changes in pep carboxylase, rubisco and rubisco activase ... · 2 inserm, ifr 31, chu rangueil,...

137LEITAO ET AL. Biol Res 40, 2007, 137-153Biol Res 40: 137-153, 2007 BRChanges in PEP Carboxylase, Rubisco and Rubiscoactivase mRNA levels from maize (Zea mays) exposed toa chronic ozone stress

LOUIS LEITAO1, JEAN-JOSÉ MAORET2 and JEAN-PHILIPPE BIOLLEY1, *

1 Laboratoire d’Ecologie Moléculaire, E.A. 3525, I.B.E.A.S., Université de Pau et des Pays de l’Adour,Avenue de l’Université, BP 1155, F-64013 Pau Cedex, France2 INSERM, IFR 31, CHU Rangueil, F-31403 Toulouse Cedex 4, France

ABSTRACT

We quantified the ozone impact on levels of Zea mays L. cv. Chambord mRNAs encodingC4-phosphoenolpyruvate carboxylase (C4-PEPc), ribulose-1,5-bisphosphate carboxylase/oxygenase small andlarge subunits (Rubisco-SSU and Rubisco-LSU, respectively) and Rubisco activase (RCA) using real-timeRT-PCR. Foliar pigment content, PEPc and Rubisco protein amounts were simultaneously determined. Twoexperiments were performed to study the ozone response of the 5th and the 10th leaf. For each experiment,three ozone concentrations were tested in open-top chambers: non-filtered air (NF, control) and non-filteredair containing 40 (+40) and 80 nL L-1 (+80) ozone. Regarding the 5th leaf, +40 atmosphere induced a loss inpigmentation, PEPc and Rubisco activase mRNAs. However, it was unable to notably depress carboxylaseprotein amounts and mRNAs encoding Rubisco. Except for Rubisco mRNAs, all other measured parametersfrom 5th leaf were depressed by +80 atmosphere. Regarding the 10th leaf, +40 atmosphere increasedphotosynthetic pigments and transcripts encoding Rubisco and Rubisco activase. Rubisco and PEPc proteinamounts were not drastically changed, even if they tended to be increased. Level of C4-PEPc mRNA remainedalmost stable. In response to +80 atmosphere, pigments and transcripts encoding PEPc were notablydecreased. Rubisco and PEPc protein amounts also declined to a lesser extent. Conversely, the level oftranscripts encoding both Rubisco subunits and Rubisco activase that were not consistently disturbed tendedto be slightly augmented. So, the present study suggests that maize leaves can respond differentially to asimilar ozone stress.

Key terms: carboxylase; maize; mRNA; ozone; Rubisco activase

ABBREVIATIONS USED: AOS, active oxygen species; AOT40, accumulated exposure over a threshold of 40 nL L-1

ozone; Car, carotenoid; Chl, chlorophyll; cDNA, complementary deoxyribonucleic acid; DAE, day after emergence;mRNA, messenger ribonucleic acid; NF, non-filtered air; OTC, open-top chamber; PEPc, phosphoenolpyruvatecarboxylase; RT-PCR, reverse transcription polymerase chain reaction; Rubisco, ribulose-1,5-bisphosphate carboxylase/oxygenase; Rubisco-SSU, Rubisco small subunit; Rubisco-LSU, Rubisco large subunit; RCA, ribulose-1,5-bisphosphatecarboxylase/oxygenase activase; RuBP, ribulose-1,5-bisphosphate; +40, +80, chambered non-filtered air supplied with 40and 80 nL L-1 ozone, respectively.

Author for correspondence: Jean-Philippe BIOLLEY, Tel.: +33-(0)5-59-40-74-73, Fax: +33-(0)5-59-40-74-94, E-mailaddress: [email protected]

Received: May 8, 2006. Accepted: September 28, 2006

1. INTRODUCTION

Nowadays, ozone (O3) is recognized as themost phytotoxic and worrying common airpollutant. It is a secondary pollutant formedin the troposphere by the interaction ofhydrocarbons, nitrogen oxides and sunlight(Cicerone, 1987; Thompson, 1992). Ozone,that enters the leaf through stomata, can

severely affect the survival and yield ofplants (Pell et al. , 1997; Kolb andMatyssek, 2001). If acute stress fromexposure to high concentrations of O3 forshort periods of time generally producesvisible injury, chronic O3 stress, resultingfrom exposure to low concentrations for along period, produces few symptoms ofdamage and reduces growth (Heath and

LEITAO ET AL. Biol Res 40, 2007, 137-153138

Taylor, 1997). Several studies have tried toelucidate the biochemical and molecularmechanisms of ozone toxicity. In short, it isadmitted that ozone effects are generated byan excess of AOS which can react withmembrane lipids, proteins and DNAresulting mainly in a reducedphotosynthesis and an accelerated cellsenescence (Pell et al., 1997).

In maize (Zea mays L.), photosynthesisis performed following a C4 pathway whichis a complex combination of bothbiochemical and morphologicalspecialisation able to induce an increase inthe CO2 concentration at the site of Rubisco(EC 4.1.1.39) (Von Caemmerer andFurbank, 2003). The secondary autotrophiccarboxylation reaction, catalysed byRubisco, is compartmentalized within thebundle sheath cells and is dependent, for itssupply of CO2, on the primarycarboxylation reaction, catalysed by PEPc(EC 4.1.1.31) in the cytosol of mesophyllcells (Häusler et al., 2002). Rubisco activityis regulated by Rubisco activase whichactivates Rubisco in vivo from an inactivecomplex by restoring the active Rubiscostructure (see Portis (2003) for review).

If literature related to the ozone impacton C3 species is very abundant, studiesdevoted to the response of C4 plants toozone are particularly rare. Only two paperscompared photosynthesis and yieldresponses of C3 and C4 plants to ozone(Heagle et al., 1988; Miller, 1988). Resultsfrom these studies tended to show that C4plants were more ozone-tolerant than C3plants. Although the ozone-inducedimpairment of C3 photosynthesis can bevariously explained (Matyssek et al., 1997;Guidi et al., 2000; Dizengremel, 2001;Calatayud and Barreno, 2004), i t isacknowledged that Rubisco is a centraltarget for adverse ozone effects. On thissubject, several experiments showed thatappropriate ozone doses are able to reduceRubisco quantity and to modify the enzymestructure by introducing carbonyl groups(Eckardt and Pell, 1995; Junqua et al.,2000; Dizengremel, 2001; Kanoun et al.,2002; Leitao et al., 2003). Assuming thatthe impact of additional carbonyl groups onRubisco activity established in vitro

(Eckardt and Pell, 1995) is not yetquantified in vivo, and that the impact ofozone on Rubisco activase remainsunknown, the ozone-induced decline inRubisco activity is generally regarded as aconsequence of a loss in Rubisco proteincontent (Pell et al., 1994; Dizengremel,2001; Pelloux et al., 2001). In C3 trees, thisozone-induced decline in Rubisco activitycan be accompanied by a spectacularincrease in the PEPc activity which reflectsa significant stimulation of anapleroticPEPc protein content (Dizengremel, 2001).Such an increase in PEPc activity probablyenhances anaplerotic processes which mightbe efficient at promoting detoxification andrepair of ozone injury by supplyingreducing power and skeletons(Dizengremel, 2001). At the molecularlevel, in C3 species, a few studies tried toquantify ozone-induced variations ofmRNA encoding PEPc and the two subunitsconstitutive of Rubisco. Using Northernblot and densitometric analyses of RT-PCRproducts, the authors showed that ozonewas able to increase PEPc mRNA levels inpine, poplar, Norway spruce, and beechwhereas it reduced Rubisco subunit mRNAlevels in poplar, pine and potato (Eckardtand Pell, 1994; Pell et al., 1994; Glick etal., 1995; Brendley and Pell, 1998; Pellouxet al., 2001). Regarding C4 species, onlyone study based on the same techniques,reported that maize mRNA encodingRubisco small subunit was decreased bymassive ozone doses (Ruzsa et al., 1999).To our knowledge, there are currently noother data describing the effect of ozone onphotosynthetic PEPc and Rubisco involvedin the Hatch and Slack pathway.

To gain new insights into the effect ofair pollution on C4 plants, we aimed todetect and to quantify a possible ozoneimpact on the accumulation of sometranscripts encoding key enzymes whichcontrol the photosynthetic carboxylationactivities of Zea mays L. For this purpose,we developed a real-time RT-PCR methodable to quantify levels of mRNAs encodingC4-phosphoenolpyruvate carboxylase(PEPc), ribulose-1,5-bisphosphatecarboxylase/oxygenase small subunit(Rubisco-SSU), Rubisco large subunit

139LEITAO ET AL. Biol Res 40, 2007, 137-153

(Rubisco-LSU) and Rubisco activase(RCA). Although it can be hazardous toconnect mRNA levels to their respectiveprotein contents (Boschetti et al., 1990;Eckardt and Pell, 1994; Glick et al., 1995;Moore et al., 1998), we also determinedcarboxylase protein contents.Simultaneously, we quantified chlorophyllsand carotenoids since photosyntheticpigment degradation is regarded as areliable parameter to estimate leafsenescence which is known to be ozone-accelerated in C3 plants (Matile et al., 1999;Pell et al., 1999; Calatayud and Barreno,2004). All analyses were carried out onleaves from maize plants (Zea mays, L. cv.Chambord) exposed, at differentdevelopment stages, to chronic and realisticozone stresses. Concretely, we performedtwo fumigation experiments in order tocompare the response of a lower (5th leaf)and of an upper leaf (10th leaf) to twopolluted atmospheres enriched with 40 and80 nL L-1 ozone, respectively; both leavesbeing fumigated during their growingperiod.

2. MATERIALS AND METHODS

2.1. Ozone treatment

The experiments were conducted atMontardon (43°N, 0e30’W, attitude 200 mabove the sea level), 10 km north of Pau,France. Three atmospheres wereexperimented in open-top chambers(OTCs): non-filtered air (NF, control) and 2ozone-enriched treatments using non-filtered air containing 40 nL L-1 (+40), and80 nL L-1 (+80) ozone. Technicalcharacteristics of OTCs, fumigation system,the monitoring and the computing of ozonedata were previously detailed elsewhere(Junqua et al., 2000). Supplemental ozonewas applied from 10:00 to 17:00 hGreenwich mean time (GMT) in order tosimulate the normal period of ozoneexposure. For each atmosphere, seasonal 7-h mean ozone concentration was computedfrom ozone hourly means between 10:00and 17:00 h. Ozone dose was calculated asan Accumulated exposure Over a Threshold

of 40 nL L-1 (AOT40) for each daylighthour with global radiation of 50 W m-2 orgreater, as defined for critical levels forozone vegetation effects in Europe(Karenlampi and Skarby, 1996; Grünhageet al., 1999). Thus AOT40 (nL L-1 h) is thesum of the differences between the hourlymean ozone concentration and 40 nL L-1 foreach hour when ozone concentrationexceeds 40 nL L-1, accumulated from leafemergence until sampling. The appearanceof the lamina tip out of the whorl definedthe leaf emergence date.

2.2. Crop management, ozone exposure,sampling process

Maize leaves were numbered from thebasis to the top of the plant, the first leafbeing the first appeared leaf and then theoldest leaf. A maize leaf is considered asfully expanded when its collar is visible.Two experiments were performed: the firstexperiment aimed to quantify the ozoneimpact on a lower leaf (5th leaf) sampledon young plants exposed for 33 days fromemergence (19 May) and the secondexperiment aimed to detect the impact ofan almost similar ozone stress on an upperleaf (10th leaf) sampled on older maizeplants exposed for 28 days from the fullexpansion of the 7th leaf (21 June). Fromsowing until 21 June, these plants weregrown in ambient air. Fifty-seven 2-L (19for each atmosphere) and 27 12-L (9 foreach atmosphere) base-perforated plasticpots filled with universal compost, wereprepared for experiment 1 and 2,respectively. Although it may influencethe plant microenvironment, the size ofpots was chosen according to the plantdevelopment expected at the final harvest,for each experiment. Five maize caryopses(Zea mays, L. cv. Chambord) were sownper pot on 13 May. A very homogeneousemergence (about 95%) was recorded on18 May and 19 May for 2-L pots placed inOTCs and 12-L pots maintained in ambientair, respectively. The number of plants perpot was gradually reduced to keep 1 plantper pot 10 days after emergence (DAE).During experiments, plants were alwayswell-watered to avoid water stress effects


and fertilized once a week with an NPKfert i l izer (20:10:10) enriched inmicronutrients. In experiment 1, 15 plantsexhibiting 7 fully expanded leaves wereharvested from each OTC 38 days afterplanting (33 DAE). In experiment 2, potswere distributed in the 3 OTCs on 21 Juneas maize plants exhibited 7 fully expandedleaves. Five maize plants per OTC wereharvested 28 days later (61 DAE) as theydisplayed 13 fully expanded leaves. Foreach experiment, leaves were harvested inthe early afternoon to avoid any influenceof diurnal cycling on gene expression. Thecollected leaves were immediately frozenin liquid nitrogen and individually storedat -80°C until analysis. Since the 5th leafwas not large enough, extractions oftranscripts, pigments and proteins wereperformed on three different sets of 5th

leaves (5 leaves per set and peratmosphere). Regarding the large 10th leaf,these 3 extractions were done on the sameleaf so that only one set of 10th leaves wasused (5 leaves per atmosphere). Analyseswere carried out on the central part of eachcollected leaf.

2.3. Pigment extraction and analysis

For each experiment, 5 leaves peratmosphere were analysed. For eachsampled leaf, the determination of pigmentcontent was achieved from analysis of 4foliar discs of 1.131 cm2 each. The discsfrom the 5th leaf were processed by pairswhereas those from the 10th leaf wereindividually analysed. Each disc pair orindividual disc was ground with liquidnitrogen. Pigments were extracted byincubating leaves in 5 mL acetone 80% (v/v) for 24 h at 4°C in darkness. Theabsorbance of leaf pigment extracts wasmeasured at 470, 646.8 and 663.2 nm.Concentrations of chlorophyll a, b, totalchlorophylls (a+b) and total carotenoidswere calculated according to extinctioncoefficients and equations reported byLichtenthaler (1987). Finally, data fromeither two pairs of discs (5th leaf) or from 4individual discs (10th leaf) were averagedand the obtained mean concentration wasexpressed as μg cm-2 of leaf.

2.4. Protein extraction and analysis

For each experiment, 5 leaves peratmosphere were analysed. Leaves werecoarsely ground in a mortar under liquidnitrogen. Soluble proteins were extractedby reducing 600 mg of this ground topowder in a mortar with 6 mL of 0.1 M(Tris(hydroxymethyl)aminomethane)-HCl(Tris-HCl, pH 7.5), 5 mM ethylene glycol-bis(β-aminoethyl ether)-tetraacetic acid(EGTA), 1 mM phenylmethylsulfonylfluoride (PMSF), 1 μM pepstatin, 2 mMdithiothreitol (DTT), 5 mM MgCl2, 10 mMNaHCO3, 1.5% (w/v)polyvinylpolypyrrolidone and 5 μg mL-1

leupeptin. After centrifugation at 17 608 gat 4°C for 15 min, proteins present in thesupernatant were precipitated according toLeitao et al. (2003). After a newcentrifugation (17 608 g, 4°C, 10 min),pellets were resuspended in 200 μL ofextraction buffer. Protein concentrationswere determined by the procedure ofBradford (1976) using a protein assayreagent (Biorad) and bovine serum albuminas a standard. Estimation of Rubisco-SSU,Rubisco-LSU and PEPc quantities wereperformed according to a previouslypublished procedure (Kanoun et al., 2002;Leitao et al., 2003). Relative amounts ofRubisco-SSU, Rubisco-LSU and PEPc wereexpressed as a percentage of solubleproteins.

2.5. RNA analysis

2.5.1. RNA extraction

For each experiment, 5 leaves were analysedper atmosphere. The central part of eachlamina was ground in a mortar with liquidnitrogen. Approximately 0.1 g of the powderwas transferred to a 2 mL microcentrifugetube. Total RNA was extracted with PlantRneasy kit (Quiagen) according tomanufacturer’s instructions. Quantitative andqualitative integrity measurements of RNAswere assessed by absorbance ratio (A260nm/A280nm) and by capillary electrophoresisusing a Bioanalyser 2100 (AgilentTechnologies), respectively. RNA extractswere stored at -80°C.


2.5.2. RNA preparation and reversetranscription (RT)

One μg of RNA was made free of DNA byincubating with DNAse I for 15 min at 25°C,according to the recommendations of thesupplier (Sigma). This DNA degradationprocess was followed by (i) thermalinactivation of the enzyme in presence of 50mM EDTA (70°C, 10 min) and (ii) a rapidcooling down to 4°C. Reverse transcription(RT) reactions were performed withSuperscript III First-Strand Synthesis Systemfor RT-PCR following manufacturer’sinstructions (Invitrogen) in a PTC 200thermocycler (MJ Research, Watertown,MA). To minimize possible variations ofcDNA synthesis during RT process, sixseparate RT reactions were performed andpooled for each RNA extract. Then, 2.5 μMoligo(dT)20 primers and 0.5 mM dNTP werehybridised to DNase-treated total RNA in avolume of 10 μL by heating up to 65°C for 5min, then placed on ice. First-strand cDNAwas synthesised by incubating the previousRNA-containing mixture with 1X RT buffer,5 mM MgCl2, 0.01 M DTT, 40 units RNaseOUT and 200 units Superscript III RT in a20 μL final reaction volume. The RTreaction was performed sequentially for 50min at 50°C, for 5 min heating at 85°C and arapid cooling down to 4°C followed byRNase H treatment (Invitrogen). cDNAswere immediately used and/or stored at -20°C until analysis. In order to test cDNA

amplification products specificity, a reversetranscription reaction without enzyme wassimultaneously performed.

2.5.3. Primer designs

The PCR primers were designed usingPrimer Express 2.0 software (AppliedBiosystems). Each gene sequence wasobtained from public database. Each primerwas designed to produce approximately a100 bp-amplicon according to AppliedBiosystems’ recommendations. Primersequences for amplification of C4-phosphoenolpyruvate carboxylase (PEPc),Ribulose-1,5-bisphosphate carboxylasesmall subunit (Rubisco-SSU), Ribulose-1,5-bisphosphate carboxylase large subunit(Rubisco-LSU), ribulose-1,5-bisphosphatecarboxylase/oxygenase activase (RCA) andmaize actin genes by real-time PCR arelisted in Table 1. Rubisco-SSU primerswere designed to fit both Rubisco-SSUgenes described in literature (Hanhen et al.,2003). Gene specificity of each primer wasconfirmed throughout BLAST searches inpublic databases. Furthermore, thespecificity of RT-PCR products wasassessed by monitoring the dissociationcurves after real-time RT-PCR reactions inABI Prism 5700 sequence detection System(Perkin-Elmer Applied Biosystems) andanalysing their size using electrophoresiswith ethidium bromide staining on a 4%agarose gel.

TABLE 1

Sequences of oligonucleotide primers used for real-time RT-PCR

Oligo name Accession Oligonucleotide sequence (5’ to 3’)b Reverse ProductForward size (bp)

Actin J 01238 GATGGTCAGGTCATCACCATTG AACAAGGGATGGTTGGAACAAC 76

PEPc X 15238 AGCCTTCAGAACCGATGAAATC CATCCCATAGCGCATTTCG 67

Rubisco-SSU D 00170 ATGTGGAAGCTGCCCATGTT GCCTCCTGCAGCTCCTTGTA 65

Rubisco-LSU Z 11973 AAAGCCTTACGCGCTCTACGT CGGACCTTGGAAAGTTTTTGAA 72

Rubisco Activase AF 084478 CTTCATGACCCTGCCAAACA GATTTTCCCTGGCCTTTGC 72

b BLAST analysis (www.ncbi.gov/BLAST) showed that all primers have 100% homology with their intendedtarget sequence, i.e. are specific.


2.5.4. Real-time RT-PCR

Real-time RT-PCR was carried out usingSYBR Green PCR master mix (AppliedBiosystems) in the ABI Prism 5700Sequence detection system (Perkin-ElmerApplied Biosystems) with a GeneAmp 5700PCR thermocycler, according to theprotocol provided by the supplier.Triplicate amplification reactions wereperformed in 20 μL 1X SYBR Green PCRmaster mix containing 300 nM of eachprimer (forward and reverse) and 5 μLcDNA. PCR parameters were thoserecommended by the manufacturer. Meltcurves and derivative melt curves were runafter the last PCR cycle. Melt curves wereproduced by plotting the fluorescenceintensity versus temperature as thetemperature increased from 60 to 95°C. Thereal-time RT-PCR efficiency wasdetermined for each gene with the slope ofa linear regression model (Pfaffl, 2001) bymeasuring the Ct value to a specificthreshold for a serial dilution of RNA(Walker, 2002). Since all RT-PCRefficiencies were above 98%, thecomparative Ct method which was similarto the standard curve method (AppliedBiosystems User Bulletin #2), was used.The use of GeNorm software(Vandesompele et al., 2002) as well asBrunner et al.’s procedure (Brunner et al.,2004) showed that the expression of actin, ahousekeeping gene, was stable enough to beused as an internal standard for RT-PCR toallow normalization of real-time RT-PCRdata. Normalized amplification data arecalculated and expressed as 2(Ctactin- Ctgene),where Ct corresponds to the number ofcycles needed to generate a fluorescentsignal above a predefined threshold (Ferryet al., 2003).

2.6. Statistical analysis

For each treatment, results are expressed asmeans associated with standard error (SE).The significance of ozone treatmentimpacts were tested using a one-wayanalysis of variance (ANOVA). Each time asignificant difference was accepted(p<0.05), groups of homogeneous means

were detected with the help of a Newman-Keuls test based on the minimumsignificant range (Sokal and Rohlf, 2001).All statistical analyses were carried outusing STATBOX (version 6.4) softwarepackage.

3. RESULTS

3.1. Ozone exposure and visible foliardamage

Ozone data recorded in NF, +40 and +80treatments are reported in Table 2. Incontrol treatments, the 5th and 10th leaveswere exposed to seasonal 7-h mean ozoneconcentrations of 48 and 36 nL L-1,respectively. In experiment 1, the ozoneconcentrations registered in +40 and +80regimens during the 7-h O3-enrichmentwere roughly 1.8- and 2.6-fold that of theambient control (NF), respectively. Inexperiment 2, they were roughly 2.1- and3.2-fold that of NF. Although the externalAOT40 ozone dose experienced by the 5th

leaf in control treatment (NF) was 2.8-foldgreater than that experienced by the 10th

leaf, both leaves were exposed to almostsimilar AOT40 doses in each of the twoozone-enriched treatments. The AOT40ozone dose that the 5th and the 10th leavesreceived in +80 atmosphere was about 2-fold superior to that computed in +40atmosphere.

At the date of their respective harvest,no visible damage was exhibited by the 5th

and 10th leaves from control atmosphere(NF). Tenth leaves from +40 and +80atmospheres appeared as healthy as thosefrom NF conditions: neither colour changenor particular necrosis could be observedon their laminae. Conversely, 5th leavesfrom ozone-enriched atmospheres exhibitedsenescence symptoms crescent with theexternal ozone dose: chlorosis was morepronounced in +80 atmosphere than in +40atmosphere. Moreover, in +80 atmospherethe lamina tip (1.5-2 cm) of the yellowish5th leaf was completely withered. In anycase the senescence proceeded in the samemanner as leaf development: from the topof the leaf (made of older cells) to the base(made of younger cells).


3.2. Ozone effect on photosynthetic pigmentcontent

As shown in Figure 1, the photosyntheticpigmentations of the 5th and 10th leaveswere differentially affected by ozone.

Regarding the 5th leaf, pigment datamatched the visual aspect of the lamina. Incontrol atmosphere (NF), total chlorophylland total carotenoid contents were onaverage, 47.40 μg cm-2 and 7.37 μg cm-2,respectively. A decline in total chlorophyllsby about 35 and 47% was evidenced in +40and +80 treatments, respectively, relative tothe control (NF). Such a significantreduction (p<0.001) can be ascribed toconsistent losses in both Chl a (p<0.001)and Chl b (p<0.001) (Fig. 1). However, assuggested by the Chl a/b ratio, Chl a tendedto be more affected than Chl b (p<0.01).This trend became significant only in thehighest ozone-enriched treatment (+80).Indeed, in +80 atmosphere Chl a wasdecreased by 52% whereas Chl b wasdecreased by only 35%, compared to thecontrol. The ozone-induced decline in totalcarotenoid content was also significant(p<0.001) and almost similar to thereduction in total chlorophylls. Therefore,total carotenoids were decreased by 32%and 54% in +40 and +80 treatments,respectively. However, the Chl a+b/total

Car ratio was slightly but consistently(p<0.05) increased in +80 treatment. Thisresult suggests that carotenoids might bemore sensitive to ozone than chlorophylls.

Regarding the 10th leaf, ozone-inducedchanges in pigment content wereaccompanied by no change in leaf colourthat could be visually assessed. Undernormal atmosphere, the 10th leaf was richerin photosynthetic pigment than the 5th leaf.In mature 10th leaf from NF atmosphere,Chl a, Chl b and total carotenoidconcentrations were about 42%, 15% and60% higher than in the control mature 5th

leaf, respectively. Therefore, in the controlupper leaf (10th), Chl a/b ratio wasdefinitely greater whereas Chl a+b/total Carwas lower, relative to the control lower leaf(5th). In any case, ozone was also able tosignificantly modify total chlorophyll(p<0.001), Chl a (p<0.001), Chl b(p<0.001) and total carotenoid (p<0.001)contents in the 10th leaf (Fig. 1). However,its effect was more complex than thatobserved for the 5th leaf. Indeed, a moderateaddition of 40 nL L-1 ozone to the ambientconcentration (+40 atmosphere)consistently increased total chlorophylls(+36%), Chl a (+37%), Chl b (+34%) andtotal carotenoids (+30%), relative to thecontrol. This stimulation of pigmentaccumulation affected neither Chl a/b ratio

TABLE 2

Ozone data recorded in the three tested atmospheres according to the experiment

Experiments 1 and 2 were carried out to study the ozone impact on the 5th and the 10th

maize leaf, respectively. For each experiment, seasonal 7-h (between 10:00 and 17:00 hGMT) mean O3 concentrations (nL L-1) were computed from the beginning of the exposureuntil harvest date. External O3 doses expressed as AOT40 [Accumulated exposure Over a

Threshold of 40 nL L-1 O3 (nL L-1 h), see Materials and Methods] were computed fromemergence of the sampled leaf until its harvest. NF, chambered non-filtered air (control);

+40, +80, chambered non-filtered air plus 40 and 80 nL L-1 O3, respectively.

Experiment 1 (5th leaf) Experiment 2 (10th leaf)

Atmosphere Ozone concentration AOT40 Ozone concentration AOT40(nL L-1) (nL L-1 h) (nL L-1) (nL L-1 h)

NF 48 1281 36 463

+40 86 7170 76 7094

+80 124 12782 114 14539


nor Chl a+b/total Car ratio. Conversely, thehighest polluted atmosphere (+80 nL L-1

ozone) induced a significant decline in totalchlorophylls (-22%), Chl a (-26%), Chl b (-12%) and total carotenoids (-25%), relativeto the control. As already observed in the 5th

leaf, Chl a was much more reduced by ozonethan Chl b and the extent of reduction intotal carotenoid content was close to thatregistered for Chl a. The preferentialdegradation of Chl a, relative to Chl b, wasunderlined by the significant fall in the Chla/b ratio (p<0.01). In the same way as for the5th leaf, the Chl a+b/total Car ratiodetermined in the 10th leaf appeared ratherinsensitive to the deleterious ozone effects.

3.3. Specificity of real-time RT-PCRreaction

For each primer set, the specificity ofSYBR Green detection of real-time RT-PCR products was assessed by dissociationcurve analysis and agarose gelelectrophoresis. For example, regardingRubisco-LSU, a single dissociation peakwas obtained for an experimental meltingtemperature (Tm) of 78°C that was veryclose to the theoretical Tm of 79°C. Thepresence of a single amplification productwas confirmed by gel electrophoresis whereonly a single band, with a predicted size of72 bp, was visible. All these data indicated

5th leaf

Total ChlChl a

a

b

c

a

bc

***

***

50

40

30

20

10

ug

cm

-2

10th leaf

Total ChlChl a

a

b

ca

b

c

***

***

100

ug

cm

-2

90

80

70

60

50

40

20

a

b ba

bc

***

***

14

ug

cm

-2

12

10

8

6

4

2NF

(1281)+40

(7170)+80

(12782)

Atmosphere(AOT40, nL L-1 h)

a

b

aa

b

c

***

***

30

ug

cm

-2

5NF

(463)+40

(7094)+80

(14539)


Chl bTotal Car

20

15

10

Chl bTotal Car

Figure 1: Total chlorophylls (●), chlorophyll a (▲), chlorophyll b (♦) and total carotenoids (O)accumulated in control and ozone-treated maize leaves (5th leaf and 10th leaf). NF, chambered non-filtered air; +40, +80 chambered non-filtered air plus 40, 80 nL L-1 O3, respectively. External ozonedoses accumulated by the leaves are provided as AOT40 values (nL L-1 h; see Materials andMethods). Data are presented as mean values (n=5). Vertical bars represent standard errors (SE).Results of a one-way ANOVA: ***, p<0.001; **, p<0.01; *, p<0.05. When significance wasaccepted (p<0.05), means were compared with a Newman-Keuls test: means identified with thesame letter are not significantly different (p>0.05).


that Rubisco-LSU real-time RT-PCR assaywas gene-specific and could not beconfused with non-specific amplificationand/or primer dimer. Melting curves andgel analyses for all other primer sets(Rubisco-SSU, Rubisco activase and PEPc)matched well.

3.4. Ozone impact on PEP carboxylase(transcripts and protein)

Ozone was able to reduce PEPc transcriptsin the 5th leaf (p<0.001) as well as in the10th leaf (p<0.01) (Fig. 2). However, theeffect of a given external ozone dose onPEPc mRNA levels could vary with leafrank. Indeed, an AOT40 of 7170 nL L-1 h(achieved in +40 atmosphere) significantlyreduced the PEPc transcripts by 59% in the5th leaf whereas an almost similar externalozone dose of 7094 nL L-1 h (also achievedin +40 atmosphere) did not change theiramount in the 10th leaf. In any case, the

highest ozone dose accumulated in +80atmosphere significantly decreased PEPcmRNA in both 5th (-59%) and 10th (-79%)leaf. In control atmosphere (NF), the foliarrelative amount of PEPc protein did notvary significantly between lower and upperleaves (p=0.370). On the average, PEPcprotein accounted for circa 15% of solubleproteins extracted from the 5th leaf whereas,in the 10th leaf, it accounted for circa 14%of soluble proteins. The O3-inducedvariations in PEPc protein content roughlyreflected changes observed in mRNAquantities even if depletion percentageswere not always comparable (Fig. 2).Regarding the 5th leaf, a significantreduction in PEPc protein was noticedexclusively in +80 atmosphere (-44%,relative to the control) whereas transcriptswere already drastically reduced in +40atmosphere. As previously described fortranscripts, +40 atmosphere did notconsistently change the PEPc protein

5th leaf

40

0

30

20

10

ProteinTranscript

20

0

10

PE

Pc

tran

scri

pt

leve

l(a

rbit

rary

un

it) P

EP

c con

tent (%

)

aa

ba

bb

NF(1281)

+40(7170)

+80(12782)

***

*


25

0

20

10

5

ProteinTranscript

18

4

PE

Pc

tran

scri

pt

leve

l(a

rbit

rary

un

it) P

EP

c con

tent (%

)

a

a

ba

ba

NF(459)

+40(7094

+80(14539)

**

*


16

14

12

10

8

6

15

10th leaf

Figure 2: PEPc transcript levels (O) and PEPc protein amounts (●) determined in 5th and 10th

leaves from maize plants exposed to three increasing O3 concentrations. Relative quantification ofPEPc transcripts (arbitrary units) was performed by real-time RT-PCR with actin as housekeepinggene. Amount of PEPc protein was expressed as percentage of soluble proteins. NF, chambered nonfiltered air; +40, +80 chambered non-filtered air plus 40, 80 nL L-1 O3, respectively. External ozonedoses accumulated by the leaves are provided as AOT40 values (nL L-1 h; see Materials andMethods). Data are presented as mean values (n=5). Vertical bars represent standard errors (SE).Results of a one-way ANOVA: ***, p<0.001; **, p<0.01; *, p<0.05. When significance wasaccepted (p<0.05), means were compared with a Newman-Keuls test: means identified with thesame letter are not significantly different (p>0.05).

)


content in the 10th leaf whereas +80atmosphere significantly reduced theprotein by 25%, i.e. 3-fold less than mRNAquantities. In the atmosphere with highestpollution (+80), the percentage of PEPcprotein was more severely depressed in the5th leaf (-44%) by an AOT40 of 14539 nLL-1 h than in the 10th leaf (-25%) for analmost comparable AOT40 of 12782 nL L-1

h.

3.5. Ozone impact on Rubisco (transcriptsand protein)

The ozone impact on the accumulation ofmRNAs encoding both Rubisco-SSU andRubisco-LSU is displayed in Figure 3.Whatever the tested atmosphere, theamounts of SSU and LSU transcriptsextracted from the 5th leaf remainedstatistically stable (p=0.338 and p=0.634for SSU and LSU, respectively). This wasalso true for LSU mRNA from the 10th leaf(p=0.231) in spite of a trend towards anincrease in both ozone-enrichedatmospheres as compared to the control(NF). Also in the 10th leaf, this trendbecame significant for SSU (p<0.001): thelevel of SSU transcripts increased by 338%and 59%, in +40 and +80 atmosphere,respectively, relative to NF. Focusing onRubisco protein, it appeared that the control10th leaf was slightly richer (p=0.018) inRubisco-SSU (circa 12% of solubleproteins) than the control 5th leaf (circa 8%of soluble proteins) (Fig. 3). In contrast,from a statistical viewpoint, these twoleaves contained similar average amountsof Rubisco-LSU (p=0.170): about 24% forthe 5th leaf and 26% for the 10th leaf. In the10th leaf, the amounts of both Rubiscosubunits were not consistently disturbed byozone (p=0.055 and p=0.062) even if, theytended to respond to increasing ozoneconcentration in the same way as transcriptsdid. As compared to the control, a smallaverage increase was observed in +40atmosphere (+14% for SSU and +13% forLSU) whereas a small average reductionwas noticed in +80 atmosphere (-11% forSSU and -12% for LSU). With regard to the5th leaf, SSU and LSU proteins exhibited aresponse to ozone distinct from that shown

by their corresponding transcripts. Indeed,ozone significantly reduced both SSU(p<0.001) and LSU (p<0.01) proteins.However, these declines were reliable onlyin +80 atmosphere: -31% for SSU and -29%for LSU.

3.6. Ozone impact on Rubisco activasetranscripts

Accumulation of transcripts encodingRubisco activase did not seem verysensitive to ozone exposure (Fig. 4).Despite the occurrence of mean variationsin transcript amounts that could reach 50%relative to the control, no significantchanges were statistically assessed probablybecause of some important within-atmosphere variances. However, RCAmRNAs from the 5th and 10th leaves clearlyshowed distinct trends in their response toozone. Indeed, as quantities of RCAmRNAs accumulated in the 5th leafdecreased by -37% and -44% in +40 and+80 atmosphere, respectively and relativeto the control, RCA mRNAs accumulated inthe 10th leaf increased by 50% and 36%.

4. DISCUSSION

Ozone and maize pigments

The control 10th leaf accumulated largeramounts of photosynthetic pigments (Chl a,Chl b and Car) than the control 5th leaf. The5th leaf is a small leaf as compared to the10th leaf. Despite its rather short lifespan,the 5th leaf sampled in control atmospherewas particularly healthy. It exhibited novisible sign of senescence at the harvestdate. Thus, the difference in pigmentcontent between control 5th and 10th leafcould be ascribed to (i) a pigment loss inthe 5th leaf resulting from a naturalsenescence process which is not sufficientlyadvanced to be visually assessed or/and (ii)a greater pigment accumulation in the 10th

leaf that could be variously explained.Focusing on this last hypothesis, theincrease in pigment content measured in the10th leaf does not necessarily mean thatthylakoids are richer in pigments or/and


that cells are richer in chloroplasts. It maybasically be due to the unit in whichpigment concentrations are expressed (mgcm-2) since that unit takes neither foliar drymatter nor leaf thickness into account.Indeed, it has been reported that leaf massper unit leaf area (LMA) augments withleaf rank in maize plants (Drouet et al.,2005). Such an increase in LMA may resultfrom an increase in leaf thickness (Mauriceet al., 1997). Thus, the 10th leaf appearsricher in pigments than the 5th leaf probablybecause it is thicker and therefore containsa much more important number ofmesophyll cells.

Although they roughly experienced the sameAOT40 doses in each of the two ozone-enriched atmospheres, 5th and 10th leavesexhibited distinct pigment responses toozone. The decline in pigment content withincreasing ozone concentration could beexpected since it had been previouslyreported that ozone was able to accelerateleaf senescence by triggering an oxidativeburst (Castagna et al., 2001; Calatayud andBarreno, 2004). If the deleterious ozoneeffect on photosynthetic pigments had beenshown in many C3 species (Castagna et al.,2001; Calatayud and Barreno, 2004), no datawere available in maize. Nevertheless, a

Figure 3: Rubisco-SSU (O), Rubisco-LSU (Δ) transcript levels and Rubisco-SSU (●), Rubisco-LSU (▲) protein amounts determined in 5th and 10th leaves from maize plants exposed to threeincreasing O3 concentrations. Relative quantification of Rubisco transcripts (arbitrary units) wasperformed by real-time RT-PCR with actin as housekeeping gene. Amounts of Rubisco-SSU andRubisco-LSU subunits were expressed as percentage of soluble proteins. NF, chambered nonfiltered air; +40, +80 chambered non-filtered air plus 40, 80 nL L-1 O3, respectively. External ozonedoses accumulated by the leaves are provided as AOT40 values (nL L-1 h; see Materials andMethods). Data are presented as mean values (n=5). Vertical bars represent standard errors (SE).Results of a one-way ANOVA: ***, p<0.001; **, p<0.01; *, p<0.05. When significance wasaccepted (p<0.05), means were compared with a Newman-Keuls test: means identified with thesame letter are not significantly different (p>0.05).


decrease in maize chlorophyll content inresponse to different abiotic stresses(ultraviolet-B radiation or herbicide) knownto generate AOS formation had been alreadyreported (Jung, 2003; Correia et al., 2004).In our experiment, the loss in bothchlorophylls (a and b) and carotenoidsaugmented across +40 and +80 atmospherein the 5th leaf while for the 10th leaf, itoccurred to a lesser extent only in +80atmosphere. Thus, an AOT40 of 12782 nL L-

1 h (accumulated in +80 atmosphere)reduced pigment content in the 5th leafdrastically enough to be visible, whereas analmost similar AOT40 of 14539 nL L-1 hslightly depressed the pigment content of the10th leaf without modifying its visual aspect.The preferential degradation in Chl a thatwas noticed in both leaves from +80atmosphere, relative to Chl b, was alsoexpected since it had previously beenreported in response to ozone, in C3 species(Castagna et al., 2001). If the effect of the

reproductive growth on the profiles of maizeleaf senescence was investigated withspecial regard to the node (Sadras et al.,2000), there are currently no clear data ableto allow a comparison between senescencepatterns of 5th and 10th leaves. Nonetheless,the distinct negative ozone impacts onpigmentation may be related to differentphysiological abilities. Indeed, the 10th leafthat contributes to corn filling ischaracterized by a longer lifespan than the5th leaf that naturally begins to senesceearlier after its full leaf span. So, ascompared to the 10th leaf, a much moreozone-accelerated senescence in the 5th leafcould be expected. The consistent increase inpigment content (Chl a, b and Car) that wasobserved in the 10th leaf in response to amoderate addition of ozone (+40atmosphere) was more unexpected. Untilnow, only slight indications of a higherfoliar chlorophyll concentration have beendetected in potato and birch samplings

Figure 4: Rubisco activase transcript levels ( ) determined in 5th and 10th leaves from maize plantsexposed to three increasing O3 concentrations. Relative quantification of transcripts (arbitraryunits) was performed by real-time RT-PCR with actin as housekeeping gene. NF, chambered nonfiltered air; +40, +80, chambered non-filtered air plus 40, 80 nL L-1 O3, respectively. Externalozone doses accumulated by the leaves are provided as AOT40 values (nL L-1 h; see Materials andMethods). Data are presented as mean values (n=5). Vertical bars represent standard errors (SE).Results of a one-way ANOVA: ***, p<0.001; **, p<0.01; *, p<0.05. When significance wasaccepted (p<0.05), means were compared with a Newman-Keuls test: means identified with thesame letter are not significantly different (p>0.05).

5th leaf

NF(1281)

+40(7170)

+80(12782)


60

50

40

30

20

10

0

Transcript

RC

A t

ran

scri

pt

leve

l(a

rbit

rary

un

it)

10th leaf

RC

A t

ran

scri

pt

leve

l(a

rbit

rary

un

it)

30

25

20

15

10

5

0

Transcript

NF(459)

+40(7094)

+80(14539)



grown under elevated O3 (Bindi et al., 2002;Karlsson et al., 2003). Comparatively, thepigment rise we evidenced (approximately+33%) is more spectacular and could beregarded as an adaptative response. Bypromoting light reactions of photosynthesis,it may contribute to enhance production ofboth ATP and reducing power required fordetoxification and repaired processes. On thecontrary, the ozone-induced pigmentdegradation can limit the ability of plants touse energy and consequently can contributeto the impairment of photosynthesis.

mRNA levels and carboxylase proteinaccumulation

With special regard to unstressed leavesfrom control treatment, we showed thatcarboxylase protein of the mature 5th leaf(lower leaf) was roughly similar to that ofthe mature 10th leaf (upper leaf). Theserelative amounts expressed as percentages ofsoluble proteins matched those alreadyreported in maize (Sugiyama et al., 1984).The analysis of real-time RT-PCR datarevealed that ozone was able to differentiallydisturb the amount of mRNAs encodingPEPc, Rubisco and Rubisco activase. Suchozone-induced changes in transcript levelsdid not necessarily reflect parallel changes inthe protein products of these genes. Firstly,the transcript accumulation we measuredmust be regarded as a balance betweentranscription activity and mRNA stabilitythat can be controlled in part, by furtherpost-transcriptional events (DeRocher andBohnert, 1993; Glick et al., 1995; Pell et al.,1997). Secondly, a tight linkage betweenmRNA quantity and the amount of itscorresponding protein must notsystematically be expected since (i) alltranscripts are not necessarily translated and(ii) post-translational events as well asprotein degradation also regulate proteinaccumulation (Moore et al., 1998; Suzuki etal., 2001; Cohen et al., 2005). On thissubject, it is acknowledged that theexpression of genes encoding Rubisco-SSU,Rubisco-LSU and PEPc may be regulated attranscriptional, translational and post-translational levels (Eckardt and Pell, 1994;Glick et al., 1995; Pell et al., 1997; Moore et

al., 1998; Suzuki et al., 2001; Cohen et al.,2005). Besides, ozone may differentiallymodify mRNA and protein accumulation.

Ozone and PEPc

PEPc is a cytosolic carboxylase made offour identical subunits of about 110 kDaeach (Nimmo, 2003). In C4 species such ascorn, the photosynthetic isoform isresponsible for primary CO2 fixation thatcharacterizes C4 photosynthesis (Hudspethand Grula, 1989). As for photosyntheticpigments, the highest ozone-enrichedtreatment (+80) drastically reduced C4-PEPc transcripts in both sampled leaveswhereas a moderate ozone addition (+40treatment) corresponding to an externalozone dose of circa 7100 nL L-1 h could orcould not decrease C4-PEPc mRNAaccumulation in the 5th and 10th leaves,respectively. Variation patterns of PEPcprotein content correlated roughly withmRNA data: changes followed the samedirection, however, they did not havesimilar magnitudes. Light distortions in thecorrelation arose especially for +40treatment. Indeed, in that atmosphere, the10th leaf PEPc protein content slightlyincreased (+37%) whereas mRNA poolencoding C4-specific PEPc isoformremained stable. In the 5th leaf from thesame atmosphere, the PEPc protein contentwas slightly decreased whereas the C4-specific PEPc mRNA was severelydecreased. Whatever the leaf, a much moreimportant external ozone dose accumulatedin +80 atmosphere (AOT40 of 12782 and14539 nL L-1 h for 5th and 10th leaf,respectively) reduced both mRNA andprotein suggesting that O3-derived AOSwere produced in ample amounts topromote, via a transduction signal pathway,the deceleration of protein biosynthesis andprobably an increase in protein degradation(Pell et al., 1997). In any case, we neverdetected an increase in PEPc protein ormRNA levels as previously reported for C3species (Dizengremel, 2001). When itoccurs, the loss in PEPc content might bepartly the result of a biosynthesis inhibitionat transcription level as suggested by thedecrease in the corresponding transcripts.


Ozone, Rubisco and Rubisco activase

Rubisco is a holoenzyme made of eightnucleus-encoded small subunits (SSU) andeight chloroplast-encoded large subunits(LSU). Its activity is partly regulated byanother protein, Rubisco activase(Spreitzer, 1999). In control 5th and 10th

leaves, the ratio of RbcL to RbcS mRNAwas close to that (10:1) previously reportedin maize leaves (Sheen and Bogorad, 1986).Whatever the atmosphere tested, this ratioremained roughly unchanged.

Surprisingly, ozone seemed to have noimpact on Rubisco-related mRNAs from the5th leaf whereas in the 10th leaf, contrary towhat had been observed for PEPc mRNAs,ozone was able to slightly increase both LSUand SSU transcripts especially when it wasadded in moderate concentration (+40).These data contrast with those from Ruzsa etal. (1999) who tested high ozoneconcentrations. Indeed, using Northern blotanalysis, these authors showed that maizemRNA encoding Rubisco small subunit wasdecreased by (i) a single 6 h exposure toozone concentrations ranging from 300 to1000 nL L-1 and (ii) 3, 6, or 10 days ofrepeated exposure to ozone concentrationsranging from 100 to 300 nL L-1 (Ruzsa et al.,1999). These declines matched other resultsgained from various C3 plants. By means ofNorthern blot, it was shown that RbcS andRbcL transcripts were reduced in potatoleaves exposed for 3 days to 80 nL L-1 ozone(Glick et al., 1995) whereas RbcS transcriptsdeclined in Arabidopsis leaves exposed for 2weeks to 150 nL L-1 ozone (Miller et al.,1999). Bahl and Kahl (1995) suggested that,in response to an air pollutant stress,transcription reduction of some light-regulated photosynthesis genes like RbcScould result from oxidative damagesaffecting photoreceptors and/or signaltransduction molecules (Quail, 1991). As aconfirmation, a blocked transcription ofRubisco-SSU gene has been alreadydescribed in maize cells, uponphotooxidation (Mayfield and Taylor, 1987).In the 5th maize leaf, the absence of an ozoneeffect on Rubisco mRNA quantity could beconnected with a probable age-relatedreduction in transcription activity as

suggested by the amount of total RNAextracted from the control 5th leaf that wasabout 2.8 times lesser than RNAs present inthe control 10th leaf (data not shown). Sinceit is admitted that synthesis of Rubiscodeclines once leaves are fully expanded(Dalling, 1987), Reddy et al. (1993)postulated that the impact of ozone ontranscript level in mature leaves could not beas consistent as for the younger leaves. Stillin the 5th leaf, the ozone-induced variationsin SSU and LSU protein amounts werealmost similar to that observed for PEPc: nospectacular changes were detected for anAOT40 of 7170 nL L-1 h (+40 atmosphere)whereas a decline by a little less that onethird was registered in response to anAOT40 of 12782 nL L-1 h (+80 atmosphere).In contrast to the results from Eckardt andPell (1994) who found that LSU was lessresponsive to ozone than SSU but matchingour previous results gained from bean(Junqua et al., 2000), we showed that bothsubunits of maize Rubisco were equallyreduced by an appropriate ozone dose. Suchsimilar reductions might reflect distinctozone impact. Indeed, it has been postulatedthat the maintenance of subunitstoichiometries may be driven by twoprincipal mechanisms: LSU would bepreferentially adjusted at the level of RbcLmRNA translation initiation whereas SSUlevels would be preferentially adjusted at thelevel of protein degradation (Rodermel,1999). However, the decrease in Rubiscoprotein during natural senescence of leavescan also be accompanied by coordinateddecreases in the levels of mRNAs for thesmall and large subunits of Rubisco (Jiang etal., 1993). In any case, the loss in Rubiscoprotein that has been extensively reported inC3 species exposed to ozone, is oftenregarded as a consequence of anenhancement in proteolysis activity relatedto an ozone-accelerated senescence process(Pell et al., 1994; Brendley and Pell, 1998;Junqua et al., 2000; Dizengremel, 2001). Inour case, the idea that the reduction inRubisco protein content is not due to adecline in transcription activity iscorroborated by the study of the 10th leaffrom +80 atmosphere that also exhibited aslightly reduced Rubisco content together


with a trend towards an increase incorresponding transcripts. Regardingphotosynthetic genes including RbcS, it hasbeen previously reported that atmosphere-induced changes in the steady-statetranscript levels do not necessarily reflectsimilar changes in the concentrations ofcorresponding proteins (Bahl and Kahl,1995; Moore et al., 1998). Irrespective of aprotein degradation acceleration, the absenceof correlation between SSU and LSUtranscript variations and their respectiveproducts could also be due to a possibleoxidative alteration of the translation system,as already suggested by Reiss et al. (1983) inthe case of a photooxidative stress. Withregard to the 10th leaf, the most originalevent was recorded in +40 atmosphere andconsisted in the concomitant increase in bothRubisco subunit content (SSU and LSU) andtheir respective transcripts. To ourknowledge it is the first time that such aphenomenon is observed in response to amoderate chronic ozone stress.

Until now, the effect of stresses onRubisco activase has been poorlyinvestigated (Portis, 2003). More precisely,to our knowledge, there are no dataregarding the specific effect of ozone onRubisco activase. Rubisco activasetranscripts from the 5th leaf tended to be lessabundant in both ozone-enrichedatmospheres related to the control,suggesting that Rubisco from ozonated 5th

leaf might be less activated. Conversely, theaddition of either 40 or 80 nL L-1

supplemental ozone tended to promote theaccumulation of Rubisco activase transcriptsin the 10th leaf. Even if measurements ofsteady-state mRNA content do notnecessarily reflect the rate of translation orprotein synthesis (Boschetti et al., 1990), ourresults suggest that ozone may either up- ordown-regulate the carboxylation activitycatalysed by Rubisco by modifying thequantity of the enzyme and/or by changingregulation of its activity.

To conclude, we showed that during itsgrowing period a maize upper leaf such asthe 10th leaf is able to respond to a moderateexternal ozone dose (7094 nL L-1 h) byincreasing photosynthetic pigments andtranscripts encoding Rubisco and Rubisco

activase. Level of C4-PEPc mRNA remainedalmost stable. Rubisco and PEPc proteinamounts were not drastically changed, evenif they tended to be increased. In response toa higher ozone dose (14539 nL L-1 h),pigments and transcripts encoding C4-PEPcwere notably decreased. Conversely, levelsof transcripts encoding both Rubiscosubunits and Rubisco activase were notconsistently disturbed even if they tended tobe slightly augmented. Rubisco and PEPcprotein amounts slightly declined. Regardingthe 5th leaf, the moderate external ozonedose (7170 nL L-1 h) induced a loss inpigmentation, PEPc and Rubisco activasemRNAs. However, this moderate stress wasunable to notably depress carboxylaseprotein amounts and mRNAs encodingRubisco. Except for Rubisco mRNAs, allother measured parameters from the 5th leafwere depressed by the highest ozone dose(12782 nL L-1 h). Although the intensity ofthe measured ozone-induced variationsmight be affected by an open-top chambereffect, we showed that maize leaves canrespond differentially to a similar ozonestress.

ACKNOWLEDGEMENTS

Louis Leitao is the recipient of a grant fromthe Région Aquitaine. This researchprogramme is part of the multidisciplinaryBioPollAtm project which is mainly fundedby the Ministère de l’Ecologie et duDéveloppement Durable (programmePRIMEQUAL 2), the Agence del’Environnement et de la Maîtrise del’Energie (Ademe), the Ministère Délégué àla Recherche (ACI Ecologie Quantitative,programme Biosphère Continentale) andthe Institut National des Sciences del’Univers / CNRS (Programme National deChimie Atmosphérique). Additionalfinancial support has come from the RégionAquitaine and the Conseil Général desPyrénées-Atlantiques. We gratefullyacknowledge Pr Eric Pinelli and BertrandPourrut for providing various facilities. Weare thankful to Arnaud Verbaere fortechnical assistance. We also wish to thankIsabelle Langlois and the technical support


of the Applied Biosystems company as wellas the genomic platform of the InstitutFédératif de Recherche 31 (Institut LouisBugnard, CHU Rangueil, 31432 Toulouse,Cedex 4) for providing excellent supportduring the setup of real-time PCR systems.We are indebted to Neau Eric for GeNormanalysis advice and to Arnaud Betbeder forEnglish language improvement.

REFERENCES

BAHL A, KAHL G (1995) Air pollutant stress changes thesteady state transcript level of three photosynthesisgenes. Environ Pollut 88: 87-65

BINDI M, HACOUR A, VANDERMEIREN K, CRAIGONJ, OJANPERA K, SELLDÉN G, HÖGY P, FINNAN J,FIBBI L (2002) Chlorophyll concentration of potatoesgrown under elevated carbon dioxide and/or ozoneconcentrations. Eur J Agron 17: 319-335

BOSCHETTI A, BREIDENBACH E, BLATTLER R(1990) Control of protein formation in chloroplasts.Plant Sci 68: 131-149

BRADFORD MM (1976) A rapid and sensitive method forthe quantitation of microgram quantities of proteinutilizing the principle of protein-dye binding. AnalBiochem 72: 248-254

BRENDLEY BW, PELL EJ (1998) Ozone-induced changesin biosynthesis of Rubisco and associatedcompensation to stress in foliage of hybrid poplar. TreePhysiol 18: 81-90

BRUNNER AM, YAKOVLEV IA, STRAUSS SH (2004)Validating internal controls for quantitative plant geneexpression studies. BMC Plant Biology 4: 1-7

CALATAYUD A, BARRENO E (2004) Response to ozonein two lettuce varieties on chlorophyll a fluorescence,photosynthetic pigments and lipid peroxidation. PlantPhysiol Biochem 42: 549-555

CASTAGNA A, NALI C, CIOMPI S, LORENZINI G,SOLDATINI GF, RANIERI A (2001) Ozone exposureaffects photosynthesis of pumpkin (Cucurbita pepo)plants. New Phytol 152: 223-229

CICERONE RJ (1987) Changes in stratospheric ozone.Science 237: 35-42

COHEN I, KNOPF JA, IRIHIMOVITCH V, SHAPIRA M(2005) A proposed mechanism for the inhibitoryeffects of oxidative stress on Rubisco assembly and itssubunit expression. Plant Physiol 137: 738-746

CORREIA CM, MOUNTINHO PERREIRA JM,COUNTINHO JF, BJÖRN LA, TORRES-PEREIRAJMG (2004) Ultraviolet-B radiation and nitrogen affectthe photosynthesis of maize: a Mediterranean fieldstudy. Eur J Agron 22: 337-347

DALLING MJ (1987) Proteolytic enzymes and leafsenescence. In: (eds THOMPSON WW, NOTHNAGELEA, HUFFAKER RC) Plant Senescence: i tsBiochemistry and Physiology. Rockville:AmericanSociety of Plant Physiologists. pp. 54-70

DEROCHER JE, BOHNERT HJ (1993) Development andenvironmental stress employ different mechanisms inthe expression of a plant gene family. Plant Cell 5:1611-1625

DIZENGREMEL P (2001) Effects of ozone on the carbonmetabolism of forest trees. Plant Physiol Biochem 39:729-742

DROUET J-L, PAGES L, SERRA V (2005) Dynamics ofleaf mass per unit leaf area and root mass per unit rootvolume of young maize plants: implications for growthmodels. Eur J Agron 22: 185-193

ECKARDT NA, PELL EJ (1994) O3-induced degradationof Rubisco protein and loss of Rubisco mRNA inrelation to leaf age in Solanum tuberosum L. NewPhytol 127: 741-748

ECKARDT NA, PELL EJ (1995) Oxidative modification ofrubisco from potato foliage in response to ozone. PlantPhysiol Biochem 33: 273-282

FERRY G, TELLIER E, TRY A, GRES S, NAIME I,SIMON MF, RODRIGUEZ M, BOUCHER J, TACK I,GESTA S, CHOMARAT P, DIEU M, RAES M,GALIZZI JP, VALET P, BOUTIN JA, SAULNIER-BLACHE JS (2003) Autotaxin is released fromadipocytes, catalyzes lysophosphatidic acid synthesis,and activates preadipocyte proliferation. Up-regulatedexpression with adipocyte differentiation and obesity. JBiol Chem 278: 18162-18169

GLICK RE, SCHLAGNHAUFER CD, ARTECA RN,PELL EJ (1995) Ozone-induced ethylene emissionaccelerates the loss of ribulose-1,5-bisphosphatecarboxylase/oxygenase and nuclear-encoded mRNAs insenescing potato leaves. Plant Physiol 109: 891-898

GRÜNHAGE L, JÄGER HJ, HAENEL HD, LÖPMEIERFJ, HANEWALD K (1999) The European criticallevels for ozone: improving their usage. Environ Pollut105: 163-173

GUIDI L, DI CAGNO R, SOLDATINI GF (2000)Screening of bean cultivars for their response to ozoneas evaluated by visible symptoms and leaf chlorophyllfluorescence. Environ Pollut 107: 349-355

HANHEN S, JOERIS T, KREUZALER F,PETERHÄNSEL C (2003) Quantif ication ofphotosynthetic gene expression in maize C3 and C4tissues by real-time PCR. Photosynth Res 75: 183-192

HÄUSLER RE, HIRSCH HJ, KREUZALER F,PETERHÄNSEL C (2002) Overexpression of C4-cycleenzymes in transgenic C3 plants: a biotechnologicalapproach to improve C3-photosynthesis. J Exp Bot 369:591-607

HEAGLE AS, KRESS LW, TEMPLE PJ, KOHUT RJ,MILLER JE, HEGGESTAD HE (1988) Ozone dose-yield response relationships. In: (eds HECK WW,TAYLOR OC, TINGEY DT) Assessment of Crop Lossfrom Air Pollutants. London, New York:ElsevierApplied Science. pp. 141-179

HEATH RL, TAYLOR TGE (1997) Physiological andplant responses to ozone exposure. In: (edsSANDERMANN H, WELLBURN AR, HEATH RL)Forest decline and ozone. Berlin: Springer-Verlag. pp.317-398

HUDSPETH RL, GRULA JW (1989) Structure andexpression of the maize gene encoding thephosphoenolpyruvate carboxylase isozyme involved inC4 photosynthesis. Plant Mol Biol 12: 578-589

JIANG CZ, RODERMEL SR, SHIBLES RM (1993)Photosynthesis, Rubisco activity and amount, and theirregulation by transcription in senescing soybeanleaves. Plant Physiol 101: 105-112

JUNG S (2003) Expression level of specific isozymes ofmaize catalase mutants influences other antioxidants onnorflurazon-induced oxidative stress. Pest BiochemPhysiol 75: 9-17

JUNQUA M, BIOLLEY JP, PIÉ S, KANOUN M, DURANR, GOULAS P (2000) In vivo occurrence of carbonylresidues in Phaseolus vulgaris proteins as a directconsequence of a chronic ozone stress. Plant PhysiolBiochem 38: 853-861


KANOUN M, GOULAS P, BASSÈRES A, BIOLLEY JP(2002) Ozone-induced oxidation of Rubisco: from anELISA quantif ication of carbonyls to putativepathways leading to oxidizing mechanisms. Funct PlantBiol 29: 1357-1363

KARENLAMPI L, SKARBY L (1996) Critical Levels forOzone in Europe: Testing and Finalizing the Concepts.University of Kuopio, Department of Ecology andEnvironmental Science, Kuopio

KARLSSON PE, UDDLING J, SKARBY L, WALLIN G,SELLDÉN G (2003) Impact of ozone on the growth ofbirch (Betula pendula) saplings. Environ Pollut 124:485-495

KOLB TE, MATYSSEK R (2001) Limitations andperspectives about scaling ozone impact in trees.Environ Pollut 115: 373-393

LEITAO L, GOULAS P, BIOLLEY J-P (2003) Time-course of Rubisco oxidation in beans (Phaseolusvulgaris L.) subjected to a long-term ozone stress.Plant Sci 165: 613-620

LICHTENTHALER HK (1987) Chlorophylls andcarotenoids: Pigments of photosyntheticbiomembranes. Method Enzymol 148: 350-382

MATILE P, HÖRTENSTEINER S, THOMAS H (1999)Chlorophyll degradation. Annu Rev Plant Physiol PlantMol Biol 50: 67-95

MATYSSEK R, HAVRANEK WM, WIESER G, INNES JL(1997) Ozone and the forests in Austria andSwitzerland. In: (eds SANDERMANN H,WELLBURN AL, HEATH RL) Forest Decline andOzone. Berlin Heidelberg: Springer-Verlag. pp. 95-134

MAURICE I, GASTAL F, DURAND J-L (1997)Generation of form and associated mass depositionduring leaf development in grasses: a kinematicapproach for non-steady growth. Ann Bot London, 80:673-683

MAYFIELD SP, TAYLOR WC (1987) Chloroplastsphotooxidation inhibits the expression of a set ofnuclear genes. Mol Gen Genet 242: 309-314

MILLER JD, ARTECA RN, PELL EJ (1999) Senescence-associated gene expression during ozone-induced leafsenescence in Arabidopsis. Plant Physiol 120: 1015-1023

MILLER JE (1988) Effects on photosynthesis, carbonallocation and plant growth associated with airpollutant stress. In: (eds HECK WW, TAYLOR OC,TINGEY DT) Assessment of Crop Loss from AirPollutants . London, New York:Elsevier AppliedScience. pp. 287-314

MOORE BD, CHENG SH, RICE J, SEEMAN JR (1998)Sucrose cycling, Rubisco expression, and prediction ofphotosynthetic acclimation to elevated atmosphericCO2. Plant Cell Environ 21: 905-915

NIMMO HG (2003) Control of the phosphorylation ofphosphoenolpyruvate carboxylase in higher plants.Arch Biochem Biophys 414: 189-196

PELL EJ, LANDRY LG, ECKARDT NA, GLICK RE(1994) Effects of gaseous air pollutants on ribulosebisphosphate carboxylase/oxygenase: effects andimplications. In: (eds ALSHER RG, WELLBURN AR)Plant responses to the gaseous Environment:molecular, metabolic and physiological aspects .London:Chapman and Hall. pp. 239-253

PELL EJ, SCHLAGNHAUFER CD, ARTECA RN (1997)Ozone-induced oxidative stress: Mechanisms of actionand reaction. Physiol Plantarum 100: 264-273

PELL EJ, SINN JP, BRENDLEY BW, SAMUELSON L,VINTEN-JOHANSEN C, TIEN M, SKILLMAN J

(1999) Differential reponse of four tree species toozone-induced acceleration of foliar senescence. PlantCell Environ 22: 779-790

PELLOUX J, JOLIVET Y, FONTAINE V, BANVOY J,DIZENGREMEL P (2001) Changes in Rubisco andRubisco activase gene expression and polypeptidecontent in Pinus halepensis Mill. subjected to ozoneand drought. Plant Cell Environ 24: 23-132

PFAFFL MW (2001) A new mathematical model forrelative quantification in real-time RT-PCR. NucleicAcids Research 29: 2002-2007

PORTIS AR (2003) Rubisco activase-Rubisco’s catalyticchaperone. Photosynth Res 75: 11-27

QUAIL PH (1991) Phytochrome: a l ight-activatedmolecular switch that regulates plant gene expression.Annu Rev Genet 25: 389-409

REDDY CN, ARTECA RN, DAI YR, FLORES HE, NEGMFB, PELL EJ (1993) Changes in ethylene andpolyamines in relation to mRNA levels of the large andsmall subunits of ribulose bisphosphate carboxylase/oxygenase in ozone-stressed potato foliage. Plant CellEnviron 16: 819-826

REISS T, BERGFELD R, LINK G, THIEN W, MOHR H(1983) Photooxidative destruction of chloroplast andits consequences for cytosolic enzyme levels and plantdevelopment. Planta 15: 518-528

RODERMEL SR (1999) Subunit control of Rubiscosynthesis- a relic of an endosymbiotic past? PhotosynthRes 59: 105-123

RUZSA SM, MYLONA P, SCANDALIOS JG (1999)Differential response of antioxidant genes in maizeleaves exposed to ozone. Redox Rep 4: 95-103

SADRAS VO, ECHARTE L, ANDRADE FH (2000)Profiles of leaf senescence during reproductive growthof sunflower and maize. Ann Bot London 85: 187-195

SHEEN JY, BOGORAD L (1986) Differential expressionof six light-harvesting chlorophyll a/b binding proteingenes in maize leaf cell types. Proc Nat Acad Sci USA83: 7811-7815

SOKAL RR, ROHLF FJ (2001) Biometry Third Edition.W. H. Freeman and Company, New York

SPREITZER RJ (1999) Questions about the complexity ofchloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase. Photosynth Res 60: 29-42

SUGIYAMA T, MIZUNO M, HAYASHI M (1984)Partitioning of nitrogen among ribulose-1,5-bisphosphatecarboxylase/oxygenase, phosphoenolpyruvate carboxylase,and pyruvate orthophosphate dikinase as related to biomassproductivity in maize seedlings. Plant Physiol 75: 665-669

SUZUKI Y, MAKINO A, MAE T (2001) Changes in theturnover of Rubisco and levels of mRNAs of rbcL andrbcS in rice leaves from emergence to senescence.Plant Cell Environ 24: 1353-1360

THOMPSON AM (1992) The oxidising capacity of theearth’s atmosphere: probable past and future changes.Science 256: 1157-1165

VANDESOMPELE J, DE PRETER K, PATTYN F, POPPEB, VAN ROY N, DE PAEPA A, SPELEMAN F (2002)Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internalcontrol genes. Genome Biology 3: research 0034.1-0034.0011 http:/genomebiology.com/2002/3/7/research/0034 (15-09-2007)

VON CAEMMERER S, FURBANK RT (2003) The C4pathway: an efficient CO2 pump. Photosynth Res 77:191-207

WALKER NJ (2002) A technique whose time has come.Science 296: 557-559

changes in pep carboxylase, rubisco and rubisco activase ... · 2 inserm, ifr 31, chu rangueil,...

Documents