characterization of afae adhesins produced by ... · texas 775553; and unite´ des maladies...

JOURNAL OF CLINICAL MICROBIOLOGY,0095-1137/01/$04.0010 DOI: 10.1128/JCM.39.5.1738–1745.2001

May 2001, p. 1738–1745 Vol. 39, No. 5

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Characterization of AfaE Adhesins Produced by Extraintestinaland Intestinal Human Escherichia coli Isolates: PCR Assays

for Detection of Afa Adhesins That Do or Do NotRecognize Dr Blood Group Antigens

CHANTAL LE BOUGUENEC,1* LILA LALIOUI,1 LAURENCE DU MERLE,1 MABEL JOUVE,1,2

PASCALE COURCOUX,1 SAEID BOUZARI,1† RANGARAJ SELVARANGAN,3 BOGDAN J. NOWICKI,3

YVES GERMANI,4 ANTOINE ANDREMONT,5 PIERRE GOUNON,2 AND MARIE-ISABELLE GARCIA1‡

Unite de Pathogenie Bacterienne des Muqueuses1 and Station Centrale de Microscopie Electronique,2 Institut Pasteur, 75724 ParisCedex 15, and Unite de Bacteriologie, INSERM EMI 9933, Hopital Bichat, AP-PH, Paris,5 France; Department of Microbiology

and Immunology and Department of Obstetrics and Gynecology, The University of Texas Medical Branch, Galveston,Texas 775553; and Unite des Maladies Infectieuses Opportunistes, Institut Pasteur de Bangui,

BP923 Bangui, Central African Republic4

Received 18 October 2000/Returned for modification 20 December 2000/Accepted 5 February 2001

Operons of the afa family are expressed by pathogenic Escherichia coli strains associated with intestinal andextraintestinal infections in humans and animals. The recently demonstrated heterogeneity of these operons(L. Lalioui, M. Jouve, P. Gounon, and C. Le Bouguenec, Infect. Immun. 67:5048–5059, 1999) was used todevelop a new PCR assay for detecting all the operons of the afa family with a single genetic tool. This PCRapproach was validated by investigating three collections of human E. coli isolates originating from the stoolsof infants with diarrhea (88 strains), the urine of patients with pyelonephritis (97 strains), and the blood ofcancer patients (115 strains). The results obtained with this single test and those previously obtained withseveral PCR assays were closely correlated. The AfaE adhesins encoded by the afa operons are variable,particularly with respect to the primary sequence encoded by the afaE gene. The receptor binding specificitieshave not been determined for all of these adhesins; some recognize the Dr blood group antigen (Afa/Dr1

adhesins) on the human decay-accelerating factor (DAF) as a receptor, and others (Afa/Dr2 adhesins) do not.Thus, the afa operons detected in this study were characterized by subtyping the afaE gene using specific PCRs.In addition, the DAF-binding capacities of as-yet-uncharacterized AfaE adhesins were tested by variouscellular approaches. The afaE8 subtype (Afa/Dr2 adhesin) was found to predominate in afa-positive isolatesfrom sepsis patients (75%); it was frequent in afa-positive pyelonephritis E. coli (55.5%) and absent fromdiarrhea-associated strains. In contrast, Afa/Dr1 strains (regardless of the afaE subtype) were associated withboth diarrhea (100%) and extraintestinal infections (44 and 25% in afa-positive pyelonephritis and sepsisstrains, respectively). These data suggest that there is an association between the subtype of AfaE adhesin andthe physiological site of the infection caused by afa-positive strains.

Pathogenic Escherichia coli cells, which cause intestinal andextraintestinal infections in humans, generally adhere to mu-cosal epithelia early in the colonization of host tissues (14).These bacteria produce a wide variety of adhesive proteins andorganelles. Adhesins are often assembled into hairlike fiberscalled fimbriae (or pili) and are classified based on their ad-hesive properties. Type 1 adhesins that bind to mannose-con-taining host cell receptors (adhesins mediating mannose-sen-sitive hemagglutination [MSHA]) are produced by a widevariety of pathogenic and nonpathogenic E. coli strains yethave been implicated only in the pathogenicity of uropatho-genic E. coli (41). There are many adhesins that mediate man-

nose-resistant hemagglutination (MRHA). They are producedby a large number of pathogenic E. coli isolates associated withdifferent intestinal and extraintestinal infections. Some MRHAadhesins do not form fimbriae: among these are the AFAafimbrial adhesive sheaths (AFAs) that are encoded by the afagene clusters. Several studies have strongly suggested that afa-positive strains play an important role in urinary tract infection(UTI) pathogenesis (1, 2, 6, 9, 32). Such strains are especiallycommon in pregnant woman (44), children (2), and patientswith recurring UTIs (10). Furthermore, using an experimentalmodel of mouse chronic pyelonephritis, Goluszko et al. (20)demonstrated that an isogenic mutant that did not produce theDr adhesin (encoded by the afa-related dra operon) was lessvirulent in terms of causing persistent UTI than the parentalwild-type strain (20). An unusual feature of the afa-positivestrains is their additional association with intestinal infectionsin children (17, 19, 37, 38). These diarrhea-associated isolatesare E. coli organisms of the diffusely adherent pathotype(DAEC) (26, 35).

The first set of afa gene clusters to be described originatedfrom human uropathogenic and diarrhea-associated strains. It

* Corresponding author. Mailing address: Unite de Pathogenie Bac-terienne des Muqueuses, Institut Pasteur, 28 rue du Docteur Roux,75724 Paris Cedex 15, France. Phone: (1) 40 61 32 80. Fax: (1) 40 6136 40. E-mail: [email protected].

† Present address: Molecular Biology Unit, Pasteur Institute of Iran,Teheran 13164, Iran.

‡ Present address: Universita di Roma ‘La Sapienza,’ Dipartimentodi biotecnologie cellulari ed Ematologie, Sezione di Genetica Mole-colare, 1-00161 Rome, Italy.

1738

on March 28, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

contained very similar operons that could be detected by aPCR assay based on the sequence of the afaB and afaC genesfrom the afa-3 operon (36). This assay also detected the dra(45) and daa (5) operons from the same family of gene clusters.Unlike the other afa genes, afaE, the structural-adhesin-en-coding gene, was found to be highly heterogeneous, producingantigenically different adhesins (30). Of the various AfaE sub-types, the AfaE-I, AfaE-III, Dr, and F1845 adhesins, encodedby the afa-1, afa-3, dra, and daa operons, respectively, havebeen extensively studied (3, 4, 8, 12, 13, 21, 22, 28, 31, 32, 37,39). They mediate MRHA of human erythrocytes expressingthe Dr blood group antigen on the decay-accelerating factor(DAF, or CD55) (43). These so-called Afa/Dr1 adhesins alsomediate diffuse adhesion of the bacteria to human epithelialcells by recognizing the short consensus repeat-3 (SCR-3) do-main of the DAF molecule as a receptor (42). The relativedistribution of each of these Afa/Dr1 adhesin subtypes in alarge collection of strains from patients with UTI showed thatafaE3 and afaE1 are frequently expressed (47). Their distribu-tion among afa-positive diarrheagenic strains is unknown. In-terestingly, the same afaE1-positive strain has been implicatedas the causative agent of consecutive diarrhea and cystitis in anindividual child (16).

We recently reported the cloning and characterization of theafa-7 and afa-8 gene clusters from bovine isolates (33). Al-though these two operons have a genetic organization verysimilar to that of the afa gene clusters from human isolates,strains carrying them test negative for afa sequences by PCR.The AfaE-VII and AfaE-VIII adhesins do not bind to humanDAF (Afa/Dr2 adhesins) (33). Preliminary epidemiologicalresults showed a high prevalence of afa-8 genes in E. coliisolates from animals with extraintestinal infections and indi-cated that afa-8 sequences were present in human extraintes-tinal clinical isolates (15, 33). From these data, it appears thatthe afa operons are widely distributed among pathogenic E.coli. However, they encode a large variety of AfaE adhesins,the distributions and the receptors of which have not alwaysbeen identified.

This study has been initiated to increase our knowledge ofthe various AfaE adhesins and to better understand their rolein the pathogenicity of extraintestinal and intestinal E. coliisolates. The first goal was to develop a new PCR assay (usingthe afa-f and afa-r primers) for the detection of all the mem-bers of the afa family of gene clusters, including the afa-7 andafa-8 operons. We then used this assay to collect a large num-ber of afa-positive strains associated with different pathologies.The main objective was to compare the adhesins produced byintestinal and extraintestinal isolates. We identified the sub-types of the AfaE adhesins by PCR and showed that afaE8 isthe most prevalent adhesin subtype in human pyelonephritisand blood isolates. We then studied the receptor specificities ofsome as-yet-uncharacterized AfaE adhesins. These studiesconfirmed that Afa/Dr1 adhesins are produced by both ex-traintestinal and intestinal pathogenic human isolates, whereasAfa/Dr2 adhesins are produced only by extraintestinal patho-genic strains. Based on our results, we have a PCR assay for thedetection of both Afa/Dr1 and Afa/Dr2 adhesins and a PCRassay for the detection of Afa/Dr1 adhesins only.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions. Three collections of hu-man pathogenic E. coli, previously partially characterized, were used in thisstudy. Ninety-seven E. coli strains were isolated from urine specimens frompatients (children and adults) clinically diagnosed with pyelonephritis (1).Eighty-eight E. coli strains were isolated from stool specimens from children withdiarrhea (18). These strains did not produce heat-stable or heat-labile entero-toxins or Shiga-like toxins and were noninvasive. All adhered to HEp-2 andHeLa cell monolayers. One hundred fifteen strains of E. coli were isolated fromblood cultures from cancer patients (25). Additional afa-positive strains werealso used: seven human E. coli isolates, including strains KS52 and A30, fromwhich the afa-1 and afa-3 operons have been cloned, respectively (30, 37), andthe diarrhea-associated isolate C1845 (5), kindly provided by S. Moseley (Uni-versity of Washington, Seattle). Twenty-two isolates from calves (19 strains) andpiglets (3 strains) with intestinal and extraintestinal disorders were also studied.These isolates were previously reported to carry either the afa-7 (bovine strain262 KH 89) or the afa-8 (21 strains, including the bovine strain 239 KH 89) geneclusters (33).

E. coli K-12 strain HB101 (7) was used as a negative control in PCR studiesand as a host for genetic experiments. pILL570 (29) was used for cloning exper-iments. pILL1101 and pILL1191 are recombinant plasmids carrying the afa-3gene cluster from strain A30 and the afa-7 operon from strain 262 KH 89,respectively (13, 33). Culture conditions were as previously described (37).

Molecular biology techniques. Restriction endonuclease digestion and othercommon DNA manipulations were performed according to standard procedures(40). PCR assays were performed as previously described (36) using the sets ofprimers listed in Table 1. Amplification was carried out over 25 cycles of 94°C for1 min, 65°C for 1 min, and 72°C for 2 min in a thermal cycler (Perkin-ElmerCetus).

The afa-5 gene cluster was isolated from E. coli AL851, one of the clinicalstrains associated with diarrhea previously reported to carry an afa gene cluster(37). Fragments (6 to 13 kb in size) of plasmid DNA partially digested withSau3A were ligated to pILL570 linearized with BamHI. Two clones hybridizingwith the afa1-afa2 amplification product were selected; one carried the recom-binant plasmid pILL1147, which confers HeLa cell adhesion activity, and theother carried pILL1114, which does not confer adhesion (absence of the afaEgene). In electron microscopy of negatively stained preparations of the wild-type(AL851) and recombinant [HB101(pILL1147)] strains, we observed no fimbrialstructures on the bacterial surface, suggesting that the AfaE-V adhesin is afim-brial. The afa-2 gene cluster from E. coli A22 was cloned by inserting a 11.2-kbSau3A fragment from the recombinant cosmid pILL73 (30) into pILL570. Theresulting recombinant plasmid was called pILL1019. The nucleotide sequenceaccession numbers for afaE2 and afaE5 are X85782 and X91748, respectively.

Hemagglutination and adhesion assays. Adhesion to HeLa cells and thehemagglutination of washed human erythrocytes in the presence of 2% (wt/vol)a-methyl mannoside were assessed as described elsewhere (1, 28). CHO cell-binding assays were performed as previously described (42). For hemagglutina-tion and adhesion assays, human erythrocytes and CHO cells were preincubatedwith monoclonal antibodies (MAbs) directed against various domains of thehuman DAF.

Antibodies. The DAF-specific MAbs 1H4 and 8D11 (directed against theSCR-3 and SCR-4 domains, respectively), were kindly provided by D. M. Lublin(Washington University, St. Louis, Mo.), and BRIC110 (directed against SCR-2)and BRIC230 (directed against SCR-1) were purchased from the InternationalBlood Group Reference Laboratory (Bristol, United Kingdom).

Immunofluorescence. HeLa cells on glass coverslips were infected by incuba-tion with afa-expressing strains for 3 h. Briefly, the cells were fixed in 4% (wt/vol)paraformaldehyde (Merck, Darmstadt, Germany) in 0.1 M phosphate buffer (pH7.4) for 15 min, incubated in 50 mM NH4Cl in phosphate-buffered saline (PBS)for 30 min, and then permeabilized by adding 0.1% saponin (Sigma-AldrichChimie, St. Quentin-Fallavier, France) in PBS containing 0.2% bovine serumalbumin (BSA; Sigma-Aldrich Chimie) and incubating them for 15 min. DAFmolecules were detected by incubating the cells for 30 min at room temperaturewith BRIC230 and then with a fluorescein-conjugated secondary antibody. Cov-erslips were mounted in mowiol and examined under an Olympus microscope(model BH-2).

Microscopy. Interacting bacteria and erythrocytes were fixed by incubation in1.6% buffered (0.1 M phosphate buffer, pH 7.4) glutaraldehyde for 1 h, postfixedfor 2 h with 2% buffered osmium tetroxide, and embedded in 4% agarose typeVII at 37°C. The agar was solidified on ice, and the embedded specimens werecut into 1-mm3 blocks, which were dehydrated in a graded series of ethanolsolutions, treated with epoxy-1,2-propane, and then embedded in epoxy resin.

VOL. 39, 2001 AfaE ADHESINS IN HUMAN PATHOGENIC E. COLI 1739


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

Semithin sections (0.5 mm thick) were cut with a diamond knife, placed on glassslides, and examined in phase contrast with a Leica microscope. Bacterial sus-pensions were examined by electron microscopy for fimbrialike structures aspreviously described (37). For immunocytochemistry, the infected monolayerswere treated as previously described (23). Briefly, cells were fixed in situ with 4%formaldehyde (freshly made from paraformaldehyde) and 0.2% glutaraldehydein 0.1 M phosphate buffer (pH 7.4), scraped off the slides with a rubber police-man, and embedded in 10% gelatin. Small blocks were infused with 1.7 Msucrose–15% (wt/vol) polyvinylpyrrolidone (average molecular weight, 10,000)for at least 2 h, frozen in liquid nitrogen, and cut at 2120°C with a cryostat; thesections were transferred to Formvar-coated nickel grids. The grids were floatedon droplets of the following solutions in succession: 50 mM NH4Cl in PBS; 1%BSA–1% normal goat serum in PBS; anti-DAF antibodies (IA10) in 1%BSA–1% normal goat serum in PBS; three times on 0.1% BSA in PBS; IgG(H1L) anti-mouse immunoglobulin–gold conjugate; and 0.01% gelatin in PBS.The grids were washed with PBS, fixed with 1% glutaraldehyde in PBS, washed

again with water, and then incubated with 1% methyl cellulose–0.3% uranylacetate, air dried, and examined with a Jeol 1010 electron microscope at 80 kV.

RESULTS

Selection of oligonucleotides for the detection of afa-relatedsequences in pathogenic E. coli. The first set of primers, afa1and afa2, used to detect afa sequences was based on the partialsequence of the afa-1 gene cluster (36). These oligonucleotidesflanked a 750-bp DNA segment overlapping the afaB and afaCgenes (Table 1). Comparison of the nucleotide sequences ofthe afa-3, afa-7, and afa-8 operons showed that these primersdid not detect all the afa-related gene clusters. Thus, based onthe alignment of the sequences of the afaC3, afaC7, and afaC8

TABLE 1. Primers used for PCR assays

Regionspecific for Primer name Sequence (59-39) Sequence deduced from

(GenBank accession no. or reference):Size of

product (bp)

afaBC afa1 GCTGGGCAGCAAACTGATAACTCTC afa-1 operon (36) 750afa2 CATCAAGCTGTTTGTTCGTCCGCCG

afaC afa-f CGGCTTTTCTGCTGAACTGGCAGGC afa-3, afa-7, afa-8 operons(X76688, AF72901, AF72900)

672

afa-r CCGTCAGCCCCCACGGCAGACCafaE1 afaE-fa TTAGACCGTACTGTTGTGTTACCCCC afaE1 gene (X69197) 394

afaE1-r CATCGCCCGTCGCAGAGCCCATafaE2 afaE-fa TTAGACCGTACTGTTGTGTTACCCCC afaE2 gene (X85782) 375

afaE2-r GTTTCCCAGTAGACTGGAATGAAGCafaE3b afaE-fa TTAGACCGTACTGTTGTGTTACCCCC afaE3 gene (X69102) 349

afaE3-r CCCTATTGTTGTCGCTGATCAGGAAGafaE5 afaE5-f TCAACTCACCCAGTAGCCCCAG afaE5 gene (X91748) 405

afaE5-r AGGAAGTGGTAGCACCGGTACGafaE7 afaE7-f GCTAAATCAACTGTTGATGTT afaE7 gene (AF72901) 618

afaE7-r GGACAATCCAAATGGCGAATTAafaE8 afaE8-f CTAACTTGCCATGCTGTGACAGTA afaE8 gene (AF72900) 302

afaE8-r TTATCCCCTGCGTAGTTGTGAATCdaaE afaE-fa TTAGACCGTACTGTTGTGTTACCCCC daaE gene (5) 338

daaE-r CGGCTAGTCATATATAGATTTGTCGC

a The afaE-f primer was based on a region upstream from the afaE gene (37) that is conserved in several afa gene clusters.b afaE3 PCR also detects the Dr adhesin-encoding gene (draA, recently renamed draE [8]), which is 99.4% identical to afaE3 (37).

TABLE 2. Distribution of afa operons among representative E. coli strains

Isolate(reference)

Clonedoperon Origina

afa PCR resultb afaE PCR subtypeb

afa1-afa2 afa-f–afa-r afaE1 afaE2 afaE3 afaE5 daaE afaE7 afaE8

HumanKS52 (32) afa-1 Pye 1 1 1 2 2 2 2 2 2A22c (30) afa-2 Cys 1 1 2 1 1 2 2 2 2A30 (30) afa-3 Cys 1 1 2 2 1 2 2 2 2AL851 (30) afa-5 D 1 1 2 2 2 1 2 2 2C1845 (5) daa D 1 1 2 2 2 2 1 2 2A2c (30) Cys 1 1 2 1 1 2 2 2 24006d (30) Cys 1 1 1 2 2 2 2 2 26584d (30) Cys 1 1 1 2 2 2 2 2 2

Animal (34)262 KH 89 afa-7 BEI 2 1 2 2 2 2 2 1 2239 KH 89 afa-8 BEI 2 1 2 2 2 2 2 2 117 Isolates BEI 2 1 2 2 2 2 2 2 13 Isolates PEI 2 1 2 2 2 2 2 2 1

a Pye, pyelonephritis; Cys, cystitis; D, diarrhea; BEI, bovine extraintestinal infection; PEI, porcine extraintestinal infection.b 1, positive; 2, negative.c Strain known to carry two afa gene clusters (30). This strain was identified as producing an adhesin designated AFA-II based on biochemical and antigenic

properties (30).d Strain initially identified as producing an adhesin designated AFA-I (30).

1740 LE BOUGUENEC ET AL. J. CLIN. MICROBIOL.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

genes, we selected a new set of primers (afa-f and afa-r) spe-cific for the afa family. These primers flanked a 672-bp DNAsegment internal to the afaC genes (Table 1). The specificity ofthe new afa oligonucleotide pair for afa gene clusters wasevaluated by testing representative strains. Strains KS52, A22,A30, AL851, 262 KH 89, and 239 KH 89, from which the afa-1,afa-2, afa-3, afa-5, afa-7, and afa-8 operons, respectively, havebeen cloned, showed positive amplification (Table 2). An am-plification product was also obtained from the diarrhea-asso-ciated C1845 strain, which carried the daa operon (Table 2).No amplification product was obtained for the E. coli K-12strain, HB101, used as a negative control. As for the afa1-afa2set of primers, the afa-f and afa-r oligonucleotides could beused in the multiplex PCR assay developed to detect in a singlestep the three common adhesin-encoding operons (pap, sfa,and afa) in uropathogenic E. coli (36). The distribution andsizes of the amplification products were as predicted (data notshown).

Detection of afa operons in clinical isolates. Operons of theafa family have been detected in E. coli isolates associated withhuman extraintestinal and intestinal infections. To validate thenew PCR approach for detecting afa-related sequences in clin-ical isolates, we investigated three collections of E. coli isolates(Table 3). This PCR assay was demonstrated to be sensitivebecause all the strains that previously gave positive results withthe afa1-afa2 pair and all but one of the afa-8-carrying strainstested gave positive results with this test. PCR investigationwith the afa-f–afa-r set identified a total of 27 positive pyelo-nephritis-associated E. coli strains. Only 12 of these strainswere positive with the afa1-afa2 pair of primers. Eleven of 115blood isolates were positive with the afa-f–afa-r set, eventhough for 8 of these isolates no amplification product wasobtained with the afa1-afa2 pair. Twenty-eight of the 88 diar-rheal isolates, positive with afa1-afa2 primers, tested positivewith the afa-f–afa-r pair. These results confirmed that afa oper-ons are present in E. coli strains associated with various dis-eases and indicated that the new PCR assay is more sensitivethan the original assay for the detection of afa-expressingstrains. This assay shows that the frequency of afa-positivestrains among pyelonephritis and blood isolates is much higherthan predicted with the afa1-afa2 set: 28 instead of 12.4 and 9.6instead of 2.6%, respectively. The frequencies of afa-positivestrains among diarrheal strains are similar (32%) whatever theset of primers.

Distribution of afaE subtypes in pathogenic E. coli isolates.The various afa operons carried by human and animal patho-genic E. coli were characterized by subtyping the afaE gene,using a PCR approach, as previously reported (47). Seven pairsof primers, each specific for an afaE subtype, were defined(Table 1). The specificity of each set of primers was evaluatedby testing representative strains (Table 2): (i) the strains fromwhich the afa-1, afa-2, afa-3, afa-5, afa-7, afa-8, and daa oper-ons were cloned and (ii) strains reported to produce adhesinspreviously designated AFA-I and AFA-II on the basis of theirbiochemical and antigenic properties (30).

The screening of human and animal isolates for the afaEsubtype indicated that the frequencies of the various afaEsubtypes differed depending on the pathotype of the isolate

FIG. 1. Light micrographs of semithin sections of human erythrocytes interacting with strains KS52 (A), A30 (B), and AL851 (C). Note thatthe aggregates resulting from the cross-linking of erythrocytes (arrowheads) with bacteria (arrows) producing AfaE-I (A) and AfaE-III (B) arelarger than those with AfaE-V-producing bacteria (C).

TABLE 3. Distribution of afa operons amonghuman clinical isolates

PCR assay

No. of positive isolates (total no. of isolates)

Pyelonephritis(97)

Sepsis(115)

Diarrhea(88)

afaafa1-afa2 12a 3a 28a

afa-f–afa-r 27b 11b 28

afaE subtypeafaE1 2 3 5afaE2 0 0 2afaE3 0 0 6afaE5 0 0 5daaE 1 0 1afaE7 0 0 0afaE8 15 9c 0afaE1 1 afaE5 1 0 1afaEX 8 0 8

a All strains were positive in the afa-f–afa-r PCR.b Strains negative in the afa1-afa2 PCR were all positive for afaE8.c One strain was negative in afa-f–afa-r PCR.



http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

(Tables 2 and 3). The afaE7 gene was extremely rare; the onlyafaE-7-positive strain was that from which the afa-7 gene clus-ter was cloned. The afaE8 subtype predominated in both ani-mal (95.4%) and human (75% in blood isolates and 55.6% inpyelonephritis strains) extraintestinal isolates. The afaE8 sub-type was not detected in any human diarrheal isolate. None ofthe animal and human afa-8-positive isolates tested positivewith the afa1-afa2 set or with any of the other afaE subtypesets. We identified afaE1-, afaE2-, afaE3-, afaE5-, and daaE-carrying strains only among human extraintestinal and intesti-nal isolates that tested positive in the afa1-afa2 PCR assay. TheafaE1 subtype was frequent, especially in extraintestinal strains(25%). In human diarrheal isolates, the afaE1, afaE3, andafaE5 subtypes were similarly represented (21.4%). Despitepositive detection with both the afa-f–afa-r and afa1-afa2 sets,about 29% of human pyelonephritis (8 of 27) and diarrheal (8of 28) isolates were not typable using the various afaE subtypePCR assays. The afaE subtype of these strains was designatedafaEX.

Receptor specificities of AfaE adhesins. Four afaE subtypes(afaE1, afaE3, draE, and daaE) expressed by strains positive inafa1-afa2 PCR encoded adhesins binding the SCR-3 domain ofhuman DAF (42). In contrast, adhesins produced by afa1-afa2PCR-negative strains, such as AfaE-VII and AfaE-VIII, didnot recognize human DAF molecules as receptors (33). Weinvestigated whether other AfaE subtypes (AfaE-II, AfaE-V,and AfaE-X) produced by strains positive in the afa1-afa2 PCRrecognized DAF as a receptor.

(i) Binding specificity of AfaE-V. Strains producing AfaE-Vhave an MRHA-negative phenotype. As an initial approach forevaluating the receptor specificity of AfaE-V, we compared theinteractions with human erythrocytes of MRHA-positivestrains producing AfaE-I and AfaE-III and that of an MRHA-negative AfaE-V-producing strain by light microscopy (Fig. 1).AfaE-I- and AfaE-III-producing strains adhered to erythro-cytes, causing extensive agglutination (Fig. 1A and B). TheAfaE-V-producing strain also bound to erythrocytes, suggest-ing that the cell receptor for the AfaE-V adhesin was presenton erythrocyte membranes (Fig. 1C). However, this straincaused a lower level of erythrocyte aggregation.

We determined the receptor specificity of the AfaE-V ad-hesin by using CHO cells transfected with the cDNA for hu-man DAF (Table 4). No binding of AfaE-V-producing HB101(pILL1147) to untransfected CHO cells was observed. More-over, HB101(pILL1147) adhered significantly more stronglyto transfected CHO cells than did HB101(pILL1114), whichdid not produce AfaE-V. The specific inhibition of this bindingby SCR-3 MAb clearly indicated that AfaE-V recognized theSCR-3 domain of DAF as a receptor.

(ii) Binding specificity of AfaE-II and AfaE-X adhesins.Inhibition of hemagglutination was used to test the specificityof the receptor for the AfaE-II and AfaE-X adhesins producedby HB101(pILL1019), three afaE2-expressing isolates, and fiveisolates carrying an afaEX gene. In all cases, MRHA was af-fected by the prior treatment of erythrocytes with SCR-3 MAb(Fig. 2). The other afaEX-expressing strains could not be

FIG. 2. Hemagglutination of erythrocytes by the AL657 strain producing an AfaE-X adhesin without (A) and with (B) prior treatment oferythrocytes with SCR-3 MAb. Bar, 0.5 mm.

TABLE 4. Binding properties of AfaE-V adhesin

Strain Presence of theafaE5 genea

Binding to CHO cellsb

Untransfected DAF cDNAtransfected

Pretreated withanti-SCR-3 MAb

Pretreated withanti-SCR-2 MAb

HB101(pILL1147) 1 1.02 6 0.2 14.3 6 0.8 1.82 6 0.17 14.2 6 1.09HB101(pILL1114) 2 1.52 6 0.48 1.47 6 0.12 NTc NT

a 1, present; 2, absent.b Each experiment was performed three times, and the binding values are expressed as the mean number of bacteria per CHO cell 6 standard deviation.c NT, not tested.



http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

tested due to the lack of MRHA phenotype or P adhesinproduction. Thus, the SCR-3 domain appears to be essentialfor AfaE-II and some AfaE-X attachment.

Ultrastructural analyses by transmission electron microscopy

of HeLa cells infected with AfaE-III- and AfaE-V-producingHB101 strains showed a dense accumulation of DAF mole-cules beneath adherent bacteria and in the microvillar exten-sions surrounding the bacteria (Fig. 3). Immunofluorescencestudies showed that DAF also aggregated on HeLa cells in-fected with HB101 strains expressing the afa-1, afa-2, and daaoperons or the 16 human isolates producing uncharacterizedAfaE-X adhesins (Fig. 4). No such aggregation was observedon HeLa cells infected with HB101(pILL1191), which pro-duces the AfaE-VII adhesin that does not recognize humanDAF as a receptor (data not shown).

DISCUSSION

The AFA adhesive sheath, encoded by the afa operons, isreported to be a virulence factor in E. coli strains that causeintestinal infections and UTIs in humans. Our recent descrip-tion of new members of the afa family of gene clusters, afa-7and afa-8, two operons from E. coli strains pathogenic in calves(33), strongly suggested that the prevalence and significance ofthese virulence factors has been underestimated. In this study,we developed a PCR approach, using a single set of primersdesigned such that the sequence of each of the members of theafa family of operons would be amplified, and validated it bytesting clinical isolates from patients with various diseases (in-testinal and extraintestinal infections). This new PCR assayappears to detect all afa-related sequences in human and an-imal strains. We observed that the frequencies of afa-positivestrains in pyelonephritis isolates and in blood isolates werehigher (twice and three times, respectively) than those ob-tained with the previously described PCR. Characterization ofthe AfaE adhesin subtype by specific PCR assay made it pos-sible to determine in both cases the increase in detection of theafa-8 operon.

Investigation of the AfaE subtypes showed that afaE1,afaE2, afaE3 (and draE, which is 99.4% identical to afaE3),afaE5, and daaE were found in both diarrhea and uropatho-genic human isolates, suggesting that, regardless of the afaEsubtype, strains expressing these operons may cause both in-testinal infections and UTIs. An AfaE-I-producing clone lack-ing other virulence factors has been reported to be the caus-ative agent of both diarrhea and cystitis (16). We found thatthe afaE1 subtype was one of the most frequent in isolatesfrom patients with pyelonephritis, sepsis, and diarrhea. In ad-dition, afaE3 and afaE5, two subtypes that have been reportedto predominate in cystitis isolates (47), together with afaE1,were also observed in this study to predominate in strainsassociated with diarrhea. In contrast, we did not detect the

FIG. 3. Electron micrographs of immunogold staining of uninfect-ed HeLa cells (A) and HeLa cells incubated with HB101(pILL1147)bacteria producing AfaE-V (B). DAF molecules were detected byincubation with anti-DAF antibodies followed by anti-mouse immu-noglobulin G antibodies conjugated to 10-nm-diameter gold particles.Bar, 0.5 mm.

FIG. 4. Immunofluorescence micrographs of uninfected HeLa cells (A) and HeLa cells incubated with HB101(pILL1101) (B),HB101(pILL1019) (C), or the clinical isolate 1548 (D) producing the AfaE-III, AfaE-II, and AfaEX adhesins, respectively. DAF molecules weredetected by incubation with anti-DAF antibodies followed by fluorescein-conjugated secondary antibodies. Bar, 1 mm.



http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

afaE7 subtype in human pathogenic strains. These data areconsistent with the lack of significance of this subtype sug-gested by studies with animal pathogenic strains (15, 33).

Previous studies have detected the afa-8 operon in E. colistrains causing neonatal septicemia and diarrhea in farm ani-mals, especially calves (15, 33), and have reported the presenceof afa-8-positive strains in human E. coli isolates, especially inhuman extraintestinal isolates producing cytotoxic necrotizingfactor 1 (CNF1) (15). Our results confirm the association ofafa-8 with human extraintestinal isolates. Our approach, usingtwo different PCR assays to detect the conserved AFA biogen-esis region and the adhesin-encoding gene, generated resultssuggesting that the entire afa-8 operon is present in all of thepositive strains. We demonstrated the presence of the afa-8operon in blood isolates from cancer patients with variousunderlying diseases and immune statuses and with and withouta possible urinary source for bacteremia. We found that afa-8was carried by 75% of the afa-positive bacteremia isolates. Inaddition, we report for the first time that afa-8 is also the mostprevalent afa operon in a well-documented collection of pye-lonephritis isolates. All these data strongly suggested that afa-8-positive bacteria are associated with severe human extraint-estinal infections. afa-positive strains are also associated withinfections of the lower urinary tract (10). The possible pres-ence of afa-8 in cystitis isolates should be evaluated.

Several virulence factors associated with extraintestinal iso-lates of E. coli were detected with similar frequencies in afa-8-positive strains isolated from patients with sepsis and pyelo-nephritis. We found that iutC (aerobactin)- and papC (Pfimbria)-positive strains occurred at high frequencies (70.8 and58%, respectively) (data not shown). Some afa-8-positivestrains were also found to carry sfa or foc (S and FIC fimbriae),hlyA (hemolysin), and cnf1 (CNF1 toxin) sequences. More-over, 54% of the afa-8-positive strains carried two to five ofthese virulence factors (data not shown), indicating that thesestrains are true extraintestinal pathogens. However, three py-elonephritis isolates (12.5%) were positive for only afa-8. Intwo of these strains, afa-8 was reported to be carried by agenetic element similar to PAI IAL862, the afa-8-carryingpathogenicity island of the human blood isolate AL862 (34).These data strongly suggested that these two strains are patho-genic and that afa-8 itself may be a key factor in pathogenesis.This idea is supported by a recent study that reported thepresence of bmaE (encoding an M agglutinin very similar toAfaE-VIII [33, 46]) in urosepsis isolates of E. coli lacking otherextraintestinal virulence factors (27). E. coli isolated from thefeces of healthy volunteers is rarely positive for the presence ofafa-8 sequences (data not shown). The normal niche for theextraintestinal pathogenic E. coli is the colonic microflora,from which it may spread and cause UTI or septicemia. Wedetected four afa-8-positive strains among 46 isolates fromhealthy people (data not shown). At least three of these strainscould be considered extraintestinal pathogenic E. coli. Theycarried a genetic element similar to PAI IAL862 and were pos-itive for the presence of sequences encoding virulence factors(aerobactin and P fimbriae) associated with uropathogenicstrains (data not shown). Interestingly, afa-8 was not detectedin human isolates associated with diarrhea, consistent with thepreviously reported properties of AfaE-VIII, which binds tourothelial cell lines but does not bind to intestinal cell lines

(33). It seems likely that afa-8 is involved exclusively in thedevelopment of extraintestinal infections in humans and ani-mals. The afa-8 operon encodes AfaE-VIII adhesin and AfaD-VIII protein, which belongs to the AfaD family of invasins (11,33). The characterization of adhesin and invasin receptorsshould provide important information about the role of thisvirulence factor in the pathogenic processes involved in thedevelopment of such infections.

Afa/Dr1 adhesins, encoded by the afaE1, afaE3, draE, anddaaE genes, and Afa/Dr2 adhesins, encoded by the afaE7 andafaE8 genes, have been described (33, 43). The Afa/Dr1 ad-hesins bind to human DAF, and this attachment results in adense local accumulation of DAF molecules readily detectableon HeLa and Caco-2 cells by immunofluorescence (22, 24; M.Jouve, M.-I. Garcia, P. Courcoux, S. Bouzari, A. Labigne, P.Gounon, and C. Le Bouguenec, Abstr. 98th Gen. Meet. Ave.Soc. Microbiol., abstr. B-304, 1998). Here, we demonstrate thatthe afaE2, afaE5, and afaEX subtypes encode adhesins thatalso recognize DAF, suggesting that all these adhesins, whichdo or do not mediate MRHA, belong to the Afa/Dr1 family.We screened all the afa-positive clones with the fluorescentDAF staining test and showed a correlation between the ac-cumulation of DAF at the bacterium-HeLa cell interaction siteand positive results in the PCR assay based on the afa1 andafa2 primers. Thus, the two afa PCR assays described herecould be used for different purposes. The afa-f–afa-r primersdetect all afa strains, irrespective of the afaE subtype and thebinding properties of the adhesins (Afa/Dr1 and Afa/Dr2). Incontrast, the afa1-afa2 assay detects only strains encoding Afa/Dr1 adhesins.

The production of several AfaE adhesins by a single strainhas been reported (30). Our results suggest that the variousAfaE adhesins produced by a single strain have similar bindingproperties: we found strains that produced two different Afa/Dr1 adhesins among diarrhea and intestinal isolates, whereasno single strain simultaneously produced Afa/Dr1 and Afa/Dr2 adhesins. Similar mutual exclusion was observed betweensfa or foc operons and afa operons encoding Afa/Dr1 adhesins.We have no explanation for this yet. Further investigation ofthese points might increase our understanding of how and whythe genome of E. coli evolves to create new pathotypes and thelimits of the evolutionary process.

ACKNOWLEDGMENTS

We thank A. Labigne, in whose unit this work was carried out, forher continuing interest and helpful discussions. We also thank S.Moseley for the C1845 isolate and D. M. Lublin for the IH4 and 8D11MAbs against human DAF.

C. Le Bouguenec was supported by grant 1335 from the EuropeanCommunity program FAIR and a grant from the Programme de Re-cherche Fondamentale en Microbiologie et Maladies Infectieuses etParasitaires (PRFMMIP-MENRT). L. Lalioui received fellowshipsfrom the Marcel Merieux Fondation and the Fondation pour la Re-cherche Medicale. M. Jouve was a fellow of the Association Pour lesJournees de Biologie Clinique Institut Pasteur-CHU Necker EnfantsMalades.

REFERENCES

1. Archambaud, M., P. Courcoux, and A. Labigne-Roussel. 1988. Detection bymolecular hybridization of PAP, AFA, and SFA adherence systems in Esch-erichia coli strains associated with urinary and enteral infections. Ann. Inst.Pasteur/Microbiol. 139:575–588.

2. Arthur, M., C. E. Johnson, R. H. Rubin, R. D. Arbeit, C. Campanelli, C. Kim,



http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

S. Steinbach, M. Agarwal, R. Wilkinson, and R. Goldstein. 1989. Molecularepidemiology of adhesin and hemolysin virulence factors among uropatho-genic Escherichia coli. Infect. Immun. 57:303–313.

3. Bilge, S. S., J. M. Apostol, M. A. Aldape, and S. L. Moseley. 1993. mRNAprocessing independent of RNase III and RNase E in the expression of theF1845 fimbrial adhesin of Escherichia coli. Proc. Natl. Acad. Sci. USA 90:1455–1459.

4. Bilge, S. S., J. M. J. Apostol, K. J. Fullner, and S. L. Moseley. 1993.Transcriptional organization of the F1845 fimbrial adhesin determinant ofEscherichia coli. Mol. Microbiol. 7:993–1006.

5. Bilge, S. S., C. R. Clausen, W. Lau, and S. L. Moseley. 1989. Molecularcharacterization of a fimbrial adhesin, F1845, mediating diffuse adherence ofdiarrhea-associated Escherichia coli to HEp-2 cells. J. Bacteriol. 171:4281–4289.

6. Blanco, M., J. E. Blanco, M. P. Alonso, A. Mora, C. Balsalobre, F. Munoa,A. Juarez, and J. Blanco. 1997. Detection of pap, sfa, and afa adhesin-encodingoperons in uropathogenic Escherichia coli strains: relationship with expres-sion of adhesins and production of toxins. Res. Microbiol. 148:745–755.

7. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysisof the restriction and modification of DNA in Escherichia coli. J. Mol. Biol.41:459–472.

8. Carnoy, C., and S. L. Moseley. 1997. Mutational analysis of receptor bindingmediated by the Dr family of Escherichia coli adhesins. Mol. Microbiol.23:365–379.

9. Daigle, F., J. Harel, and J. M. Fairbrother. 1994. Expression and detectionof pap-, sfa-, and afa-encoded fimbrial adhesin systems among uropathogenicEscherichia coli. Can. J. Microbiol. 40:286–291.

10. Foxman, B., L. Zhang, P. Tallman, K. Palin, C. Rode, C. Bloch, B. Gillespie,and C. Marrs. 1995. Virulence characteristics of Escherichia coli causing firsturinary tract infection predict risk of second infection. J. Infect. Dis. 172:1536–1541.

11. Garcia, M.-I., M. Jouve, J. P. Nataro, P. Gounon, and C. Le Bouguenec.2000. Characterization of the AfaD-like family of invasins encoded by patho-genic Escherichia coli associated with intestinal and extra-intestinal infec-tions. FEBS Lett. 479:111–117.

12. Garcia, M. I., P. Gounon, P. Courcoux, A. Labigne, and C. Le Bouguenec.1996. The afimbrial adhesive sheath encoded by the afa-3 gene cluster ofpathogenic Escherichia coli is composed of two adhesins. Mol. Microbiol.19:683–693.

13. Garcia, M. I., A. Labigne, and C. Le Bouguenec. 1994. Nucleotide sequenceof the afimbrial-adhesin-encoding afa-3 gene cluster and its translocation viaflanking IS1 insertion sequences. J. Bacteriol. 176:7601–7613.

14. Garcia, M. I., and C. Le Bouguenec. 1996. Role of adhesion in pathogenicityof human uropathogenic and diarrhoeogenic Escherichia coli. Bull. Inst.Pasteur. 94:201–236.

15. Gerardin, J., L. Lalioui, E. Jacquemin, C. Le Bouguenec, and J. G. Mainil.2000. The afa-related gene cluster in necrotoxigenic and other Escherichiacoli from animals belongs to the afa-8 variant. Vet. Microbiol. 76:175–184.

16. Germani, Y., E. Begaud, P. Duval, and C. Le Bouguenec. 1997. An Esche-richia coli clone carrying the adhesin-encoding afa operon is involved in bothdiarrhoea and cystitis in twins. Trans. R. Soc. Trop. Med. Hyg. 91:573.

17. Germani, Y., E. Begaud, P. Duval, and C. Le Bouguenec. 1996. Prevalence ofenteropathogenic, enteroaggregative, and diffusely adherent Escherichia coliamong isolates from children with diarrhea in New Caledonia. J. Infect. Dis.174:1124–1126.

18. Germani, Y., M. Morillon, E. Begaud, H. Dubourdieu, R. Costa, and J.Thevenon. 1994. Two-year study of endemic enteric pathogens associatedwith acute diarrhea in New Caledonia. J. Clin. Microbiol. 32:1532–1536.

19. Giron, J. A., T. Jones, F. Millan-Velasco, E. Castro-Munoz, L. Zarate, J. Fry,G. Frankel, S. L. Moseley, B. Baudry, J. B. Kaper, G. K. Schoolnik, andL. W. Riley. 1991. Diffuse-adhering Escherichia coli (DAEC) as a putativecause of diarrhea in Mayan children in Mexico. J. Infect. Dis. 163:507–513.

20. Goluszko, P., S. L. Moseley, L. D. Truong, A. Kaul, J. R. Williford, R.Selvarangan, S. Nowicki, and B. Nowicki. 1997. Development of experimen-tal model of chronic pyelonephritis with Escherichia coli O75:K5:H bearingDr fimbriae. J. Clin. Investig. 99:1662–1672.

21. Goluszko, P., V. Popov, R. Selvarangan, S. Nowicki, T. Pham, and B. J.Nowicki. 1997. Dr fimbriae operon of uropathogenic Escherichia coli mediatemicrotubule-dependent invasion to the HeLa epithelial cell line. J. Infect.Dis. 176:158–167.

22. Goluszko, P., R. Selvarangan, V. Popov, T. Pham, J. W. Wen, and J. Singhal.1999. Decay-accelerating factor and cytoskeleton redistribution pattern inHeLa cells infected with recombinant Escherichia coli strains expressing Drfamily of adhesins. Infect. Immun. 67:3989–3997.

23. Gounon, P., M. Jouve, and C. Le Bouguenec. 2000. Immunocytochemistry ofthe AfaE adhesin and AfaD invasin produced by pathogenic Escherichia colistrains during interaction of the bacteria with HeLa cells by high-resolutionscanning electron microscopy. Microbes Infect. 2:359–365.

24. Guignot, J., I. Peiffer, M.-F. Bernet-Camard, D. M. Lublin, C. Carnoy, S. L.Moseley, and A. L. Servin. 2000. Recruitment of CD55 and CD66e brushborder-associated glycosylphosphatidylinositol-anchored proteins by mem-bers of the Afa/Dr diffusely adhering family of Escherichia coli that infect the

human polarized intestinal Caco-2/TC7 cells. Infect. Immun. 68:3554–3563.25. Hilali, F., R. Ruimy, P. Saulnier, C. Barnabe, C. Le Bouguenec, M. Tibay-

renc, and A. Andremont. 2000. Prevalence of virulence genes and clonality inEscherichia coli strains that cause bacteremia in cancer patients. Infect.Immun. 68:3983–3989.

26. Humbert, J., M. Jouve, C. Le Bouguenec, and P. Gounon. 2000. Electronmicroscopic improvement in the study of diarrheagenic Escherichia coli.Microsc. Res. Tech. 49:383–393.

27. Johnson, J. R., and A. L. Stell. 2000. Extended virulence genotypes ofEscherichia coli strains from patients with urosepsis in relation to phylogenyand host compromise. J. Infect. Dis. 181:261–272.

28. Jouve, M., M. I. Garcia, P. Courcoux, A. Labigne, P. Gounon, and C. LeBouguenec. 1997. Adhesion to and invasion of HeLa cells by pathogenicEscherichia coli carrying the afa-3 gene cluster are mediated by the AfaE andAfaD proteins, respectively. Infect. Immun. 65:4082–4089.

29. Labigne, A., V. Cussac, and P. Courcoux. 1991. Shuttle cloning and nucle-otide sequences of Helicobacter pylori genes responsible for urease activity. J.Bacteriol. 173:1920–1931.

30. Labigne-Roussel, A., and S. Falkow. 1988. Distribution and degree of het-erogeneity of the afimbrial-adhesin-encoding operon (afa) among uropatho-genic Escherichia coli isolates. Infect. Immun. 56:640–648.

31. Labigne-Roussel, A., M. A. Schmidt, W. Walz, and S. Falkow. 1985. Geneticorganization of the afimbrial adhesin operon and nucleotide sequence froma uropathogenic Escherichia coli gene encoding an afimbrial adhesin. J.Bacteriol. 162:1285–1292.

32. Labigne-Roussel, A. F., D. Lark, G. Schoolnik, and S. Falkow. 1984. Cloningand expression of an afimbrial adhesin (AFA-1) responsible for P bloodgroup-independent, mannose-resistant hemagglutination from a pyelone-phritic Escherichia coli strain. Infect. Immun. 46:251–259.

33. Lalioui, L., M. Jouve, P. Gounon, and C. Le Bouguenec. 1999. Molecularcloning and characterization of the afa-7 and afa-8 gene clusters encodingafimbrial adhesins in Escherichia coli strains associated with diarrhea orsepticemia in calves. Infect. Immun. 67:5048–5059.

34. Lalioui, L., and C. Le Bouguenec. 2001. afa-8 gene cluster is carried by apathogenicity island inserted into the tRNAPhe of human and bovine patho-genic Escherichia coli isolates. Infect. Immun. 69:937–948.

35. Le Bouguenec, C. 1999. Diarrhea-associated diffusely adherent Escherichiacoli. Clin. Microbiol. Rev. 12:180–181.

36. Le Bouguenec, C., M. Archambaud, and A. Labigne. 1992. Rapid and specificdetection of the pap, afa, and sfa adhesin-encoding operons in uropathogenicEscherichia coli strains by polymerase chain reaction. J. Clin. Microbiol.30:1189–1193.

37. Le Bouguenec, C., M. I. Garcia, V. Ouin, J. M. Desperrier, P. Gounon, andA. Labigne. 1993. Characterization of plasmid-borne afa-3 gene clustersencoding afimbrial adhesins expressed by Escherichia coli strains associatedwith intestinal or urinary tract infections. Infect. Immun. 61:5106–5114.

38. Levine, M. M., C. Ferreccio, V. Prado, M. Cayazzo, P. Abrego, J. Martinez,L. Maggi, M. M. Baldini, W. Martin, D. Maneval, B. Kay, L. Guers, H. Lior,S. S. Wasserman, and J. P. Nataro. 1993. Epidemiologic studies of Esche-richia coli diarrheal infections in a low socioeconomic level peri-urban com-munity in Santiago, Chile. Am. J. Epidemiol. 138:849–869.

39. Loomis, W. P., and S. L. Moseley. 1998. Translational control of mRNAprocessing in the F1845 fimbrial operon of Escherichia coli. Mol. Microbiol.30:843–853.

40. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a labo-ratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

41. Mulvey, M. A., Y. S. Lopez-Boado, C. L. Wilson, R. Roth, W. C. Parks,J. Heuser, and S. J. Hultgren. 1998. Induction and evasion of host defensesby type 1-piliated uropathogenic Escherichia coli. Science 282:1494–1497.

42. Nowicki, B., A. Hart, K. E. Coyne, D. M. Lublin, and S. Nowicki. 1993. Shortconsensus repeat-3 domain of recombinant decay-accelerating factor is rec-ognized by Escherichia coli recombinant Dr adhesin in a model of a cell-cellinteraction. J. Exp. Med. 178:2115–2121.

43. Nowicki, B., A. Labigne, S. Moseley, R. Hull, S. Hull, and J. Moulds. 1990.The Dr hemagglutinin, afimbrial adhesins AFA-I and AFA-III, and F1845fimbriae of uropathogenic and diarrhea-associated Escherichia coli belong toa family of hemagglutinins with Dr receptor recognition. Infect. Immun.58:279–281.

44. Nowicki, B., M. Martens, A. Hart, and S. Nowicki. 1994. Gestational age-dependent distribution of Escherichia coli fimbriae in pregnant patients withpyelonephritis. Ann. N.Y. Acad. Sci. 730:290–291.

45. Nowicki, B., C. Svanborg-Eden, R. Hull, and S. Hull. 1989. Molecular anal-ysis and epidemiology of the Dr hemagglutinin of uropathogenic Escherichiacoli. Infect. Immun. 57:446–451.

46. Rhen, M., V. Vaisanen-Rhen, M. Saraste, and T. K. Korhonen. 1986. Orga-nization of genes expressing the blood-group-M-specific hemagglutinin ofEscherichia coli: identification and nucleotide sequence of the M-agglutininsubunit gene. Gene 49:351–360.

47. Zhang, L., B. Foxman, P. Tallman, E. Cladera, C. Le Bouguenec, and C. F.Marrs. 1997. Distribution of drb genes coding for Dr binding adhesinsamong uropathogenic and fecal Escherichia coli isolates and identification ofnew subtypes. Infect. Immun. 65:2011–2018.



http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

characterization of afae adhesins produced by ... · texas 775553; and unite´ des maladies...

Documents