINE SENSITIVE TRANSACTIVATOR INTO RCAS(A)
The tetracycline sensitive transactivator, tTA, which was used in the work
presented here, was initidly isolated fiom a Bluescnpt plasmid (Stratagen) containhg the
tTA (provided by Dr. Alan Cochran, Univer$ty of Toronto). Previously, the tTA was
cloned into an RCAS vector of the A subgroup (RCAS(A):tTA) (Martinez, O., 1 996). At
that t h e , the efficiency of the transactivator was detennined by CAT assay in CEFs: the
RCAS(A):tTA vector was CO-transfected with a vector that contained the CAT reporter
![Page 61: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/61.jpg)
gene under the control of the TRE, pCMVtCAT (Figure 7). CEFs were incubated for 24
hrs in the presence or absence of tet (1 Opg/d). CAT expression was inhibited in doubly
transfected CEFs by the presence of tet.
B. CLONINC THE TETFUCYCLINE RESPONSIVE ELEMENT INTO RCAS(B) AND RCAN(B)
i. Cloaing the TRE iato RCAS(B) and RCAN(B)
RCAS based vectors were engineered to have a unique Cla 1 cloning site
domnstream of the gadpoUenv region. Traditionaiiy, Cla 12 has been used as an adapter
plasmid to facilitate cloning of the transgene into the RCAS based vectors because the
Cla 12 polylinker is flanked by Cla 1 sequences (Hughes et al., 1987). Therefore, after a
transgene is cloned into the polylinker region of Cla 12, it can be lifted out in its entirety
by a CIa 1 digest. In this fashion, the isolated transgene has Cla 1 compatible ends and
can then be sub-cloned into the Cla 1 .site of RCAS or RCAN. One difficulty
encountered in cloning the v-rel* transgene into the RCAS based vectors is that v-rel*
has an interna1 Cla 1 site at position 441. Therefore, it was not possible to isolate the
entire v-rel* sequence as a Cla 1 fiagrnent fiom the Cla 12 shuttle vector. For this
reason, cloning of v-rel* into RCAS and RCAN took place in several steps.
Previously, the tetracycline repressible element (TRE) was cloned into the
polylinker of the Cla 12 shuttle vector at an Eco R1 site to give Cla 12:T (Figure 8)
(Martinez, O., 1996). The TRE was isolated from the pUC-13-3 plasmid (provided by
Dr. Alan Cochran; Gossen and Bujard, 1992) via an Eco R1 digest. Orientation of the
insert was confirmed by a combination of restriction mapping and sequencing.
Moreover, Cla 12:T was further modified by the insertion of a strong B-globin
polyadenylation signal (PA), to enhance post-transcriptional processing. The PA was
obtained from pGEM 32 f(-) (provided by Dr. Nicholas Acheson, McGill University;
(Lanoix and Acheson, 1988)) as a Sa1 1 fragment and then cloned into the Sd 1 site of
the Cla 12 polylinker, downstream of the TRE, to give Cla 12:TP (Figure 9). Orientation
of the PA was confimed by sequencing.
![Page 62: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/62.jpg)
Both Cla 12:T and Cla 12:TP were M e r rnodified as described below. A Sac
l/Spe 1 fiagrnent \vas removed from both vectors, and was replaced by a double stranded
oligonucleotide sequence, [WE + WE'] (synthesized at Sheldon Biotechnology, McGill
University) (Figure 8 & 9). Not land Eco RV sequences, as well as a Kozak sequence
(K), for enhanced translational eficiency (discussed below) (Iida and Masuda, 1996), are
al1 embedded within this 17mer oligonucIeotide. The resulting shuttle vectors, Cla
12:TK and Cla I2:TKP, both possess these three novel elements (Not 1, Eco RV and K)
downstream of the TRE. Insertion of the oligonucleotide was confirmed by restriction
mapping (Figure 10)-
TREK and TREMPA sequences were isolated fiom the Cla 12 shuttle vectors
by Cla 1 digests. These Cla 1 fragments were then sub-cloned into the unique Cla 1 site
of either RCAS(B) or RCAN(B) vectors in either the sense or anti-sense orientation. The
resulting vectors (Figure 1 1) were:
O pSBT: RCAS(B) with the T R E k sequences
pNBT: RCAN(B) with the TRE/Kz sequence
pSBP: RCAS(B) with the TRE/Kz/fA sequence
O pNBP: RCAN(B) with the TRElWPA sequence
O pNBi: RCAN(B) with the TREKzlPA sequence inserted in the inverse
orientation to viral encoded genes
ii. Cloning the v-rel* Transgene into the Modified RCAS(B) and RCAN(B) vectors
The first step was to modify the pMJ1 .O vector (Figure 12). The pMJ 1 .O plasmid
is based on the pCRIITM vector (Invitrogen, CA). First, a 8bp fiqgnent was removed
from pMJ1 .O by a Spe 1ISac 1 double digest. The same double stranded oligonucleotide
described above, (K/E + WE'), was cloned into the Iinearized pMJ1.0 since the Sac 1 and
Spe 1 ends of the double stranded oligonucleotide were compatible with the Sac 1 and
Spe 1 ends. The modified pblJ1 .O was then digested with Eco RV to remove a 40bp
fragment. The Iinearized vector was gel purified and then self-ligated. The final product,
pRAO1, was a circularized plasmid having a unique Eco RV site flanked by Not 1
sequences.
![Page 63: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/63.jpg)
Figure 7. The RCAS:tTA Construct. a) The tTA was isolated from Clal2:tTA as a Cla 1 fragment and cloned into the unique Cla 1 cloning site of RCAS(A) (Martineg O., 1996). b) RCAS:tTA can induce CAT expression fiom a reporter plasmid, pCMVtCAT. CEFs were doubly transfected with RCAS(A):tTA and pCMVtCAT. The reporter plasmid has the CAT gene under the control o f the TRE. Transfectsd CEFs were incubated in the presence or absence of tet (10pg/ml) for 24 hours. CAT assays were carried out on these cells to detennine the amount of CAT enzyme being expressed. (Martinez. 0.. 1 996)
![Page 64: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/64.jpg)
Clal 2:tTA poly linker Sa1 1
5' 3'
Sa1 1 -.-l
SD SA SA a- m 6557
2322 CL
r, tTA 500
CAT EnzymenSmm culture (pg)
Figure 7. a) The RCAS:tTA Construct. b) RCAS:tTA can induce CAT expression from a reporter plasmid, pCMVtCAT. (Work done by Omalso Marti nez)
![Page 65: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/65.jpg)
Figure 8. Modifying the Clal2:T Shuttle Vector by addition of a Kozak Sequence. The tetracycline repressible element (TRE) was cloned into Cla12 as an EcoRl fiagrnent to give Clal2:T. Restriction mapping was carried out to cofirm orientation of the insert (Martinez, O., 1996). Clal2:T was then modified by cloning an oligonucleotide, which coded for both a Kozak sequence and a Notl site, into the polylinker. The two strands of the oligonucleotide, KzEcoRV & (KzEcoRV)', were designed to give 5' and 3' overhangs that were complementary to Sac 1 and Spe 1 sites, respectively (synthesized at S heidon Biotech., Montreal, QC). The resulting vector, Clal 2:TK, was analyzed by restriction mapping.
![Page 66: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/66.jpg)
Cla 12
GCGGCCGCCACGATATC TCGACGCCGGCGGTGCTATAGGATC
6557
2322 4- TRE
500
Cla 1
T
Kozak Sequence
Figure 8. Medifying Clul2T by Addition of a Kuzak Sequencr
![Page 67: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/67.jpg)
Figure 9. ModiTying CIal2:TP Shuttle vector by Addition of a Kozak Sequence. Clal 2:T (see Figure 8) was fust modified by cloning a strong poly-adenylation (PA) signal into the Sa11 site of the polylinker to give Clal2:TP. Orientation of the PA was confirmed by sequencing; the hatched bar shows the region that was fülly sequenced (Martinez, O., 1996). Clal 2:TP was then modified by cloning an oligonucleotide, which coded for a Kozak sequence and a Notl site, into the polylinker (see Figure 9 for the design & synthesis of the double stranded oligonucleotide sequence). The resulting vector, Cla l2:TKP, was analyzed by restriction mapping.
![Page 68: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/68.jpg)
- .
Cla 12
GCGGCCGCCACGATATC TCGACGCCGGCGGTGCTATAGGATC t Kozak Sequence
Figure 9. Modifying ClalZTP by Addition of a Kozak Sequence
![Page 69: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/69.jpg)
Figure 10. The Clal2:TK and CIal2:TKP Shuttle Vecton. This figure represents a schematic o f the modified CIa12 vectors. Clal2:TK (a) has the TRE upstrearn of the Kozak, while Clal2:TKP (b) includes a strong PA sequence as well. A unique Notl site is found in the poly-linker of both constructs. These sequences can be lifted out of the shuttle vector in their entirety as a ClaI hgment.
![Page 70: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/70.jpg)
a) Cla 12:TK Not 1 Sa1 1
a) Cla 12:TKP Not 1 Sa1 1
5' 3'
Figure 10. Clal2:TK & Clal2:TPK Sbuttle Vecton
![Page 71: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/71.jpg)
Figure 11. Cloning T K & TKP into RCAS(B) and RCAN(l3). The TREK was lifted out of the Clal 2 shuttle vectors as a Clal fragment. This fragment was then cloned into the unique Clal cloning site of RCAS(B) and RCANP), to give pSBT and pNBT respectively (a and b). The insert was ctoned into the vectors in the same orientation as viral genes, and the orientation was confirmed by restriction digest analysis (c). The same operation was camed out to isolate the TREKPA Fagment fiom CIal2:TKP. This fragment was then cloned into RCAS(B) or RCAN(B) to give pSBP and pNBP (d and e, respectively) and orientation was c o n f i e d by restriction mapping (0. Finally, the T R E W A was cloned into RCAN(B) in the anti-sense orientation, pNBi (g).
![Page 72: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/72.jpg)
![Page 73: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/73.jpg)
![Page 74: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/74.jpg)
1 Not I
Cla 1
Figu n 1 1 cont. pNBi: RCAN(B):TRE:/K/PA.. .Inverse Orientation
![Page 75: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/75.jpg)
Figure 12. The pRAOl Adapter Plasmid. a) First, an oligonucleotide encoding Notl and EcoRV sites was cloned into the Sac 1/Spe 1 sites of pMJ1 .O, which was based on the pCMI vector (Invitrogen, CA) (see Figure 9 for design and synthesis of the double stranded oligonucleotide), b) A 20 bp EcoRV fragment was then rernoved to give the pRAOl adapter plasmid. This plasmid has a unique EcoRV site flanked by Notl sequences. Insertion of the oligonucleotide was confirmed by restriction mapping.
![Page 76: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/76.jpg)
pMJ1.0 polyf inker
Sac1 Spel EcoRV k t 1
GCGGCCGCCACGATATC EcoRV
\ \ \ \ \ \ \ \ \ \ \
Not 1 EcoRV Not 1
Figure 12. The pRAOl Adaptor Plasmid
![Page 77: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/77.jpg)
Figure 13. The pRA02 plasmid ... Cloning w e i * into pRAO1. a) DNA nom the S2A3 ce11 line was used as a template for PCR amplification of v-rel*. The 5' and 3' primers used in the PCR reaction were v-rel 5' start and Rel 3' STOP, respectively (see Materials & Methods). The PCR product was 5' phosphorylated pnor to clonhg into the EcoRV site of pRAOI. The EcoRV site was destroyed in the process. A combination of restriction mapping (b) and sequencing were canïed out to confïrm the orientation of the insert. Hatched bars at the 5' and 3' ends of v-rel* indicate the regions that were fully sequenced.
![Page 78: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/78.jpg)
Not 1 Not 1
21 16 + v-rel*
642 348
Figure 13. The pRA02 plasmid ...Cloning of w e i * into pRAOl
0
![Page 79: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/79.jpg)
Figure 14. Cloning v-rei* into the modified RCAS(B) and RCAN(I3) vectors. The v-rel* transgene was isolated fiom pRA02 as a Notl fragment and cloned into the unique Notl cloning sites of pSBT, pNBT, pSBT, pSBP and pNBi to give pRA03-7, respectively (a-e). Restriction mapping was carried out to confirm orientation of the transgene in the vectors.
![Page 80: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/80.jpg)
![Page 81: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/81.jpg)
![Page 82: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/82.jpg)
Cla 1
Figure 14 cont Cloning v-rel* into the RCAS Bascd Vectors
![Page 83: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/83.jpg)
S2A3 DNA was used as the template for PCR amplification of the v-rel*
oncogene. S2A3 is a myeloid line that has been tranfected with RevT(CSV) provinis.
The v-rel* oncogene was arnplified using PFU polymerase as described previousiy (see
Materials and Methods). The primers used to ampli& the transgene were: v-rel 5' start
and Re1 3' STOP. The 5' primer was designed so that the first nucleotide, G, coded for
the G of the translational start codon of v-rel*: ATG. The 3' primer was designed to
complement sequences downstream of the v-rel* stop codon. PFU polymerase was used
to ampli@ the oncogene for two reasons: 1) PFU polymerase has 3' + 5' exonuclease
activity (Le., proofieading activity), and 2) it does not leave 3' overhaugs (Le., the PCR
products are blunt ended).
The PCR product was purified by gel electophoresis and 5' phosphorylated prior
to ligation. Meanwhile, the pRAO1 plasmid was linearized with Eco RV, a blunt cutter,
dephosphorylated and gel purified. The PCR product, v-rel*, was then cloned into the
Eco RV site of PRAO 1. In the resulting plasmid. pRA02, the v-rel* transgene is a)
flanked by Not 1 sequences, b) preceded by the Kozak sequence and c) has a
reconstituted translation initation codon (ATG) (Figure 13)
The Wv-rei* sequence was lified out of the pRA02 vector in its entirely by a Not
1 digest and then subcloned into the Not 1 cloning sites of the modified RCAS(B) and
RCAN(B) vectors (pSBT, pNBT, pSBP, pNBP and pNBi) to give pRAO3-7 respectively.
Orientation of Wv-rel* in pRA03-7 was confirmed by restriction mapping (Figure 14).
Discussion
Conditional expression of a gene is a powerfùl tcol for studying the functional
and mechanistic roles of the gene product. In order to study in situ transformation by v-
rel*, we chose to clone the oncogene into the K A S vector. However, one complication
of studying the effects of aberrant v-rel* expression in vivo, is that high levels of v-Rel*
expression in chick embryos could compromise normal developmen~ in particular the
developrnent of lymphoid organs. The rational behind ttiis thinking carne from the
evidence that the v-rel* oncogene appears to target lymphoid cells (Barth and
![Page 84: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/84.jpg)
Humphries, 1988) (see Introduction). Therefore, by developing a system to conditionally
express v-Rel* in vivo, chick embryos could develop normally under conditions non-
permissive for v-rel* expression. Once birds are fülly developed (post-hatch), the
oncogene could be induced and the consequences observed.
There are several conditional v-Rel* systems that have k e n developed. In
particular, the v-RelER mutant and the naturally occurring temperature sensitive mutants
of v-Rel, ts v-Re1 (Boehrnelt et al., 1992; White and Gilmore, 1993). The first construct,
v-RelER, has v-Re1 linked to the activation domain of the estrogen receptor. Replation
of v-RelER is at the pst-translational level, with v-RelER activation occurring only in
the presence of estrogen. The second mutant, ts v-Rel, is also regulated post-
translationally, and the permissive temperature is 37°C. Although the ts mutants of v-Re1
are unsuitable for in vivo studies for obvious reasons. the v-RelER mutant is equally
unsuited for studying v-rel* mediated transformation in vivo, since the elevated levels of
estrogen required to activate v-RelER could have unwanted physiological side effects in
chickens. Therefore, we took advantage of the tetracycline-repressible system, whereby
expression of the transgene is regulated by tetracycline (tet), which has no biological
activity with respect to avian gene expression.
A. RCAS(A):tTA Induces CAT Expression from a Reporter Plasmid
Figure 7a is a pictorial representation of the RCAS(A):tTA constnict (Martinez,
O., 1996). Functionality of the tTA constmct was tested by transient transfection assays
in CEFs using the CAT enzyme as the reporter gene. The reporter plasmid used in these
assays, pCMVtCAT (Dr. A. Cochran, University of Toronto), contained the CAT gene
linked to the TRE. CAT expression, which was observed in CEFs doubly transfected
with RCAS(A):tTA + pCMVtCAT, was significantiy attenuated by the presence of
tetracycline (lOpg/mi) (Figure 7b), showing not only that the RCAS(A):tTA vector is
functional, but aiso that the tetracycline responsive system is functional in avian cells.
Recently, Zong et al. (1997) cloned the tet-repressible system into a spleen
necrosis virus (SNV) based vector to conditionally express v-rel in avian spleen cells in
![Page 85: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/85.jpg)
vitro. Successfid control over v-rel expression revealed that in the absence o f tet, the
condition permissive for v-rel expression, avian splenic lymphocytes were rescued fiom
an apoptotic death.
Initial tests with the RCAS(A):tTA t RCAN(B):TRE/Tg were carried out using
CAT as the reporter transgene. Unfortunately, CAT enzyme was not detected when these
two vectors were used for transient transfection assays in CEFs (data not shown). One
possible reason to explain the lack CAT expression in CEFs transfectant for tTA, is that
expression could be hindered at the level of translation. For this reason, we chose to
supplement the TRE/v-rel* constnicts by addition of a Kozak sequence, which
maximizes translational efficiency. The consensus Kozak sequence is a 13mer
oligonucleotide, 5' -GCCGCC(A/G)CCATGG- 3', where the underlined ATG is the
invariant translation initiation codon (Iida and Masuda 1996). Analysis of different
nucleotide combinations by Iida and Masuda (1996) provided a way to quantitate
eficiencies of potential Kozak sequences. The Kozak sequence that was incorporated
into the v-rel+ constmcts (5'- GCCGCCACGATGG -3 ', Figures 8 & 9) was designed for
maximum translation eficiency.
Finally, the TRE/v-Rel* constnicts were introduced into RCAS(B) and RCAN(B)
either in the sense or anti sense orientation (Figures 11). Although expression of v-rel*
from the minimal promoter should be govemed by the TRE, we believed that by cloning
the transgene into the RCAN vector in the opposite direction to viral encoded genes
(pRA07) we could M e r minimize expression fiom transcripts driven by the S'LTR.
In order to test whether the vectors, pRA03-7 (Figure 14), were fimctional,
transient transfection assays were carried out with CEFs in vitro.
![Page 86: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/86.jpg)
Chapter 4. I n vitro assays of the TRE/v-reI* Coastnicts.
Introduction
The constructs that were described in the previous chapter were designed for
somatic transgenesis of the v-rel* oncogene both in vitro an in vivo. The two elements to
the conditional v-rel* expression system are the RCAS(A):tTA vector, which allows for
the constitutive expression for the tetracycline sensitive transactivator (tTA), and the v-
rel* oncogene, which was placed under the control of the tetracycline responsive element
(TRE), was cloned into members of the RCAS vector farnily fiom the B sub-group.
Super-infection of CEFs with both constructs would allow for conditional expression of
the v-rel* oncogene (Figure 6).
Results
A. v-Rel* Expression in CEFs Requires tTA
CEFs either transfected or infected with RCAS provims or virai supernatant,
respectively, were monitored for viral protein expression by flow cytometry (Figure 15).
CEFs transfected with TRElv-rel* constmcts aione, pRA03-7, did not show any v-Rel*
expression, as deterxnined by Western blot (Figure 16, lanes 1, 3, 5,7 and 9 respectively).
Protein lysates were obtained fiom CEFs three days afier transfection, a suficient time
for viral and Tg protein expression in these cells. These transfectant CEFs (pRA03-7)
were then super-infected with RCAS(A):tTA virus and then cultured in the absence of
tetracycline for an additionai five days, dlowing for dissemination of virus through-out
the cultures, for expression of tTA and for induction of v-rel*. Western blot analysis
shows that CEFs previously transfected with.pRA07 (KAN@) with TREWv-rel*lPA
in the inverse orientation) expressed v-Rel* in the presence of the tTA (Figure 16, lane
10). Oncoprotein expression was not observed in other doubly transfected CEFs (lanes 2,
![Page 87: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/87.jpg)
Figure 15. Trnnsfected and Infected CEFs Express High Levels of Viral Protein. CEFs were transfected with lOpg of provirai DNA (see Materials & Methods). Three days afisr transfection, CEFs were stained with anti-viral protein antibodies (HY23 used as diluted hybridoma supernatant, 1 5 v/v) and analyzed by flow cytornetry (b). These cells are positive for virai protein as cornpared to non-transfected, naïve CEFs (a). CEFs infected with virai supernatant gave similar resuits (c). Staining profiles fiom 10 000 cells are shown. Also used for analysis of viral protein expression was the W 2 1 monoclonai antibody (used as diluted hybridoma supernatant, 1 :5 v/v) and similar results were obtained (data not shown).
![Page 88: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/88.jpg)
A. Naive CEFs B. 'rransfected with RCAS(A): tTA provirus
C . Infected with RCAS(A): tTA viral
supernatant
Viral Protein Expression (HY23)
Figure 15. Transfected & Infected CEFs Express High Levels of Viral Protein
![Page 89: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/89.jpg)
Figure 16. The tTA is Required for Expression of v-Rel* in vitro. CEFs transfected with one of the v-rel* constnicts W-3-7) dici not show oncoprotein expression @59v-'e[3 in the absence of tTA (lanes 1, 3. 5, 7 and 9). However, when super-infected with the RCAS(A):tTA virus. CEFs transfectant for p W 7 showed a significant increase in v-Rel* (lane 10). Oncoprotein expression was not observed by the other doubly transfectant CEFs (lanes 2,4,6 and 8). Al1 CEFs expressed the endogenous c-Rel. HY87 hybridoma supematant was used to probe for Re1 protein expression (used as diluted hybridoma supematant, I :5 vh).
![Page 90: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/90.jpg)
Figure 16. The tTA i s Required for Expression of v-Rel*
![Page 91: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/91.jpg)
4,6 and 8). On the other hand, endogenous c-Re1 expression was constitutively observed
in all CEF cultures.
B. Conditional Expression of v-Rel* with Tetracycliae
The transient transfection assays described above suggested that pRA07
(RCAN(B) construct with the TRE/K/v-rel*/PA fragment in the inverse orientation to
viral genes), could be used for conditional expression of the v-rel*. Subsequent assays
with pRA07 + RCAS(A):tTA transfectant CEFs show that v-Rel* expression could be
inhibited by the continued presence of tetracycline (2pg/ml) (Figure 17, lanes 1-3). CEFs
were infected with a mixture of RCAS(A):tTA and pRA07 viral supernatants (l:Iv/v),
and culhired in IMDMIl%CS + tetracycline (2pg/ml). 5 days afier the removal of
tetracycline, expression of the v-Rel* oncoprotein was observed and conùnued to be
expressed for an additionai 3 days (Figure 17, lanes 4 and 5). Tetracycline was refieshed
every second day.
B. Limiting Dilution Assay of Bursal and Spleen Cells
Ex vivo transformation of avian lymphocytes by RevT(CSV) virus is carried out
in 2 0 0 ~ 1 bulk culture containing 75% S2A3 supernatant (Benatar et al., 199 1). Phorbol
rnyristic acetate (PMA) (20 n g d ) is also added to the cultures to increase the frequency
of transformation. Although the molecular basis for this increase is unclear, it is possible
that PMA alters the state of activation of intracellular molecules required for v-Rel*
mediated transformation.
The fiequency of transformation by the conditionai v-Rel* construct (pRAO7),
under permissive conditions (- tet), was established by limiting dilution analysis in 10p1
Terrasaki cultures as described by Marmqr et al. (1993), and compared with the
transforming eficiency of RevT(CSV), which was also determined by iimiting dilution.
Titrated numbers of either bursal or splenic lymphocytes were combined with 75% S2A3
or pRA07 viral supernatant, in the presence or absence of PMA. Transformation in the
![Page 92: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/92.jpg)
Figure 17. Conditional Expression of v-Rel* in vitro. RCAS(A):tTA + pRA07 transfectant CEFs did not express v-Re1 in the continued presence of tetracycline (2pg/ml) (lanes 1,2 and 3). However, removal of tetracycline resulted in v-Rel* espression within 5 days (lane 4), and the oncoprotein continued to be expressed thereafter (lane 5). Expression of c-Re1 was consistent regardless of the presence or absence of tetracycline. The Hy87 monoclonal antibody was used to probe for Re1 expression (see Figure 16).
![Page 93: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/93.jpg)
- Tet
DAY
Figure 17. Conditional Expression of v-Rcl* in virro
![Page 94: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/94.jpg)
Figure 18. Screening for tTA Transgenic birds by Flow Cytomehy. Lymphocytes were harvested fiom blood of normal and transgenic birds and screened for expression of virai proteins with the HY23 monoclonal antibody (see Figure 1 S), and analyzed by flow cytornetry. Lymphocytes fiom tTA transgenic birds expressed hi& levels of Wal protein (b) while normal birds did not (a). Staining profiles fiom 10 000 cells are shown. The same analysis was carried out on bursal and splenic lymphocytes tkom normal and transgenic birds (data not shown).
![Page 95: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/95.jpg)
Normal tTA Transgenic
Figure 18. Scretning for tTA transgenic Birds by Flow Cytometry
![Page 96: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/96.jpg)
Figure 19. Bursal C e l are Transformed by RevT(CSV) and not by pRA07. Limiting dilution assays were carried out for bursal cells fiom normal (a) and tTA transgenic (b) birds as described previously (Marmor et al., 1993). Titrated nurnbers of bursal cells were grown in 10pl Terrasaki cultures (74/point) containing 75% virai supernatant (either RevT(CSV) or pRA07), in the presence or absence of PMA (20nghl). lOpl cultures were scored as positive when ce11 growth completely covered the bottom of the well. Bursal ceHs are clearly transformed by RevT(CSV) regardiess of tTA expression. The conditional form of v-rel*, encoded by pRA07, was unable to transform bursal cells fiom either normal or tTA transgenic birds.
![Page 97: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/97.jpg)
Input Ce11 Number
A 200 400 600 800 1000
RevT(CSV) + PMA RevT(CSV) -PMA
a vRA07+PMA
Input Cell Number
n 200 400 600 800 1000
C. Transformation of Bursal Lymphocytes by Revï(CSV) & pRAO7
Figure 19. Bursal Cells are Transformed by RevT(CSV) and not by pRAO7
![Page 98: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/98.jpg)
Figure 20. SplenK Lymphocytes are.trpnsformed by RevT(CSV) and pRA07. Limiting dilution andysis (see Figure 19) was carried out on normal (a) and tTA transgenic (b) birds. RevT(CSV) was able to transfomi splenic lymphocytes regardless of tTA expression. The pRA07 virus, in which v-rel* was placed under conditional expression, was unable to transfomi normal splenic lymphocytes. However, splenic Iymphocytes fiom tTA transgenic birds were transformed with a poor efficiency in ex vivo cultures.
![Page 99: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/99.jpg)
Frequency Non-transforming hm
Frequency Non-traasforming log(f)
![Page 100: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/100.jpg)
1 0 ~ 1 cuitures was considered positive when ce11 growth completely covered the bottom
of the well. Lymphocytes used in the limiting dilution assays were taken fiom either
normal control or tTA transgenic birds (see Figure 5 for generation of somatically
transgenic chickens). Analysis by flow cytornetry confirmed high levels of viral protein
expression by tTA transgenic lymphocytes (Figure 18).
The fiequency of non-transfomed cultures was plotted against the number of
input celis per well on a semi-log scale, and regressional analysis of the limiting dilutions
assays were used to determine the efficiency of transformation of the viruses
(RevT(CSV) or PRAO?. Figure 19 and 20 indicate that the conditional v-Rel*
expression system (pRAO7 + RCAS(A):tTA) only transforms splenic lymphocytes in ex
vivo cultures, and that pRA07 transfonns these much less efficiently than RevT(CSV).
Discussion
A. v-Rel* Expression in CEFs Requires tTA and is Inhibited by Tet
The RCAS provirus in teptes into cellular DNA following successfid
transfection of CEFs (discussed previously). Subsequently, transcription of viral genes is
induced from the 5' LTR allowing for an efficient way to screen cultures for successfid
transfectants. Previous work by Ozvaldo Martinez (1 996) demonstrated that the
RCSA(A):tTA construct was functional in CEFs. As seen in Figure 16 it is clear that the
v-Rel* is not expressed in single transfectant cells (pRA03-7) as predicted since
oncogene expression is govemed by the TRE. Initially, we thought that minor levels of
v-Rel* expression would be observed in the RCAS based vectors (pRAO3 and 5), since
transcripts are processed fiom the SD to the second SA, which is found just upstream of
the Cla 1 cloning site. However, leaky expression of the oncoprotein was not observed.
The message derived by pst-transcriptional processing possesses a long TRE encoding
sequence (-450Bp) preceding the translation 'initiation codon for v-rel*. Therefore, it is
possible that proper assembly of the translation initiation machinery is hindered, thereby
preventing expression of v-rel*. On the other hand, le* expression from the K A N
![Page 101: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/101.jpg)
based vectors was not expected, siafe pst-transcriptional processing of the transcript
does not occur, and the outcome was as predicted (Figure 5, lanes 7 & 9).
Super infection of the CEFs with RCAS(A):tTA virus reveaied expression of v-
Rel* in pRA07 transfectants (Figure 16, lane 1 O), but not in the other transfectant cells
(pRA03-6). It is unclear why expression is not observed fiom the other super-iafected
transfectants (pRA03-6). The possibility that mutations could have occurred during the
cloning process, resulting in non-fùnctional constructs is one explanation for the lack of
v-Re1 * expression by the transfectant cells.
Previous work in our laboratory suggests that the strong polyadenylation (PA)
signal is essential for post-transcriptional processing of the message. PCR amplification
of the v-rel transgene fiom S2A3 DNA, did not include an endogenous PA signal, and
two of the TRElv-rel* constmcts, pRA03 and 4, did not include this element. In
addition to post-transcriptional processing, recent studies clearly demonstrated that the
PA signal enhances translation initiation in.eukaryotic cells by recruiting the subunits of
the translational rnachinery (Preiss and Hentze, 1998). Therefore, in the transient
transfection assays with the p u 0 3 and pRA04 vectors, transcription rnight have been
induced fiom the TRE by the transactivator (tTA), but translation of these messages was
inefficient due to the absence of the PA signal. It would be necessary to look at the level
of rnRNA, eitfier by RT-PCR or by Northern blot, to see if v-rel* message is indeed
present in these cells.
The pRA07 transfectants, on the other hand, did show v-Rel* expression when
super-infected with tTA containhg virus. Orientation of the v-rel* transgene in pRA07
opposes the orientation of viral encoded genes (Figure 14). Therefore, transcription of v-
rel* from the TRE is completely independent of the 5' LTR of the parental vector,
RCAN. In addition, this construct, pRA07, contains the strong PA s ipa l that allows for
proper post-transcriptional processing.
Conditionai expression of v-rel by transfectant CEFs (RCAS(A): tTA + pRA07)
was tested by culturing cells in the presence or absence of tetracycline (2pgh.I in
IMDM/l%CS). These assays show that the expression of v-Rel* is inhibited by the
presence of tet. Initially, CEFs were cultured in the presence of tet, which is non-
![Page 102: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/102.jpg)
permissive for v-rel* expression. From these cultures, cells were taken and cultured in
IMDM/l%CS (- tet) while another group was maintained on tet for another 5 days.
Figure 17 clearly demonstrates that the continued presence of tet (2pg/ml) was enough to
inhibit v-Rel* expression at the protein level.
The concentration of tet used in the tetracycline repressible system varies for
different ce11 types, ranging fiom 0.5-10pg/ml (Xu et al., 1998; Bettany and Wolowacz,
1998). Incidentally, the concentration of tetracycline required to inhibit v-rel* expression
in RCAS(A):tTA + pRA07 transfectant CEFs (Figure 17) was 2pg/mL However,
initial charactenzation of the RCAS(A):tTA constnict reveled that higher levels of
tetracycline (1 Opg/ml) was required to inhibit CAT expression fiom reporter plasmids in
CEFs (Figure 7b). This is the same concentration (10pghî) required to inhibit tTA in
transfected U937 cells (Martinez, O., 1996). The concentration of tet required to inhibit
tTA in CEFs was not previously titrated, and it was never determhed whether tet
c O ncentratio ns < l O&ml were adequate for tT A inhibition. Furthemore, the reporter
plasmid that was used to test the efficiency of tTA in CEFs, pCMVtCAT, is based on the
cytomegalovirus (CMV). It is possible that higher ievels of tet are required to inbibit
transcription from pCMVtCAT than fiom the RCAN based vector (pRA07) for reasons
that are unclear.
B. pRA07 Transforms Cells In Vitro with a Poor Efficiency
Transformation of lymphocytes ex vivo by RevT(CSV) is a usefd way to extend
B ce11 life in culture and to study B cell development in vivo since RevT mediated
transformation appears to fieeze cells in time (Barth and Humphries, 1988; Bose, 1992).
Our laboatory routinely uses this tool to midy B ce11 development. Cells are cultured in
IMDLW~%CS containing 75% RevT(CSV) viral supernatant and PMA (20nglml)
(Benatar et ai., 1991). The molecular mechanism for PMA-enhanced transformation
efficiency is still unclear, but it is possible that activation by PMA is in involved in
rendering lymphocytes more susceptible to v-rel*-mediated transformation.
![Page 103: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/103.jpg)
Previous work done in our lab by Marmor et al. (1993) used Iimiting dilution
assays to quantitate the eficiency of RevT(CSV) transformation of Con A-activated
splenic T cells. In this assay, the viral titer is not limiting and the fiequency of growth is
directly proportional to input ce11 numbers. By linear regression analysis of the limiting
dilution assay, the fiequency (B of cells transformed by RevT(CSV) can be caiculated.
In this fashion, it was determined that -1 in 420 activated splenic T cells was
transformed by the RevT(CSV) virus (f= 1/420).
Similarly, limiting dilution assays were used to determine the transformation
efficiencies of RevT(CSV) and pRA07. Figures 19 & 20 show the linear regression
analysis of the limiting dilution assays for bursal and splenic lymphocytes, respectively.
These assays were carried out using normal lymphocytes as well as those derived fiom
tTA transgenic birds (see above). It is clear that pRA07 is unable to transform normal
bursal cells (Figure 19a), which do not express the transactivator (tTA), either in the
presence or the absence of PMA. On the other hand, RevT(CSV) transformation of
bursal cells showed that -1 in 1198 bursal ce11 is transformed in the presence PM&
while -71 76 bursal cells are required for a single transformation event in the absence of
PMA. Therefore, PMA clearly enhances the transformation eficiency of RevT(CSV).
Transformation of tTA transgenic bursal cells ex vivo by RevT(CSV) is similar to
that of normal bursal cells (Figure 19b): 1 in 1298, and 1 in 6142 bursal cells are
transformed in the presence or absence of PMA, respectively. Interestingly, pRAO7
virus did not transform tTA transgenic bursaI cells at d l . One possible reason for this is
that bursal cells are not the primary targets of v-Rel* transformation. This is consistent
with findings that suggest the mature phenotype of B cells transformed by RevT(CSV)
in vivo @eg et al., 1992).
The same limiting dilution assays were carried out with splenic lymphocytes fiom
normal control and tTA transgenic birds (Figure 20). As seen previously, pRA07 virus
does not rtansform lymphocytes obtained fkom normal spleen, which lack the tTA.
RevT(CSV) was found to transform splenic lymphocytes with a fiequency of -1 in 3205
in the presence of PM& and less efficiently, -1 in 4939 splenic cells, in the absence of
PMA. This fiequency is less than that of bursal cells, possibly due to the high
![Page 104: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/104.jpg)
proportion of non-activated T cells nonnally found in the spleen. Splenic T cells must
be activated, by Con-A for example, for successful transformation by RevT(CSV)
(Marmor et al ., 1 993).
The virus bat codes for conditional v-rel*, pRA07, is able to transform tTA
transgenic splenic lymphocytes, aibeit with a very low efficiency. Regressional analysis
of the limiting dilution assay demonstrated that - 1 in 36 970 splenic lymphocytes that
express the tTA were trmsformed by pRA07 in the presence of PMA and under
conditions permissive for v-rel* expression (- tet), and if PMA is not present pRA07
transforms -1 in 75 020 splenic lymphocytes (Figure 20b). Once again, the presence of
T cells in the splenic lymphocyte cultures could explain why the efficiency of
transformation is very low, supporting the notion that v-rel* preferentially targets B ce11
transformation.
![Page 105: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/105.jpg)
Chapter 5. In vivo Expression of ~ R e f *
Introduction
Different stages of avian B ce11 development are identified by rearrangement of
the Ig locus, by the presence of ce11 surface markers, and by expression of the Ig receptor
(dg) . The earliest stage of cornmitment to the B ce11 lineage entails the D to JH
rearrangement of the immunoglobulul heavy chah locus. Through PCR analysis,
Reynolds et al. (1992) were able to detect DJ rearrangements in the yoke sac of day 516
embryos. Subsequent rearrangement of the Ig locus occurs in a stochastic fashion, to
complete either heavy chain or the light chah remangement, resulting in VDJN-J or V-
DJNJ phenotypes, respectively (Benatar et ai., 1992).
The pre-bursal stem cells (pre-busc), which are aiready comrnitted to the B ce11
lineage (Ratcliffe et al., 1986) , are also found in developing embryos, and they are
responsible for colonization of the bursai follicles. Seeding of bursal follicles
commences between day 8 and 14 of embryogenesis (Houssaint et al., 1976). In the
bursa, the pre-busc cells undergo massive proliferation and diversification, with the latter
occurring by gene conversion. Although most of the diversified B cells are destined to
an apoptotic death in the bursa, a small proportion of these cells immigrate to the
periphery, where they can devetop M e r into mature or memory B cells (see
Introduction).
A. Ce11 Surface Markers and B ceIl Development
The expression of ce11 surface markers has been useful for studying lyrnphopoesis
both in mammals and in birds, although the number of avian B cells markers available is
still quite limited. Figure 21 shows the pattern of expression for four avian B ce11
markers at different stages of B ce11 development: Bu-1, Major Histocompatibility
Complex class II (MHC class II), LT2 and ChL12. These four markers were used in the
work presented here for the characterization of B cells fkom normal and transgenic birds.
![Page 106: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/106.jpg)
Figure 21. Ceii Surface Markers on Avian B CeUs. Ce11 surface antigens are expressed at various Ievels at different stages of B ce11 development. B cells fiom normal and transgenic birds were analyzed for expression of these four markers by flow cytometry (see Materials & Methods for a Iist of antibodies used and the working concentrations).
![Page 107: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/107.jpg)
Level of Expression
![Page 108: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/108.jpg)
An important marker for avian B cells is Bu-1, a pan-B ce11 marker (Veromaa et
al., 1988). Although the Bu-1 is expressed at al1 stages of B ce11 development in the
chicken, its expression has also been observed on small numbers of non-lymphoid cells
such as macrophages. Expression of this marker has been observed on cells in the
embryonic spleen at the earliest stages of B ce11 cornmitment (pre-busc), and is expressed
at al1 stages of development, including terminaily differentiated plasma cells (Houssaint
et al., 1987). Until now, the role of Bu-1 in B ce11 ontogeny is remains unclear, but
recent evidence points to Bu- 1 as a mediator of ce11 death (Funk et al., 1997). Similar to
Bu-1, the MHC class II marker is ubiquitously expressed on B cells of al1 stages of
development (Hala et al,, 1977). This rnarker, important for the activation of helper T
cells (Th), is in no way restricted to B ceIls, but it is expressed at intermediate levels at
al1 stages of B ce11 development.
The third marker that was used to describe normal and transgenic B ceUs in the
work presented here, is LT2, an antigen that has been characterized in our laboratoxy
(Paramithiotis and RatclBe, 1996). Although the fùnction of LT2 is not understood, our
laboratory has shown its expression on a specific population of short lived B cells in
peripheral blood. Chicken PBL B cells can be divided into three distinct populations
(Paramithiotis and Ratcliffe, I993), which include short lived (2-3 days) non-dividing
ceIls, longer Iived (2-3 weeks) non-dividing cells and short tived cells generated at extra-
bursal sites (populations 1 -3 respectively) (Paramithiotis and Ratcliffe, 1 993). LT2 is
expressed on the short-lived cells (Population 1), while ce1Is that make up Population 2
are exciusively LT2- (Paramithiotis and RatclifTe, 1996). For this reason, cells in the -
periphery, such as splenic lymphocytes, are heterogeneous for LT2 expression, ranging
fiom LT2- to LTZ'(Figure 21 & 29). Although it has not been confmed, it is likely that
the mature/memory B cells are negative for LT2 expression, since LT2' B cells in the
periphery only have a short life span.
The ChL 12 marker has facilitated the. study of B cell emigration fiorn the bursa.
In the bursa, cells that are committed to the B ce11 lineage, having undergone the initial
rearrangement at the Ig L and IgH loci, are negative for Ch1 12 expression. However, just
prior to emigration, ChL12 expression on the surface of diversified B cells is
![Page 109: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/109.jpg)
dramatically up-regulated (Larnpisuo et al., 1 998). Consequently, peripheral B cells in
the spleen express hi& levels of this antigen (Figure 21 & 29). Splenic lymphocytes,
however, show a sub-population of large ~hL12'" B cells that are resistant to bursectomy
(unpublished data). The proportion of these cells increases significantly 30 days d e r
bursectomy. It is possible that these large lymphocytes, which have down regulated
expression of the ChL12 antigen, belong to a population of mattire B cells.
B. Conditional Expression of v d * In Vivo
The v-rel* oncogene has k e n shown to target B lymphocytes of a mature
phenotype both in vitro and in vivo (Barth and Humphries, 1988; Barth and Humphries,
1988). Therefore, the potential for abnormal development of lymphoid organs and the
potential for premature death of v-rel* transgenic embryos were indeed very h i a . In
order to fulfill our goal of king able to study cells targeted for transformation by v-rel*,
which would ultimately provide insight into the mechanisrn of v-rel*-mediated
transformation, we developed a mode1 that would allow us to study the consequence of
oncogene expression in normal birds.
Having established that the pRA07 constntct could successfùlly be used for
conditional expression of v-rel* in vitro (see Chapter 4), the RCAS-based system was
taken ifi vivo to study transformation by the oncogene in situ. Using this conditional
expression system, transgenic embryos could develop normally until hatch under
conditions that were non-permissive for transgene expression (+ tet). Only after hatch
would v-rel* expression by induced by the removal of tetracycline.
Conditional v-rel* transgenic birds were generated by injection with a viral
cocktail consisting of RCAS(A):tTA + pRA07 (l:lv/v) in ovo dong witb 0.5mg tet to
prevent expression of the oncogene (Figure 22). Embryos were maintained on tet until
hatch by injection directly into the egg every second day. Following hatch, a set of birds
was taken off tet to allow for induction of the v-rel* oncogene and the remaining chicks
were given lmg of tet (in water) every second day via intra-peritoneal injection. Six days
afier hatch, birds were sacrificed and lymphocytes were harvested fiom various organs.
![Page 110: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/110.jpg)
Figure 22. Somatic Trnnsgenesis of Conditional v 4 t A viral supernatants cocktail containing RCAS(A):tTA + pRA07 (1: 1 v/v) was injected into eggs at dl3 of embryogenesis to allow for dissemination of viral particles and infection of multiple ce11 lineages (see Figure 5). AI1 somatically transgenic birds were maintained on tetracycline (0.5mg in dH,O every second day) until hatch. Afier hatch a group of bu& were withdrawn from tetracycline while another group continued to receive lmg of tetracycline (in dH,O) by intra-peritoneal injection every second day.
![Page 111: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/111.jpg)
![Page 112: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/112.jpg)
Results
A. Dramatic Increase in B Cells Numbers in the Spleen and Liver of v-rel*
Transgenic Birds
Normal control and v-rel* transgenic birds, both (+) and (-) tet, were sacrificed
six days afier hatch. Autopsy of transgenic birds that were expressing the oncogene (-
tet) revealed gross enlargement of the spleen and liver, and abnormal white nodules of
ceIl growth were observed in these organs (data not shown). Lymphocytes were
harvested fiom the bursa, thymus, spleen, liver and blood of normal and transgenic
chicks (both + and - tet), and cells were counted by trypan biue exclusion to determine
the total number of lymphocytes in each tissue preparation. Lymphocytes were fixed in
70% ethanoi and analyzed for viral protein expression by flow cytometry as per usual
(data not shown) to confirm RCAS and/or RCAN viral infection in transgenic birds.
Western blot analysis confmed v-Rel* expression by the transgenic lymphocytes
harvested fiom the birds that had been taken off tet (Figure 23).
The percentages of T and B cells in each sample were determined by flow
cytornetrv, based on CD3 and IgM expression respectively. The absolute numbers of T
and B Lymphocytes in each sample were calculated by combining the percentage of
lymphocytes in each sample (FACS data) with total ce11 numbers.
As shown in Figure 24% T ce11 numbers in the thymus, spleen and blood were
comparable for normal birds and transgenic birds regardless of v-rel* expression (+ or -
tet). However, the number of T cells was >100 times greater in transfomed liver (- tet)
than in normal or non-transformed liver (+ tet).
When the absolute B cells numbers were determined for the different tissue
samples, transgenic birds that were expressing v-Rel* (i.e.? - tet) appeared to have a
fewer B lymphocytes, while a slight increase in splenic B cells (-10x) was observed in
these birds (Figure 24b). The major difference, however, was the massive invasion of B
lymphocytes into the liver of the transgenic birds ttiat were expressing v-reI* (-tet).
Compared to the normal controls, transgenic chicks that expressed v-rel* (- tet) had >10
![Page 113: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/113.jpg)
000 times more B cells in the liver. Furthemore, transformed B cells appeared not to be
recirculating since the number of PBL B cells was comparable for normal and transgenic
chicks (-1 0').
B. Transformed Cells in the Liver Include B Lymphocytes
In order to confirm that foreign cells in the liver of conditional v-rel* transgenic
birds (- tet) were B cells, PCR analysis was carried out on these ceIIs to detennine
whether rearrangement at the Ig light chah locus had occurred, a feature that is unique to
B cells. The primers used in this assay were designed to ampli@ a fiagrnent fiom the V,
gene segment, VL5'(2), to a region located within the J-C intron, JC(F). Prior to
rearmgement, the distance between the MO primer binding sites is too large for
amplification to occur; however, rearrangement at the light chah locus reduces this
distance, allowing for amplification. Figure 25 shows that cells harvested fkom the liver
of transgenic birds (- tet) did have a rearranged light chah locus, codrming their B cells
statu.
B. Aberrant Foci of B Ce11 Growth in the Liver of Transformed Chicks.
Sections of liver tissue kom normal and transgenic chicks were stained by
hematoxylin and eosin (H+E) (Figure 26). Cornpared to normal liver, the liver from v-
Rei* transgenic birds (- tet) show distinct foci of aberrant ce11 growth (Figures a & c
respectively). The liver of transgenic birds maintained on tet did not have these colonies
of darkly stained cells (Figure 26, b). Dark purple staining of the ectopic celis in the liver
by eosin suggested that these cells were highly nucleated, which is a characteristic feame
of lymphocytes. In addition, flow cytometry and PCR analysis of transgenic hepatic ce11
samples confmed the infiltration of B cells jnto the liver. Taken together, these results
suggested that the foci of growth in the liver of v-Rel* expressing birds were in fact the B
ce11 infiltrates.
![Page 114: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/114.jpg)
Figure 23. v-Rel* is Expressed by Transgenic Birds that were Withdrawn from Tetracycline. Western blot analysis, using the HY87 antibody (see Figure 15), was carried out on lymphocytes fiom normal and transgenic birds, either + or - tet. Lymphocytes fiom the bursa, spleen and liver of transgenic birds that were uithdrawn from tet showed high level of v-Rel* expression (lanes 5,6 and 7), while normal controls and transgenic birds (+ tet) did not show oncoprotein expression (lanes 1-4). Al1 cells expressed c-Rel.
![Page 115: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/115.jpg)
Normal
(+ tet) (- tet)
Figure 23. v-Rel* is Expressed in Lymphocytes from Transgenic Birds (- te*)
![Page 116: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/116.jpg)
Figure 24. Absolute T and B Cell Numben in Lymphoid Organs and the Liver. Absolute lymphocyte nurnbers were calculated by a combination of ce11 counting and the percentage of T and B cells (as determined by flow cytornetry) in each sample. CD3 and surface IgM were used as markers for T and B cells respectively. The antibodies that were used were CT3 and 4-22 respectively. CT3 was used as a diluted hybridoma supernatant (1:lO vh), and the working concentration of 4-22 was lOpe/ml. Under conditions permissive for v-rel* expression, elevated numbers of B and T cells are seen in the liver and spleen of transgenic birds.
![Page 117: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/117.jpg)
Total T Cell Numben in Nomal & Transgenic Chicks
In PBL
B ce11 Numben in N o m l & Transgenic Chicks
I l Normai 0 (+ tet)
Spleen Liver PBL
Figure 24. Infiltration of ~ ~ r n i h o c ~ t c s into the Livrr of v a l * Transgenic Birds
![Page 118: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/118.jpg)
Figure 25. Transformed Cells in the Liver are B Lymphocyîes. Remangement of the immunoglobulin light chain locus, which is unique to B cells, was probed by PCR analysis using TAQ polymerase. The 5' primer, VL5'(2), binds within the V region of the light chah locus, while the 3' primer, JC(F), binds within the J-C intron. Prior to rearrangement, the primer binding sites are too far apart for efficient amplification. In B ceIls, however, rearrangement of the light chain locus brings the primer binding sites closer together, thereby allowing for amplification of a 700bp DNA fragment. The DT40 B ce11 lymphoma served as a positive control.
![Page 119: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/119.jpg)
Germ Line Configuration of the IgL Locus
Rearranged IgL Locus (B Cells)
2116
Rearranged Light Chain 642
248
Figure 25. Transformed Cells in the Liver are B Cells
![Page 120: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/120.jpg)
Liver sections were analyzed by immunohistochernisty to look at Ig heavy chah
(IgH) and lighi chah (IgL) expression (Figure 26, d-f & g-h respectively). Normally
there is a neglipible amount of B cells found in the liver of chicks (Figure 26, d & g), but
when v-Rel* is expressed, B cells appear as clusten of growth in the liver. Panels f and g
of Figure 26 show that at least some of the aberrant ce11 nodules stain positive for IgH
and IgL respectively. Histology of the liver from transgenic buds maintained on tet is
comparable to that of normal chickens (Panel b & e, Figure 26).
C. Phenotyping B Cells from Normal and Transgenic Birds
Using flow cytometry, we have looked at the expression of the following four cell
surface markers: Bu-1, MHC class II, ChL12 and LT2 on bursal lymphocytes in order to
characterize the B cells fiom normal and transgenic bu&. Figure 27 shows that the
phenotype of bursal cells fkom v-Rel* expressing birds (- tet) is relatively norxnai for al1
four of these markers.
The same four markers were used to characterize splenic and hepatic
lymphocytes. Characteristic of v-Rel* transformed lymphocytes, B cells harvested fiom
the spleen and liver of transgenic birds (- tet) showed high levels of MCH class II
expression (Figure 28). When Bu-1 expression was analyzed, it was found that although
the majority of the B cells in the spleen of v-Rel* transgenic birds were positive for Bu-l
expression, a group of B cells that had down-regulated expression of Bu-1 were
observed. Transforrned lymphocytes obtained fiom the liver of transgenic birds (- tet)
were predominantiy Bu-1' B ceIIs (Figure 28).
Significant differences in LT2 and ChL12 expression were observed between
normal and transformed B cells fiorn the spleen and the Iiver alike. Although little is
known about the role of LT2 in B cet1 development, work done by our laboratory has
suggested that this surface antigen is found on short lived PBL B ce11 populations that
emigrated fkom the bursal cortex (Paramithiotis and Ratcliffe, 1996). Normal expression
of LT2 in peripherd organs, such as the spleen, spans a broad range fiom LT2- through to
LT2' (Figures 21 & 29). It appears, however, that splenic B cells fiom transgeaic birds
expressing v-Rel* (-tet) were predominantly LT2-. Whether this was due to down-
![Page 121: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/121.jpg)
Figure 26. B Cells Tumon in the Liver of v-Rel* Transgenic Bird. H+E staining of normal and v-rel* transgenic liver tissue (a-c). These stains show that normal hepatic tissue had very few lymphocytes. while birds expressing v-rel* (- tetracycline) have distinct foci of lymphocyte growth in their liver. Immunohistochemistry reveals that some of the tumors in the liver of v-rel* transgenic birds are IgH and IgL positive (f and h). Liver tissue fiorn transgenic birds maintained on tetracycline has a normal phenotype (b and e). Panel f shows that not every hepatic -or contained B cells. H+E staining of tissue was done by the Department of Pathology, McGill University, Montreal, QC. The working concentration of the antibodies used for the irnmunohistochemistry, 4-22 & 11C6 (see Materials & Methods), was 30pg/ml.
![Page 122: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/122.jpg)
![Page 123: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/123.jpg)
Figure 27. Bursil Cells from Transgenic Birds Have a Normal Phenotype. B u r d lymphocytes fiom normal and transgenic birds were analyzed by flow cytometry for expression of the ce11 surface markers Bu-1, LT2 and ChLl2 (for antibodies see Materials and Meîhods). Normal expression patterns for these markers are given in Fi,pe 2 2 . Bursal lymphocytes fiom transgenic birds (-tet) expressed normal levels of al1 three markers. suggesting that B ce11 development was not significady altered by the expression of v-Rel*.
![Page 124: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/124.jpg)
Normal tTA + TRElv-rel* (- tet)
Figure 27. Bursal Cells from Transgenic Birds Have a Normal Pbenotype
![Page 125: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/125.jpg)
Figure 28. v-Rel* Transfomeà B Cells in the Spleen and Liver of Transgenic Birds. Altered gene expression in v-Rel* transformed B cells includes up-regdation of MHC class II and down-regdation of the Bu-1 antigen. Expression of MHC class II and Bu-1 by lymphocytes fiom the spleen and liver of normal and transgenic birds was anaiyzed by flow cytometry (antibodies are described in Materials & Methods). A population of splenic B cells fiom birds expressing v-rel* (- tet) manifest this phenotype. B cells fiom the liver of these birds have elevated levels of MHC class II, but they are Bu- 1 *. Transgenic birds maintained on tet have a normal phenotype.
![Page 126: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/126.jpg)
MHC class II
![Page 127: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/127.jpg)
Figure 29. Transformed Celis Have a Mature B Cell Phenotype. Lymphocytes fiom the spleen and liver were analyzed by flow cytornetry for LT2 and ChL12 expression (see Materials & Methods for working concentrations of antibodies) and compared with normal expression patterns for these markers (Figure 21). The major@ of splenic B cells h m transgenic birds (- tet) are LTZ, and an increased nurnber of these B cells are ChLlZ1'. Lymphocytes fiom the liver of these birds are predominantly LT2' and Chi, 12-. This is consistent with B cells of a mature phenotype. Splenic lymphocytes fiom transgenic birds maintained on tet have a nonnal phenotype.
![Page 128: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/128.jpg)
![Page 129: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/129.jpg)
regulated expression, or resulted fiom transformation of LT2- B cells alone is still
unclear, Furthermore, B cells in the Iiver were almost exclusively negative for LT2
expression.
ChL12 is a marker for bursal derived B cells and it is normaily expressed at high
levels in the penphery (Figure 21 & 29). The effects of v-Rel* mediated transformation
on Cm12 expression has not been looked at until now. The results here show the
emergence of a group of B cells with down-regulated ChL 12 expression under conditions
that are permissive for v-rel* expression (- tet). Furthemore, the majority of B cells
found in the liver of these birds were ChLIT. Once again, it is unclear whether
transformation results in the down-regdation of ChL 12, or if ChL 12 is down-regulated
prior to transformation.
Discussion
A. v-Rel* Expression In Vivo is Inhibited by Tetraqcline
Although conditional forms of v-Re1 have previously been exploited in vimo, this
is the first example of conditional expression of the v-rel* oncogene in vivo. The results
obtained fiom transgenic birds maintained on tetracycline, in which v-rel* is not
expressed. are largely comparable to the results fiorn normal birds. Moreover, Western
analysis shows that v-Rel* expression in lymphocytes of transgenic birds is abrogated by
the admission of tetracycline via intra-peritoneal injection (Figure 23). Therefore, it is
most Iikely that a11 transgenic embryos maintained on tetracycline developed normally
until hatch. Chicks that were administered tetracycline post-hatch continued to develop
normally, as detemined by ce11 surface marker expression, while the chicks that stopped
receiving tet at hatch succurnbed to the effects of the v-rel* oncogene.
![Page 130: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/130.jpg)
B. Expression of v-rel* I n Vivo Leads Massive B Ce11 Infiltration of the Liver
Early work by Barth & Humphries (1988), looked at the effects of RevT(CSV)
infection of day old chicks. Infection with RevT(CSV) lead to rapid death, and autopsy
of birds revealed the presence of himors in the liver. Immunohistochemistry was carried
out on liver sections to show that -90% of the tumors were IgM'. The results obtained
here, from somatically transgenic birds that were expressing v-rel* (- tet) also point to
tumorigenesis in the iiver. Characterization of lymphocytes obtained from the liver
indicated that the majority of the infiltrating lymphocytes were IgM'. However, T cells
did not seem to be immune to the presence of v-rel* since the nurnber of T cells in the
liver was significantly elevated in transgenic birds that expressed v-Rel* (Figure 24a).
Having confirmed the presence of B cells in hepatic lymphocyte samples obtained
fiom v-rel* expressing birds (-tet), based on rearrangement of the Ig light chah locus
(Figure 25), the architecture of tumors was probed by immunohistochemistry. Initial
stains of liver tissue by HtE show that the transforrned cells are present in distinct foci of
growth, suggesting the possibility of clonality in each tumor. Although this is an issue
that is still wiresolved, probing the liver tissue for IgH and IgL expression demonstrated
that the Ig' B cells appeared to be concentrated in these nodules (Figure 26, f & h
respectively). It should be mentioned, however, that there were tumors in the liver that
were stained purple by eosin, but negative for IgH (Figures 26, e). It is possible that
these foci represent tumors of T ce11 growth, since elevated nurnbers of T cells were also
found in the liver transgenic birds (- tet) (Figure 24a). Transformation of T cells in
transgenic birds expressing v-rel* (- tet) is not surprising since previous work done in our
laboratory by Marmor et al. (1993) showed that avian T celts of both the a@ and the y/6
T ce11 receptor (TCR) lineages are transformed by RevT(CSV) in vitro. The transfonned
T cells obtained fiom the liver of transgenic birds (- tet) have yet to be characterized.
![Page 131: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/131.jpg)
C . Bursal Cells from Transgenic Birds are Normal
By the fust week pst-hatch a large proponion of bunal cells have already
undergone diversification by gene conversion, and the number of pre-busc cells are on
the decline. The pre-busc cells undergo rapidly division in the bursa, giving rise to a
large polyclonal population within each follicle. Only a srnail proportion of these IgM'
cells (-5%) actually emigrates fkom the bursa, an event that is preceded by the up-
regulation of the ChL 12 expression at the ce11 surface (Lampisuo et al., 1998). Thus, the
proportion of cells emigrating fiom the bursa is reflected by the small ratio of cells
expressing elevated levels ChL12 (Figure 27). It is interesting to note that the bursal
cells from transgenic birds that were expressing the oncogene (- tet) shows normal
patterns for ChL 12 expression regardless of the decrease in the absolute number of cells
found in the bursa (Figure 24).
Furthemore, Figure 27 shows that bursal cells fiom v-rel* transgenic birds that
were expressing the oncogene (- tet) show normal levels of LT2, Bu-land ChL12
expression (as depicted in Figure 21). Once again, it would seem that v-Rel* expression
did not effect the quality of B cells in the bursa, only that the oncogene caused a
reduction in the total number of cells therein. Therefore, it is possible that v-Rel* does
not effect B ceil development in the bursa per se! as determined by phenotypic analysis,
but it could possibly hinder the rate or eficiency at which ce11 division occurs. Another
possibility is that bursal cells fiom v-rel* transgenic birds (-tet) could be more
susceptible to apoptosis in the bursa than normal. For this reason, it would be interesting
to quantitate apoptotic activity in the bursa fiom nonnal and transgenic birds, either by
ce11 cycle anaiysis (to look at DNA content of cells) or by tunel assay to visudize
apoptosis in situ. A third possibility is that the v-Rel* oncoprotein drives bursal
emigration, thereby causing a reduction in the totd number of cells in the bursa-
![Page 132: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/132.jpg)
D. Splenic & Hepatic Lymphocytes Are Characteristic w e l * Transformed cells
Lymphocytes harvested fiom the spleen and liver of v-rel* transgenic birds
thRved when cultured in IMDM/2%CS (data not shown), which is uncharacteristic of
normal lymphocytes. In general, normal lymphocytes taken fiorn birds apoptose within
24 hours unless preventative measures are taken to ensure their survival, such as
transformation with RevT(CSV) virus (Benatar et al., 1991). Transformation by v-rel* is
known to imrnortalize splenic B celis (Bose, 1992), although RevT(CSV) transformed T
cells, having a finite life span, senesce within six months (Marmor et al., 1993)-
Interestingly, it has been observed that bursal cells transformed with RevT(CSV) grow
well in vitro for 2 months, afier which tirne growth slows down significantly
(unpublished data). Therefore, it appears that in situ transformation by v-rel* can, to a
certain degree, extend the life span of splenic and hepatic lymphocytes. Whether these
cells are immortalized has yet to be detennined.
Since v-rel* is a member if the ReVNF-d family of transcription factors (see
Introduction), it is possible that transformation by this oncogene is the consequence,
either direct or indirect, of disregulated gene expression. Thus far it has been shown that
v-Re1 can alter the expression of several genes ranging fiom those involved in ce11
activation, c--os (Fujii et al., 1996), to those that inhibit apoptosis, chL4P (You et al.,
1997). In addition, it has been observed that v-Re1 transformed lymphocytes express
elevated levels of MHC class II, but that Bu-1 expression by v-Re1 transformed B ceils is
significantly down regulated (Humphries and Zhang, 1992). The same results were
obtained for cells transformed by v-Rel* (Marmor et al., 1993).
Phenotypic analysis of the splenic and hepatic lymphocytes fiom v-rel*
transgenic birds (- tet) revealed that ce11 surface expression of the MHC class II and Bu-1
markers complied with that of RevT(CSV) transformed cells; MHC II was expressed at
high levels and Bu4 was significantiy down legulated (Figure 28). Therefore, it appears
that induction of the v-rel* oncogene did indeed result in the transformation of
lymphocytes in situ.
![Page 133: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/133.jpg)
Since the exact mechanism of v-rel* mediated transformation is not fully
understood, it remains unclear how altered gene expression by v-Rel* can lead to
transformation. Down-regulated expression of the Bu-1 antigen on v-rel* transfomed
lymphocytes, however, is interesting in light of the recent evidence by Funk et al. (1997),
suggesting a pro-apoptotic role for the Bu-1 antigen. This group observed that
incubation of B cells in the presence of anti-Bu- t antibodies resulted in a significant loss
of viability, and ultirnately ended in death of the B lymphocytes. Therefore, the down-
regulation of Bu-1 by v-Re! could be one mechanism by which the oncoprotein protects
cells fiom an untirneiy death.
E. Transformed B Cells Have a Mature Phenotype
B ce11 development in chickens occurs in several stages, fiom pre-bursal stem
cells to mature, terminally differentiated plasma cells. The avian homologues to several
marnmalian ce11 surface markers have now been identified including CD45, a maker
expressed on al1 lymphocytes, and MHC class II (Paramithiotis et al., 199 1 ; Hala et al.,
1977). On the other hand, chicken-specific markers have also been described including
LT2 and ChL 12. Although the role of many of these ce11 surface antigens has yet to be
determined, these markers have aided in the study of B ce11 ontogeny by detennining the
pattern of their expression at different stages of development.
Recently, our laboratory has described the LT2 marker (Paramithiotis and
Ratcliffe, 1996), demonstrating that the expression of LT2 antigen in peripheral blood is
restricted to a population of short lived B cells having bursal origins (Population 1). A
second population of bursa-derived PBL B cells (Population 2) was described as being
LT2-; these cells have a !-figer !if= S~LT LI the periphery (2-3 weeks). Also demonstrated
was the significant decline of LT2 expression on PBL B cells, fiom 50% to 4%, over a
penod of 5 months.
Interestingly, of the lymphocytes obtained fiom the spleen of v-rel* expressing
chicks (- tet) show that the majority of B cells are either L T ~ " or LT2; unlike the normal
control splenic B ce11 popdation (Figure 29). Furthemore, the B cells harvested fiom
![Page 134: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/134.jpg)
the liver of transgenic birds are aimost uniquely LTZ. This suggests the possibility that
Population 2 B cells in the periphery are specifically transformed by v-Rel*.
However, at this point it is not possible to definitively conclude that the LT2' B
cells alone are transformed by v-rel*. Thus far, it is unclear whether the presence of the
v-Rel* oncoprotein merely down regulates LT2 expression or whether the LT2- B cells
are specifically targeted for transformation. Sequence analysis of the LT2 promoter
would reveal the presence or absence of KB sites and, therefore, would provide insight as
to whether LT2 expression is under the control of R e m - K B transcription factors,
including v-Rei*. Unfortunately, the gene encoding LT2 has not yet been cloned.
Nevertheless, the fact that transformed B cells in the spleen of v-rel* transgenic birds (-
tet) are LT2' suggests that the cells targeted for oncogenesis by the oncogene are B cells
of a mature phenotype.
ha lys is of splenic lymphocytes by flow cytometry revealed that many of the B
cells are down regulated for ChLl2 expression in transgenic birds that were withdrawn
fiom tetracycline (Figure 29). Moreover, transformed lymphocytes that are found in the
liver of these birds are predominantly c ~ L 12'" or C U 12-. Similar to the results obtained
for LT2 expression by transformed lymphocytes, the paucity of ChL 12 on the surface of
v-reZ*-transformed cells suggest a mature B ce11 phenotype (Figure 21). Once again, it is
not clear whether ~hL12'" cells are specifically targeted for v-rel*-mediated
transformation or whether transformation by this oncogene results in the down regulated
expression of the ChL 12 marker.
![Page 135: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/135.jpg)
General Conclusion
RevT is among the most overtiy transforming of al1 known retrovinises. The
oncogene responsible for Rev-T mediated transformation is v-rel, a member of the
ReVNF-K. family of transcriptionai regulators. Although the exact mechanism for v-
Rd-mediated transformation is still unclear, several models have been suggested. The
two major models feature v-Re1 as either a dominant negative mutant of the cellular
homologue, c-Rel, or as a transcriptional activator (Figure 3). Although the two
mechanisms are opposed to one another, they are both based on the fact that v-Re1 is
indeed a transcriptional regulator. Therefore, it is generally accepted that v-rel
transforms target cells through disregulated gene expression. There are several genes that
show altered expression in v-rel-transfonned cells, such as mhc class I I , bu-1, c-jun, ch-
iap. However, a causal relationship between the altered expression of genes and v-Re1
has yet to be Mly established. Our laboratory is interested in studying the mechanism by
which v-Re1 transforms target cells.
Since RevT is a replication defective retrovins, it is dependent on a helper virus
for successfiil infection of cells. RevT has now been isolated in the context of two
different helper viruses, RevA and CSV. Interestingly, the cells transformed by RevT
differ depending on the helper virus; while RevT(RevA) appears to transform myeloid
cells and immature B cells, RevT(CSV) targets mature B cells and gives rise to
polyclonal B ce11 tumors. This suggests that the range of cells targeted for v-Rel-
mediated transformation is limited by expression of ce11 surface receptors for the ENV
protein of the helper virus. However, the v-rel oncogene that is encoded by RevT in the
context of CSV, herein referred to as v-rel*, was found to have an alanine-to-serine
mutation within the RHD, proximal to the IcB binding site. Although v-Re1 and v-Rel*
both interact with KB sites in vizro, they interact with different a f i t i e s .
In order to understand the mechanism for v-Rel*-mediated transformation, we
have devised a system to study in situ transformation. By generating somatically
transgenic chickens that express v-rel* in a conditional manner, we were able to
determine which cells were target for transformation by this oncogene. Since the
![Page 136: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/136.jpg)
tetracycline sensitive transactivator, tTA, was cloned into an RCAS vector of the A sub-
group (Martinez, O., 1996), the v-rel* oncogene was cloned under the control of the
tetracycline response element (TE) into RCAS and RCAN sub-group B vectors. A
strong poly-adenylation signal, designed to maxirnize pst-transcriptional processing,
and a Kozak sequence, to increase translational efficiency were included within the
vectors.
Initiai charactenzation of these vectors in CEFs revealed that pRA07, an
K A N @ ) vector which has the TRE/v-rel*/PA transgene in the opposing direction to
viral encoded genes, could be used for conditionai expression of v-rel* in vitro.
Subsequently, a cocktail of RCAS(A):tTA + p u 0 7 virai supematants (1:l v/v) were
used for infection and transgenesis of developing embryos. These embryos were
maintained on tetracycline until hatch to prevent expression of v-rel*, thereby allowing
normal development of the embryo. Transgenic birds were withdrawn fiom tetracycline
at hatch and sacrificed on the sixth day. .
Autopsy of these birds revealed gross enlargement of the spleen and the liver
when compared to nomal control birds and the transgenic birds maintained on
tetracycline. Analysis of the transformed cells harvested fiom the spleen and liver of
birds withdrawn fkom tetracycline revealed that they were predominantly IgM' and PCR
analysis of the Ig iight chah locus confïrmed that they were, in part, B cells.
The tumors were M e r characterized by immunohistochemistry and we
concluded that the t~ansformed B cells found in the Iiver of transgenic birds (- tet) were
concentrated in foci of growth. The pattern of tumor growth suggested the possibility of
lymphocyte clonality. In addition there were also tumors that did not stain positive for
the IgH, and it is possible that they could be T ce11 tumors.
Phenotypic analysis based ce11 surface marker expression, LT2 and ChL 12, by the
lymphocytes harvested fiom the spleen and liver of transgenic birds (- tet), suggested that
the transformed B cells were of a mature phenotype (LM- and ChL 123 Expression of
the other markers by transfonned lymphocytes, MHC class II and Bu-1, did not reflect
expression patterns of mature B cells. However, expression of these two markers was
![Page 137: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/137.jpg)
characteristic of v-Rel* transfonned B cells: up-regulated MHC class II and loss of Bu-1
expression.
nie prevalence of transformed B ce11 in the spleen of transgenic birds (- tet) by
day 6 post-hatch correlated with fmdings of Zhang et al. (Zhang et al., 1991). This group
found that RevT transformed splenic lymphocytes from week old chicks displayed
fùnctional rearrangements at the IgH and IgL loci. Moreover, they isolated a RevT
transformant that produced IgG, suggesting that mature, terminally differentiated B celis
could be transformed. On the other hand, transformation assays performed on ernbryonic
splenic lymphocytes resulted in transfonned cells that did not have Ig heavy chah gene
remangement. We looked at the effects of v-rel* on B cells in week-old hatchlings, and
the transformed B cells fiom transgenic birds (- tet) had a mature B ce11 phenotype, based
on ce11 surface antigen expression.
When birds were sacrificed and autopsied, the spleen and liver of transgenic birds
(- tet) were grossly enlarged, and Figure 24 shows that the number of B cells in the liver
of these birds is >10 000 times greater than in nonnal birds. At this point, it is unclear
whether the lymphocytes normally found in the liver (-IO4) are being transformed in situ.
It is also possible that lymphocytes are transformed at extra-hepatic sites, and are then
filtered out of circulation in the liver where they rapidly proliferate.
The system that we have developed is the first example of conditional expression
of v-rel* in vivo. In the presence of tetracycline, transgenic birds do not exhibit
lymphocyte transformation. However, withdrawal of tetracycline ultimately gives rise to
massive tumors of lymphoid cells. Therefore, we have developed a system in which we
can regulate the induction of tumor formation in vivo.
![Page 138: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/138.jpg)
References
Abbadie, C., Kabrun, N., Bouali, F., Smardova, J., Stehelin, D., Vandenbunder, B., and Enrietto, P.J. (1993). High levels of c-rel expression are associated witti programmed ce11 death in the developing avian embryo and in bone marrow cells in vitro. Cell 75,899-9 12.
Arenzana-Seisdedos, F., Thompson, J., Rodriguez, M. S ., Bacheierie, F., Thomas, D., and Hay, R.T. (1995). Inducible nuclear expression of newly synthesized 1 kappa B alpha negatively regdates DNA-binding and transcriptional activities of NF- kappa B. Mo1 Ce11 Bi01 15,2689-2696.
Astrin, S.M., Buss, E.G., and Haywards, W.S. (1979). Endogenous virai genes are non- essential in the chicken. Nature 282,339-34 1.
Bach, F.H., Hancock, W.W., and Ferran, C. (1997). Protective genes expressed in endothelial cells: a regdatory response to injury. Immunol Today 18,483-486.
Baldwin, A.S.J. (1996). The NF-kappa B and 1 kappa B proteins: new discoveries and insights. Annu Rev immun01 f 4,649-683.
Ballard, D.W., Walker, W.H., Doerre, S., Sista, P., Molitor, LA., Dixon, E.P., Peffer, N.J., Hannink, M., and Greene, W.C. (1990). The v-rel oncogene encodes a kappa B enhancer binding protein that inhibits NF-kappa B function. Celi 63, 803-814.
Barth, C.F., Ewert, D.L., Oison, W.C., and Humphries, E.H. (1990). Reticuloendo theliosis virus REV-T(REV-A)-induced neoplasia: development of tumors within the T-lymphoid and myeloid lineages. J Virot 64 ,6054-6062.
Barth, C.F. and Humphries, E.H. (1988). A nonimmunosuppressive helper virus allows high effkiency induction of B cet1 lymphomas by reticuloendotheiiosis virus strain T. J Exp Med 167,89-108.
Barth, C.F. and Humphries, E.H. (1988). Expression of v-rel induces mature B-ce11 lines that reflect the diversity of avian imrnunoglobulin heavy- and light-chah rearrangements. Mol Ce11 Bi01 8,5358-5368.
Baumann, H. and Gauidie, J. (1994). The acute phase response [see comments]. Immunol Today I5,74-80.
Beg, A.A., Ruben, S.M., Scheinman, R.I., Haskill, S., Rosen, C.A., and Baldwin, A.S.J. (1992). 1 kappa B interacts with the nilclear localization sequences of the subunits of NF-kappa B: a mechanism for cytoplasrnic retention [published erratum appears in Genes Dev 1992 Dec;6(12B):2664-51. Genes Dev 6, 1 899- 19 13.
![Page 139: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/139.jpg)
Beg, A.A., Sha, W.C., Bronson, R.T., Ghosh, S., and Baltimore, D. (1 995). Embryonic lethality and liver degeneration in rnice lacking the RelA component of NF-kappa B. Nature 376, 167-170.
Benatar, T., Iacampo, S., Tkalec, L., and Ratcliffe, M.J. (1991). Expression of immunoglobulin genes in the avian embryo bone marrow revealed by retrovirai transformation. Eur J Immunol21,2529-2536.
Benatar, T., Tkalec, L., and Ratcliffe, M. J. (1 992). Stochastic remrangement of immunoglobulin variable-region genes in chicken B-ce11 developrnent. Proc Nat1 Acad Sci U S A 89,761 5-761 9.
Bettany, J.T. and Wolowac- KG. (1998). Tetracycline derivatives induce apoptosis selectively in cultured monocytes and macrophages but not in mesenchymal cells. Adv Dent Res 12, 1 36- 143.
Boehmelt, G., Walker, A., Kabrun, N., Mellitzer, G., Beug, H., Zenke, M., and Enrietto, P.J. (1 992). Hormone-regulated v-rel estrogen receptor fusion protein: reversible induction of ce11 transformation and cellular gene expression. EMBO J 11,4641 - 4652.
Bose, H.R.J. (1992). The Re1 family: models for transcriptional regulation and oncogenic transformation. Biochim Biophys Acta 11 14, 1 - 1 7.
Bushdid, P.B., Brantley, D.M., Yull, F.E., Blaeuer, G.L., Hof ian , L.H., Niswander, L., and Kerr, L.D. (1998). Inhibition of NF-kappaB activity resdts in dismption of the apical ectodermal ridge and aberrant limb morphogenesis [see cornments]. Nature 392,6 15-6 1 8.
Caamano, J.H., Rizzo, C.A., Durham, S.K., Banon, D.S., Raventos-Suarez, C., Snapper, C.M., and Bravo, R. (1998). Nuclear factor (NF)-kappa B2 @100/p52) is required for normal splenic microarchitecture and B cell-mediated immune responses. J Exp Med 187,185-196.
Capobianco, A.J., Chang, D., Mosialos, G., and Gilmore, T.D. (1992). plOS, the NF- kappa B p50 precmor protein, is one of the cellular proteins complexed with the v-Re1 oncoprotein in transformed chicken spleen cells. J Virol66,3758-3767.
Carrasco, D., Cheng, J., Lewin, A., Warr, G., Yang, H., Rizzo, C., Rosas, F., Snapper, C., and Bravo, R ( 1 998). Multiple hemopoietic de fects and lymphoid hyperplasia in mice lacking the transcriptional activation domain of the c-Re1 protein. .J Exp Med 187,973-984.
Carrasco, D., -O, C.A., D o h a n , K., and Bravo, R. (1996). The v-rel oncogene promotes malignant T-ce11 leukemia/lyrnphoma in transgenic mice. EMBO J 15, 3640-3650.
![Page 140: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/140.jpg)
Chen, C., Agnes, F., and Gelinas, C. (1 999). Mapping of a serine-rich domain essential for the transcriptional, antiapoptotic, and transforming activities of the v-Re1 oncoprotein un Process Citation]. Mol Ce11 Bi01 19,307-3 16.
Chen, CL., Ager, L.L., Gartland, G.L., and Cooper, MID. (1986). Identification of a T3fï ce11 receptor complex in chickens. J Exp Med 164,375480.
Cressman, D.E., Greenbaum, L.E., Haber, B.A., and Taub, R (1994). Rapid activation of post-hepatectomy factodnuclear factor kappa B in hepatocytes, a prirnary response in the regenerating liver. J Bi01 Chem 269,30429-30435.
Davis, N., Bargmann, W., Lim, M.Y., and Bose, H.J. (1990). Avian retictdoendotheliosis virus-transfonned lymphoid cells contain multiple pp59v-rel complexes. J Virol 64,584-59 1.
Davis, N., Ghosh, S., Simmons, D.L., Tempst, P., Liou, H.C., Baltimore, D., and Bose, H.R. J. ( 1 99 1). Rel-associated pp40: an inhibitor of the rel family of transcription factors. Science 253, 1268- 127 1.
Duke, R.C., Ojcius, D.M., and Young, J.D. (1996). Ce11 suicide in health and disease. Sci Am 275,80-87.
Fujii, M., Minamino, T., Nomura, M., Miyamoto, KI. , Tanaka, J., and Seiki, M. (1996). Selective activation of the proto-oncogene c-jun promoter by the transforming protein v-Rei. Oncogene 12,2 1 93-2202.
Funk, P.E. and ïhompson, C.B. (1996). Current concepts in chicken B ce11 development. Curr Top Microbiol Immunol 212, 17-28.
Funk, P.E., Tregaskes, C.A., Young, J.R., and Thompson, C.B. (1997). The avian chB6 (Bu-1) alloantigen can mediate rapid ce11 death. J Immunol 159, 1695-1 702.
Gerondakis, S., Grumont, R., Rourke, I., and Grossmann, M. (1998). The regulation and roles of ReW-kappa B transcription factors during lymphocyte activation. Curr Opin Immunol 10, 353-359.
Ghosh, S., May, M.J., and Kopp, E.B. (1998). NF-kappa B and Re1 proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immun01 16,225-260.
Gilmore, T.D. (1992). Role of rel fmily genes in normal and malignant lymphoid ce11 gowth. Cancer Surv 2 5,69-87.
Gilmore, T.D., Koedood, M., Piffat, KA., and White, D.W. (1996). ReVNF- kappaBAkappaB proteins and cancer. Oncogene 13, 1 367- 1378.
![Page 141: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/141.jpg)
Gilmore, T.D. and MOM, P.J. (1993). The 1 kappa B proteins: members of a muItifiuictional family . Trends Genet 9,427-433.
Gossen, M. and Bujard, H. (1992). Tight control of gene expression in mammalian ceiis by tetracycline- responsive promoters. Proc Nat1 Acad Sci U S A 89,5547-555 1.
Govind, S. and Steward, R. (1991). Dorsoventral pattern formation in Drosophila: signai transduction and nuclear targeting. Trends Genet 7, I 19- 125.
Grunont, R.J., Rourke, I.J., O'Reilly, L.A., Strasser, A., Miyake, K., Sha, W., and Gerondakis, S. (1998). B lymphocytes differentially use the Re1 and nuclear factor kappaBl (NF- kappaB1) transcription factors to regulate ce11 cycle progression and apoptosis in quiescent and mitogen-activated cells. J Exp Med 18 7,663-674.
Hala, K., Vilhelmova, M., and Hartmanova, J. (1977). The structure of the major histocornpatibility complex of the chicken. Adv Exp Med Bi01 88,227-232.
Hannink, M. and Temin, H.M. (1991). Molecular mechanisms of transformation by the v-rel oncogene. Crit Rev Oncog 2,293-309.
Hoelzer, J.D., Lewis, R.B., Wasmuth, C.R.; and Bose, H.R.J. (1980). Hematopoietic ce11 transformation by reticuloendotheliosis virus: characterization of the genetic defect. Virology 100,462-474.
Houssaint, E., Belo, M., and Le Douarin, N.M. (1976). Investigations on ce11 lineage and tissue interactions in the developing bursa of Fabricius through interspecific chimeras. Dev Bi01 53,250-264.
Houssaint, E., Diez, E., and Pink, J.R. (1987). Ontogeny and tissue distribution of the chicken Bu- 1 a antigen. Immunology 62,463-470.
Houssaint, E., Mansikka, A., and Vainio, 0. (1991). Early separation of B and T lymphocyte precursors in chick embryo. J Exp Med 174397406.
Hrdlickova, R., Nehyba, J., and Bose, H.R.J. (1995). Mutations in the DNA-binding and dimerization domains of v-Re1 are responsible for altered kappa B DNA-binding complexes in transformed cells. J Virol69,3369-3380.
Hrdlickova, R., Nehyba, J., and Humphries, E.H. (1 994). v-rel induces expression of three avian immunoregulatory surface receptors more efficiently than c-tel. J Virol68,308-3 19.
Hrdlickova, R., Nehyba, J., Roy, A., Humphries, E.H., and Bose, H.R.J. (1995). The relocalization of v-Re1 fiom the nucleus to the cytoplasm coincides with induction of expression of Ikba and nfkbl and stabilization of I kappa B-alpha. J Virol 69, 403-413.
![Page 142: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/142.jpg)
Hughes: S.H., Greenhouse, J.J., Petropoulos, C.J., and Sutrave, P. (1987). Adaptor plasmids simplify the insertion of foreign DNA into helper- independent retroviral vectors. J Vu01 61,3004-3012.
Humphries, E.H. and Zhm.g, G. (1992). V-rel and C-rel modulate the expression of both bursal and non-bursal antigens on avian B-ce11 lymphomas. Curr Top Microbiol Immun01 182,47543.
Iida, Y. and Masuda, T. (1996). Strength of translation initiation signal sequence of mRNA as studied by quantification method: effect of nucleotide substitutions upon translation efficiency in rat preproinsulin mRNA. Nucleic Acids Res 24, 33 13-33 16.
Inoue, J., Kerr, L.D., Ramone, L.J., Bengal, E., Hunter, T., and Venna, LM. (1 991). c-rel activates but v-rel suppresses transcription fiom kappa B sites. Proc Natl Acad Sci U S A 88,3715-3719.
Iotsova, V., Caamano, J., Loy, J., Yang, Y., Lewin, A., and Bravo, R. (1997). Osteopetrosis in mice lacking NF-kappa 1 and NF-kappaB2 [see cornments]. Nat Med 3, 1285-1 289.
Jacobsen, K.A., Paramithiotis, E., Ewert, D.L., and Ratcliffe, M.J. (1996). Apoptotic ceil death in the chicken bursa of Fabricius. Adv Exp Med Bi01 106, 155-165.
Kabrun, N., Hodgson, J.W., Doemer, M., Mak, G., Franza, B.R.J., and Enrietto, P.J. (1 99 1). Interaction of the v-rel protein with an NF-kappa B DNA binding site. Proc Natl Acad Sci U S A 88, 1783- 1787.
Karin. M., Liu, Z., and Zandi, E. (1997). AP-1 function and regdation. Curr Opin Ce11 Bi01 9,240-246.
Kontgen, F., Gnunont, R.J., Strasser, A., Metcalf, D., Li, R., Tarlinton, D., and Gerondakis, S. (1995). Mice lacking the c-rel protooncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes Dev 9, 1965-1 977.
Kopp, E.B. and Ghosh, S. (1 995). NF-kappa B and rel proteins in innate immmity. Adv Irnmunol 58, 1 -27.
Kralova, J., Liss, A.S., Bargmann, W., and Bose, H.R.J. (1998). AP-1 factors play an important role in transformation induced by the v- rel oncogene. Mol Ce11 Bi01 18,2997-3009.
Lacasse. E.C., Baird, S., Komeluk, R.G., and MacKenzie, A.E. (1998). n i e inhibitors of apoptosis (IAPs) and their emerging role in cancer Dn Process Citation]. Oncogene 17,3247-3259.
![Page 143: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/143.jpg)
a Lampisuo, M., Arstila, T.P., Liippo, J., and Lassila, 0 . (1998). Expression of chL12 surface antigen is associated with ce11 survival in the avian bursa of Fabricius. Scand J Immunol 47,223-228.
Lanoix, J. and Acheson, N.H. (1 988). A rabbit beta-globin polyadenylation signal directs efficient termination of transcription of polyomavinis DNA. EMBO J 7, 2515- 2522.
Lassila, 0 . (1989). Emigration of B cells fiom chicken bursa of Fabricius. Eur J Immun01 19,955-958.
Lassila, O., Alanen, A., Lefkovits, I., Cooper, M.D., and Pink, J.R. (1988). Immunoglobulin diversification in embryonic chicken bursae and in individuai bursal follicIes. Eur J Immun01 18,943-949.
Lieber, M.R., Chang, C.P., Gallo, M., Gauss, G., Gerstein, R., and Islas, A. (1994). The mechanism of V@)J recombination: site-specificity, reaction fidelity and immunologie diversity. Semin Immunol 6, 143- 1 53.
Liou, H.C., Sha, W.C., Scott, M.L., and Baltimore, D. (1994). Sequential induction of NF-kappa B/Rel family proteins during B-ce11 terminal differentiation. Mol Ce11 Bi01 Ill, 5349-5359.
Lu, D., Thompson, J.D., Gorski, G.K., Rice, N.R., Mayer, MG., and Yunis, J.J. (1 991). Alterations at the rel Locus in human lymphoma. Oncogene 6, 1235-124 1.
Luque, 1. and Gelinas, C. (1998). Distinct domains of IkappaBalpha regulate c-Re1 in the cytoplasm and in the nucleus. Mol Ce11 Biol 18, 12 13-1224.
Mansikka, A., Jalkanen, S., Sandberg, M., Granfors, K., Lassila, O., and Toivanen, P. (1990). Bursectomy of chicken embryos at 60 hours of incubation leads to an oligoclonal B ce11 cornpartment and restricted Ig diversity. J Immunol I45,3601- 3609.
Mansikka, A., Sandberg, M., Lassila, O., and Toivanen, P. (1990). Rearrangement of immunoglobulin light chah genes in the chicken occurs prior to colonization of the embryonic bursa of Fabricius. Proc Natl Acad Sci U S A 87,94 16-9420.
Marmor, M.D., Benatar, T., and Ratcliffe, M.J. (1993). Retrovirai transformation in vitro of chicken T cells expressing either alphdbeta or gammaldelta T ce11 receptors by reticuloendothelîosis virus strain T. J Exp Med 177, 647-656.
Martinez, O. Role of Rel/NF-kappaB members in v-rel induced transformation. 1996. McGill University, Montreal, Qc- (GENERIC) Re f Type: ThesidDissertation
![Page 144: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/144.jpg)
Miyamoto, S., Chiao, P.J., and Venna, LM. (1994). Enhanced 1 kappa B alpha degradation is responsible for constitutive NF- kappa B activity in mature murine B-ce11 lines. Mol Ce11 Bi01 14,3276-3282.
Momson, L.E., Boehmelt, G., Beug, H., and Enrietto, P.J. (1991). Expression of v-rel in a replication competent virus: transformation and biochernical characterization. Oncogene 6, 1657- 1666.
Momson, L.E., Boehmelt, G., and Enrietto, P.J. (1992). Mutations in the rel-homology domain alter the biochemical properties of v-rel and render it transformation defective in chicken embryo fibroblasts. Oncogene 7, 1 137-1 147.
Morrison, L.E., Kabrun, N., Mudri, S., Hayman, M.J., and Enrietto, P.J. (1989). Viral rel and cellular rel associate with cellular proteins in transforrned and normal cells. Oncogene 4,677-683.
Mosialos, G-, Hamer, P., Capobianco, A.J., Laursen, RIA., and Gilmore, T.D. (1991). A protein kinase-A recognition sequence is structurally linked to transformation by pS9v-rel and cytoplasmic retention of p68c-rel. Mol Ce11 Bi01 11, 586795877.
Nehyba, J., Hrdlickova, R., and Bose, H.R.J. (1997). Differences in kappaB DNA- binding properties of v-Re1 and c-Re1 are the result of oncogenic mutations in three distinct functional regions of the Re1 protein. Oncogene 11, 288 1-2897.
Neiman, P.E., Thomas, S.J., and Loring, G. (1991). Induction of apoptosis during normal and neoplastic B-ce11 development in the bursa of Fabricius. Proc Nat1 Acad Sci U S A 88, 5857-5861-
Neri, A., Chang, C.C., Lombardi, L., Salina, M., Comadini, P., Maiolo, A.T., Chaganti, R.S., and Dalla-Favera, R. (1 99 1). B ce11 lymphoma-associated chromosomal translocation involves candidate oncogene lyt- 1 O, homologous to NF-kappa B p50. CeIl 67, 1075-1087.
Nuemann, M., Marienfeld, R., and Serfiing, E. ReVNF-rB transcription factors and cancer: Oncogenesis by dysregulated transcription (Review). international Journal of Oncology 11, 1335-1347. 1997. (GENEIUC) Ref Type: Genenc
Olah, 1. and Glick, B. (1 978). The number and size of the follicular epithelium (FE) and follicles in the bursa of Fabricius. Poult Sci 57, 1445-1450.
Paramîthiotis, E., Jacobsen, KA., and Ratcliffe, M.J. (1995). Loss of surface immunoglobulin expression precedes B ce11 death by apoptosis in the bursa of Fabncius. J Exp Med 181, 105-1 13.
![Page 145: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/145.jpg)
Paramithiotis, E. and Ratcliffe, M.J. (1993). Bursadependent subpopdations of peripheral B lymphocytes in chicken blood. Eur J Immunol 23,96-102.
Paramithiotis, E. and Ratcliffe, M.J. (1996). Evidence for phenotypic heterogeneity arnong B cells emigrating fiom the bursa of fabricius: a reflection of hctional diversity? Curr Top Microbiol Immun01 2/2,29-36.
Paramithiotis, E., Tkalec, L., and Ratcliffe, M.J. (1991). High levels of CD45 are coordinately expressed with CD4 and CD8 on avian thymocytes. J Immun01 I47, 3710-3717.
Perkins, N.D., Felzien, L.K., Betts, J.C., Leung, K., Beach, D.H., and Nabel, G.J. (1997). Regdation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator. Science 275,523-527.
Perkins, N.D., Schmid, R.M., Duckett, C.S., Leung, K., Rice, N.R., and Nabel, G.J. (1 992). Distinct combinations of NF-kappa B subunits determine the specificity of transcriptional activation. Proc Nat1 Acad Sci U S A 89, 1529-1 533.
Petropoulos, C.J. and Hughes, S.H. (1991). Replication-competent retrovirus vectors for the transfer and expression of gene cassettes in avian cells. J Virol 65, 3728- 3737.
Petropoulos, C.J., Payne, W., Salter, D.W., and Hughes, S.H. (1992). Appropriate in vivo expression of a muscle-specific promoter by using avian retroviral vectors for gene transfer [corrected] lpublished erratum appears in 3 Virol 1992 Aug;66(8):5 1751. J Virol66,339 I-3397.
Preiss, T. and Hentze, M.W. (1998). Dual function of the messenger RNA cap structure in poly(A)-tail- promoted translation in yeast. Naîure 392, 5 16-520.
Ratcliffe, M.J. (1 989). Generation of immunoglobulin heavy chah diversity subsequent to ce11 surface immunoglobulin expression in the avian bursa of Fabricius. J Exp bled 170, 1 165-1 173.
Ratcliffe, M.J. and Jacobsen, K.A. (1994). Rearrangement of immunoglobulin genes in chicken B ce11 development. Semin Immunol 6, 175- 184.
Ratcliffe, M. Jey Lassila, O., Pink, J.R., and Vainio, 0. (1 986). Avian B ce11 precunors: surface imrnunoglobuiin expression is an early, possibly bursa-independent event. Eur J Immunol 16, 129-133.
Ratcliffe, M.J. and Tkalec, L. (1990). Cross-linking of the surface immunoglobuiin on lymphocytes fiom the bursa of Fabricius results in second messenger generation. Eur J Immunol 20, 1073- 1078.
![Page 146: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/146.jpg)
a Reynaud, C.A., Anquez, V., Dahan, A., and Weill, J.C. (1985). A single rearrangement event generates most of the chicken immunoglobulin light chah diversity. Ce11 40,283-29 1.
Reynaud, C.A., Anquez, V., Grimal, H., and Weill, J.C. (1987). A hyperconversion mechanism generates the chicken Iight chain preimmune repertoire. Ce11 48, 3 79- 3 88.
Reynaud, C.A., Dahan, A., Anquez, V., and Weill, J-C. (1989). Somatic hyperconversion diversifies the single Vh gene of the chicken with a high incidence in the D region. Ce11 59, 1 7 1 - 1 83.
Reynaud, C.A., Imhof, B.A., Anquez, V., and Weill, J.C. (1992). Emergence of cornmitted B lymphoid progenitors in the developing chicken embryo. EMS0 J 11,4349-4358.
Richardson, P. M. and Gilmore, T. D. v-Re1 is an inactive member of the Re1 family of transcriptional activating proteins. J Virol 65, 3 122-3 130. 199 1. (GENERIC) Ref Type: Generic
Roff, M., Thompson, J., Rodriguez, My S., Jacque, J. M., Baleux, F., Arenzana- Seisdedos, F., and ay, R. T. Role of IkB-a ubiquination in signal-induced activation of NF-K. in vivo. Journal of Biological Chemistry 271(13), 7844- 7850. 1996. (GENERIC) Ref Type: Generic
Romero, P. and Humphries, E.H. (1995). A mutant v-rel with increased ability to transfonn B lymphocytes. J Virol69,30 1-307.
Sachdev, S., Diehl, LA., McKinsey, T.A., Ham, A., and Hannink, M. (1997). A tkreshold nuclear level of the v-Re1 oncoprotein is required for transformation of avian lymphocytes. Oncogene 14,2585-2594.
Sarkar, S. and Gihore, T.D. (1993). Transformation by the vRel oncoprotein requires sequences carboxy- terminal to the Re1 homology domain. Oncogene 8, 2245- 2252.
Schmidt-Ullrich, R., Memet, S., Lilienbaum, A., Feuillard, J., Raphael, M., and Israel, A. (1996). NF-kappaB activity in transgenic rnice: developmental regulation and tissue specificity. Development 122,2 1 17-2 128.
Siebenlist, U., Franzoso, G., and Brown, K. c1994). Structure. regulation and function of NF-kappa B. Annu Rev Ce11 Bi01 10,405-455.
![Page 147: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/147.jpg)
Smardovq J., Walker, A., Morrison, LE., Kabrun, N., and Enrietto, P.J. (1995). The role of the carboxy terminus of v-Re1 in transformation and activation of endogenous gene expression. Oncogene 10,20 1 7-2026.
Snapper, C.M., Zelazowski, P., Rosas, F.R., Kehry, M.R., Tian, M., Baltimore, D., and Sha, W.C. (1996). B cells fiom pSO/NF-kappa B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. 1 Immun01 156, 183- 19 1.
Theilen, G.H., Zeigel, R.F., and Twiehaus, M.J. (1966). Biological studies with RE virus (strain T) that induces reticuloendotheliosis in turkeys, chickens, and Japanese quail. J Nat1 Cancer Inst 3 7, 73 1-743.
Thompson, C.B. (1 995). Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456-1462.
Thompson, C.B. and Neiman, P.E. (1987). Somatic diversification of the chicken immunoglobulin light chah gene is limited to the rearranged variable gene segment. Ce11 18,369-378.
Tonegawa, S. (1 983). Somatic generation of antibody- diversity. Nature 302: 575-58 1.
Tumang, J.R., Owyang? A., Andjelic, S., Jin, Z., Hardy, R.R., Liou, M.L., and Liou, H.C. (1998). c-Re1 is essential for B lymphocyte survival and cell cycle progression. E u J Immunol 28,429943 12.
Veromq T., Vainio, O., Eerola, E., and Toivanen, P. (1988). Monoclonal antibodies against chicken Bu-la and Bu-1 b alloantigens. Hybridoma 7,4 1-48.
Walker, A.K. and E ~ e n o , P.J. (1996). Analysis of the role of v-rel in transcnptional regulation of high mobility group 14. Oncogene 12,25 15-2525.
Weber, W.T. and Foglia, L.M. (1980). Evidence for the presence of precursor B cells in normal and in horrnonally bursectomized chick embryos. Ce11 Immunol 52, 84- 94.
Weih, F., Durham, S.K., Barton, D.S., Sha, W.C., Baltimore, D., and Bravo, R. (1996). Both multiorgan inflammation and myeloid hyperplasia in RelB-deficient mice are T ce11 dependent. J Immun01 157,3974-3979.
White, D. W. and Gilmore, T.D. (1 993). Temperature-sensitive transforming mutants of the v-rel oncogene. J Virol 67,6876-688 1.
White, D.W. and Giimore, T.D. (1996). Bcl-2 and CnnA have different effects on transformation, apoptosis and the stability of 1 kappa B-alpha in chicken spleen cells transformed by temperature-sensitive v-Re1 oncoproteins. Oncogene 13, 89 1-899.
![Page 148: BY Mira A. Raonlc-bnc.ca/obj/s4/f2/dsk1/tape8/PQDD_0026/MQ50863.pdf · mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John Lewis, Madani Thiarn, Maricar](https://reader036.vdocument.in/reader036/viewer/2022070817/5f10a1457e708231d44a0cee/html5/thumbnails/148.jpg)
White, D.W., Pitoc, G.A., and Gilmore, T.D. (1996). Interaction of the v-Re1 oncoprotein with NF-kappaB and IkappaB proteins: heterodimers of a transforrnation- defective v-Re1 mutant and NF02 are functional in vitro and in vivo. Mol Ce11 Bi01 16, 1169-1 178.
White, D.W., Roy, A., and Gihore, T.D. (1995). The v-Re1 oncoprotein blocks apoptosis and proteolysis of 1 kappa B- alpha in transfonned chicken spleen cells. Oncogene 1 O, 857-868.
Whiteside, S.T., Epinat, J-C., Rice, N.R., and Israel, A. (1 997). 1 kappa B epsilon, a novel member of the 1 kappa B family, controls R e m and cReI NF-kappa B activity. EMBO J 16, 1413-1426.
Wilhelmsen, K.C., EggIeton, K., and Temin, H.M. (1 984). Nucleic acid sequences of the oncogene v-rel in reticuloendotheliosis virus strain T and its cellular homolog, the proto-oncogene c-rel. J VU0152 , 172- 182.
Wulczyn, F.G., Krappmann, D., and Scheidereit, C. (1996). The NF-kappa B/Rel and 1 kappa B gene families: mediators of immune response and inflammation. J Mol Med 74, 749-769.
Xul N., Loflin, P., Chen, C.Y., and Shyu, A.B. (1998). A broader role for AU-rich elernent-mediated mRNA turnover revded by a new transcriptional pulse strategy. Nucleic Acids Res 26,558-565.
You, M., Ku, P.T., Ifrdlickova, R., and Bose, H.R.J. (1 997). ch-W1, a member of the inhibitor-of-apoptosis protein family, is a mediator of the antiapoptotic activity of the v-Re1 oncoprotein. Mol Ce11 Bi01 17, 7328-7341.
Zhang, J.Y., Olson. W., Ewert, D., Bargmann, W., and Bose, H.R.J. (1 991). The v-rel oncogene of avian reticuloendotheliosis virus transfonns immature and mature lymphoid cells of the B ce11 lineage in vitro. Virology 183,457-466.
Zong, W.X., Farrell, M., Bash, J., and Gelinas, C. (1997). v-Re1 prevents apoptosis in transformed lymphoid cells and blocks TNFalpha-induced ce11 death. Oncogene IS , 97 1-980.
Zurovec, M., Petrenko, O., Roll, R., and Enrietto, P.J. (1 998). A chicken c-Relsstrogen receptor chimeric protein shows conditional nuclear localization, DN.4 binding, transformation and transcriptional activation. Oncogene 16, 3 133-3 142.