characterization of the gene for human plasminogen

8/6/2019 Characterization of the Gene for Human Plasminogen

1/8

THE JOURNAL OF BIOLOGICAL. CHEMLWRYCC, 990 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 265, No. 11, Issue of April 15, pp. 6104-6111, 1990Printed in CJ.S. A.

Characterization of the Gene for Human Plasminogen,a Key Proenzyme in the Fibrinolytic System*(Received for publicat ion, Novemb er 27, 1989)

Torben E. Petersen+, Mark R. MartzenQ , Akitada Icbinose, and Earl W. DavieFrom the Department of Biochemistry, University of Washington, Seattle, Washington 98195

The organizat ion and structure of the gene codingfor plasminogen has been determined by a combinat ionof in vit ro amplif ication of leukocyte DNA from nor-mal individuals and isolat ion of unique clones fromthree dif ferent human genomic l ibraries. These cloneswere characterized by restrict ion mapping, Southernblott ing, and DNA sequencing. The gene for humanplasminogen spanned about 52.5 ki lobases of DNA andconsisted of 19 exons separated by 18 introns. DNAsequence analysis revealed that the f ive kringle struc-tures in plasminogen were coded by two exons. Thenucleot ides in the introns at the intron-exon bounda-ries were G T-AG analogous to those found in othereukaryot ic genes. Three polyadenylat ion sites for plas-minogen mR NA were also ident ified. When the aminoacid sequences deduced from the genomic DNA andcDN As of plasminogen were compared with that of theplasma protein determined by amino acid sequenceanalysis, an apparent amino acid polymorphism wasobserved in several posit ions of the polypept ide chain.Nucleot ide sequence ana lysis of the amplif ied genomicDNA s and genomic clones a lso revealed that the plas-minogen gene was very closely related to several otherproteins , including apo lipoprotein(a). This protein ma yhave evolved via duplication and exon shuff l ing of theplasminogen gene. The presence of another plasmino-gen-related gene(s) in the human genomic l ibrary wasalso observed.

Plasminogen is a glycoprotein that circulates in plasma a sa proenzym e. I t is converted to plasmin by t issue plasminogenact ivator (tPA) in the presence of a f ibrin clot or urokinase(1). Plasmin then digests the insoluble f ibrin clot into solublefragments during t issue repair and recanalizat ion. The molec-ular weight of nat ive Glu-plasminogen is about 93,000, asest imated b y sodium dodecyl sulfate-polyacrylamide gel elec-trophoresis. Plasmin also converts Glu-plasminogen to Lys-

* This work was supported in part by Research Grant HL 1691 9from the Nationa l Institutes of Health. The costs of publicatio n ofthis article were defraved in part by the payment of page charges.This article must therefore be hereby marked aduertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submittedto the GenBank TMIEMBL Data Bunk with accession number(s)505286.$ Supported by Internationa l Research Fellowship 3 F05TW03433-OlSl from the John E. Fogarty Internationa l Center forAdvanced Study in the Health Sciences. Present address: Dept. ofMolecular Biology, University of Aarhus, C. F. Mollers Alle 130, DK-8000 Aarhus C, Denmark.

3 Supported by Nation al Research Service Award 5 F32 HL0781 6from the Nation al Institutes of Health.

1 The abbreviations used are: tPA, tissue-type plasmino gen acti-vator; kb, kilobase( bp, base pair(s).

plasminogen by releasing an NHz-terminal f ragment (A4,8,000) called a preact ivat ion pept ide (2). Lys-plasminogen ismore readily a ct ivated by plasminogen act ivators and bindsto f ibrin with greater aff inity than nat ive G lu-plasminogen(3,4).The primary structure of human plasminogen (791 aminoacids) has been established by amino acid sequence analysis(5-7) and cDN A cloning (8,9). I t is a single-chain glycoproteinconsist ing of a preact ivat ion pept ide (77 amino acid residues),f ive tandem structures called kringle domains (about 90residues each), an act ivat ion cleavage site (between Arg-561and Val-562), and a catalyt ic domain including the serineprotease tr iad of His-603, Asp-646, and Ser-741. The kringlestructures are also found in a number of other proteins, suchas tPA, urokinase, factor XII , prothrombin, and apolipopro-tein(a). The last protein is highly homologous with plasmin-ogen and contains up to 37 tandem repeats of plasminogenkringle 4 (10, 11). The f irst kringle in plasminogen (12, 13)and the second kringle in tPA (14, 15) funct ion as a bindingsite for f ibrin. The funct ion of the kringles in the otherproteins has not been established.

Since several cases of plasminogen abnormalit ies and def i-ciencies have been ident ified in associat ion with thrombosis(16), i t was important to determine the structure and organi-zat ion of the normal gene in order to compare it with abnormalgenes. Knowledge regarding the gene for plasminogen couldalso provide some insight as to i ts regulation as well a s i tsevolut ion in relation to other closely related genes, such asthe gene coding for apolipoprotein(a).

In previous studies, cDN As (8, 9, 17) and several genomicclones (8, 17) coding for plasminogen were isolated and thesequence of the DNA coding for a port ion of kringle 4 in thehuman gene was reported (8). In the present studies, thesequence o f the 5- and 3-f lanking regions, the exons, andthe intron-exon boundaries of the ent ire gene coding forhuman plasminogen are presented and compared with severalclosely related proteins.

EXPERIMENTAL PROCEDURESRestriction endonucleases, nuclease Bal-31, and T4 DNA ligase

were purchased from Bethesda Research Laboratories or New Eng-land Biolabs. T7 DNA polymerase and sequencing kits were pur-chased from the United States Biochem ical Corp. The Kleno w frag-ment of Escherichia coli DNA polymerase, bacterial alkaline phos-phatase, ATP, deoxynucleotides, dideoxynucleotides, M13m p18,-Ml3mp i9, pUC18, and pUC19 were supplied by Bethesda ResearchLaboratories. P-Labeled nucleotides were obtained from Du Pont-New Engla nd Nuclear, and [(u-S]dATP was provided by AmershamCorn. Two human nenomic libraries cloned into Charon 4A (18) andEMbL 3 (19) were kindly provided by Drs. Tom Maniatis and Shin jiYoshitake, respectively. Addit ional human leukocyte and lung fibro-blast genomic libraries were obtaine d from Clontech and Stratagene,respectively.

Oligonucleotide s were synthesized using a nucleotide synthesizer(Applie d Biosystems Inc.) and kindly provided by Dr. Patrick S. H.

6104

atINSTITUTEOFMICROBIALTECHNOLOGYLIBRARY:(CSIR),onJuly27,2011

www.jbc.org

Downloadedfrom
http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/


2/8

Organization of the Gene fo r Human Plasminogen 6105Chou, Dr. Yim Foon Lee, and Jeff Harris, University of Washington.Genomic clones containing the gene for human plasm inogen wereobtained by screening human genomic libraries by the in situ hybrid-ization technique using a partial cDNA or the 5 and 3 portions ofthe cDNA coding for human plasminog en. Two cDNAs of 1.9 kb (8)and 2.7 kb (17) were principally employed. The 2.7-kb cDNA wasisolated from a normal liver cDNA library and started with nucleotide

FIG. 1. EcoRI restriction map and location of the exons inthe gene for human plasminog en. The 19 exons are shown withwide vertical bars and are numbered with Roman numerals, while the14 EcoRI restriction sites are shown with narrow uertical bars. Thesix overlapping X phage clones with DNA inserts coding for plasmin-ogen are also shown. The 5 and 3 portions of the gene (14.5 and 3.5kb, respectively) were amplif ied by the polymerase chain reaction,and these fragments are listed as PCR 1-13 for the 5 end and PCR14-16 for the 3 end of the gene.

100 (Fig. 2). It contained the same 3 end as the 1.9-kb cDNA. Athird cDNA of 3.4 kb was also employed. It was isolated from ahuman Hep G2 cDNA library and extended beyond the stop codonin the smaller cDNAs by 750 nucleotides. This 3.4-kb cDN A resultedfrom the utilization of an alternative polyadenylation site. The HepG2 cDNA library was kindly provided by Dr. Fred Hagen, Zymo-Genetics, Inc., Seattle, WA. To obtain genom ic clones containingcertain exons, appropriate restriction fragments from the cDNA orsynthetic oligonucleotid es were used for further screening or foridentification of isolated clones by Southern blot analysis.

Phage DNA was prepared by the liquid culture lysis method (20),followed by centrifugation and banding on a cesium chloride stepgradient (21). Genomic DNA inserts were isolated by digestion of thephage DNA with EcoRI or Sal1 and EcoRI endonuclease followed bysubcloning into plasmid pUC18 or pUC19. A dditio nal restrictionfragments from the inserts were also subcloned into M13mp 18 orM13m p19 to obtain overlapping sequences. The genomic DNA insertswere sequenced by the dideoxy method (22) employin g [(u-S]dATPand buffer grad ient gels (23). The DNA sequence was determined twoor more times, and approximately 90% of the sequence was carriedout on both strands. Sequence data were obtained by employin g atleast two overlapping independ ent fragments. Digestions with nu-clease Bal-31 were also performed to generate DNA fragments thatprovided overlap ping sequences with restriction fragments (24). Oli-gonucleotides were synthesized as sequencing primers to obtain DNAsequence of the second strand for several regions in the gene.

The 5 and 3 portions of the gene for plasmino gen were alsoestablished by in vitro amplifica tion employing the polymerase chainreaction (25). Genomic DNA samples were prepared from the leuko-cytes of normal individuals by standard techniques (26). One to fivepg of genomic DNA was ampli fied in a lOO-~1 reaction mixturecontaining 50 mM KCl, 10 mM Tris-HCl (pH 8.4), 2.5 mM MgC12,two oligonuc leotide primers each at l-10 P M, the four deoxynucleotidetriphosphates each at 200 pM, gelatin at 200 pg/ml, and 2.5-5.0 unitsof Taq DNA polymerase obtained from New Englan d Biolabs orPerkin-Elmer-Cetus. Each sample was placed in a small Eppendorftube and overlaid with 75 ~1 of mineral oil to prevent evaporation.

TABLE INucleotide sequences of the primers employed for amplifica tion of the gene coding for plasminog en

PC Rfraanent Size

123456789

10111213141516

kb1.23.22.43.81.11.62.22.24.43.32.22.72.31.81.83.5

5 GATCGAATTCCGCAGACATTCCACC3 CACAGAATTCCATGGCATATGTATTTTTACTAC5 CTGCGAATTCTGGCAACCACTAATCTAC3 GGGTATTCACATAGTCATCCAGAGGCTCTCC5 GATGAAGCTTGTAGTTTTATTTGAAAAGAAAGGT3 ATTAAAGCTTGTCGAGATATGGTCCACTTCAA5 TGTAAGCTTCAGAGTGCAAGACTGGGAATGGAAAG3 TTGGAAGGAATGTATCCATGAGCGTGTGGG5 GGGACCCACTTTCTGGGCACTGCTGGCC3 CCATAAGCTTGTATGCCTAAATGGGTGAATTC5 AAGCAGCTGGGAGCAGGAAGTAT3 TTTTCAAATAAAACTACATCTCTCATC5 ATTAAAGCTTACAAGTAGCAAGCAAACGGT3 GTAAAGCTTTCCATTCCCAGTCTTGCACTCTGA5 ATTTGAATTCATCCATTTCAGTTTTCTTCTTC3 TGTAAGCTTTTGATTTCAAGAACAGGGC5 GGGACCCACTTTCTGGGCACTGCTGGCC3 GGGTATTCACATAGTCATCCAGAGGCTCTCC5 GATGAAGCTTGTAGTTTTATTTGAAAAGAAAGGT3 GTAAAGCTTTCCATTCCCAGTCTTGCACTCTGA5 CATCGAATTCTGCCTTGCTAATAGCAAGC3 TTTACATGTGTAAAAATCACTCAACAGAAT5 TAGTAAGCTTCTTTATTTATGTCCAAATGCCCG3 TATTAAGCTTACCGTTTGCTTGCTACTTGTAA5 TGTAAGCTTCAGAGTGCAAGACTGGGAATGGAAAG3 ACACTCAAGAATGTCGCAGTAGTCATATCTC5 GGTAGTCAAGAGGAGCTTCCTCCCTGCAGC3 ACAGAGTTCGGTGGATTGGACTCTTCCATTCAG5 GGAAGAGTCCAATCCACCGAACT3 CACAGTCACTTGCAGTTTTGCTTTTCTCTG5 GGTAGTCAAGAGGAGCTTCCTCCCTGCAGC3 CACAGTCACTTGCAGTTTTGCTTTTCTCTG

atINSTITUTEOFMICROBIALTEC

HNOLOGYLIBRARY:(CSIR),onJuly27

,2011

www.jbc.org

Downloadedfrom


3/8

6106 Organization of the Gene for Human Plasminogen

FIG. 2. Nucleotide sequence of the5- and 3-flanking regions, the ex-ons, and the intronjexon boundariesfor the gene coding for human plas-minoge n. The DNA sequence upstreamfrom the cytosine listed as nucleotide 1is shown in the left margin with negativenumbers. The amino acids in the signalsequence are also shown with n egativenumbers, while those in the mature pro-tein are shown with positive numbers inthe left margin. The amino acid sequencepredicted by the coding region of eachexon is indicated above the correspond-ing DNA sequence employing the one-letter amino acid code. CCAAT boxesand TATAA sequences are underlined,as well as the 3.noncoding region withsequences that are apparently involvedin mRNA processing. The 5 and 3 endsof each exon are enclosed in brackets.The sites of polyadenylation at the 3end of the gene are shown with a diagonalslash. The sequences used for the prep-aration of amplifying primers are under-l ined or ouerlined and begin with an as-terisk. The solid vertical arrows indicatethe cleavage site for the signal peptideand the cleavage site for the conversionof plasminogen to plasmin.



,2011

www.jbc.org

Downloadedfrom


4/8

FIG. 2. -continued

The samples were then subjected to 25 or 30 cycles of amplific ationby heating at 94 C for 1 min to denature the DNA, cooling to 60-70 C for 2 min to annea l the primers, and incubating at 72 C for 3min to extend the annea led primers. At the end of the last cycle, th esamples were incubated at 72 C for 7 min to ensure the completionof the final extension step. After precipitation with ethano l andresuspension in 100 ~1 of 10 mM Tris-HCI and 1 mM EDTA buffer(pH 7.5), a 5- or lo-p1 aliquo t was app lied to a 0.8 or 1.5% agarose(IBI) gel containing 0.5 rg/ml of ethidium bromide in 89 mM Trisbase, 89 m M boric acid, and 20 m M EDTA buffer (pH 7.8).

A human leukocyte library (18) and a lung fibroblast library(Stratagene) were also screened employ ing the appropriate 5 or 3region of the cDNA (8, 17) to obtain genomic clones conta ining the5 or 3 portion of the gene coding for plasmino gen, as describedabove. To select the correct genomic clones coding for plasmin ogenand to exclude those for a plasminoge n-related gene(s), the isolatedphage clones were first amp lified by the polymerase chain reaction,as described. Several portions of the ampl ified phage DNA were thensubjected to DNA sequ ence analysis. The phage clones that wereshown to contain the nucleotide sequences coding for exons thatmatched the corresponding regions of the cDNAs for plasmin ogenwere employed for further analysis.

DNA sequences were analyzed by the Genepro program (Version4.1, Riverside Scientific Enterprises. Seattle, WA) employin g a Tandy3000 computer.

RESULTS AND DISCUSSIONThe Middle Port ion of the Gene for Plusminogen-Three

clones (Xl, X2, X3) containing the gene for human plasminogenwere initially isolated from approximately 2 x lo6 phage ofthe AU/Hoe111 genomic l ibrary of Lawn et al. (18) using thecDNA o f 1.9 kb as a probe (Fig. 1) (8). These three cloneswere found to be unique by restriction enzyme digest ion andSouthern blott ing analysis. DNA sequence analysis revealedthat these genomic clones contained the middle port ion of thegene for plasminogen extending from exons VII to XVII (Fig.1). This corresponded to the central part of the cDNA codingfor the polypeptid e chain of plasmin ogen extending from thesecond half of kringle 2 (Lys-204) to the midd le portion ofthe catalytic chain (Gly-690).

Since these three clones did not contain the 5 and 3port ions of the gene, appropriate restriction fragments fromthe cDNA of 1.9 kb (8) or 2.7 kb (17) and synthet ic ol igonu-cleot ides w ere used for further screening and isolation ofaddit ional clones for ident ificat ion by Southern blot analysis.Two more clones obtained from the human f ibroblast l ibrary(19) and human leukocyte l ibrary contained nucleot ide se-

atINSTITUTEOFMICROBIALTE

CHNOLOGYLIBRARY:(CSIR),onJuly2

7,2011

www.jbc.org

Downloadedfrom


5/8

6108 Organization of the Gene fo r Human PlasminogenK2 S G L E : Q R U D S Q , cc~T?Q~usa- K3

FIG. 3. Amin o acid sequence forhuman plasminogen and the loca-tion of the 18 introns in the genecoding for plasminog en. The posi-t ions of the introns (A-R) are indicatedby solid arrows at or between specif icamino acids. The amino acid residuesare numbered start ing with the amino-terminal glutamic acid residue as num-ber 1 and ending with residue 791 . Thesignal pept ide (shown in a box with neg-ative numbers) contains 19 amino acidsand is cleaved by signal pept idase at theGly-Glu peptide bond. The preactivationpeptide (PAP) is generated primarily bythe cleavage between Lys-77 and Lys-78(shown with an open straight arrow) byplasmin. The conversion of plasminogento plasmin occurs by the cleavage be-tween Arg-561 and Val-562 (shown byan open curued arrow). Kl-K5 refer tokringles l-5 in the A chain, wh ile theact ive site His, Asp, and Ser residues inthe B chain are circled. Carbohydrateattachment sites (Asn-289, Thr-346) areshown by diamonds.

c c-c L L. ~.'1 i,;42iTp

c-c*I. ECE PP~~~~TV

a D t 29 8c--c: y D

SP STEQ L RPTT DPEKRY

TKCE s A chain T .3 4 6 YG 3 4 7 * R C- LNK

P 0 sTK~~r r .~~ K

PEL T ,u ~ _- ~~.FuL

PAP +sK ;:4 3 & :

E EF~CA Q , nAEN

D~Eh 3 ;~E,SIGNAL sj - y - 1 9 :G

FSUTKKqLLS R

GQTN

-3 + + t v

K E p a G G

ctCFHGG

T:

,s

lainnG

F 5 8 2f+RkUQ UPUS

G R,G Pc-cA t:H P

:F

,ER

s

I L L p p p R E

GP

NGK~ RGK ,,,Tf5

bE;fc$T

DyLKRPNTTv FY

- ;Q P G y C--cKN vchc * L. ,: :

DOD UC sTRK~IRLLKLS~PflUITGK lp~ ;

69 0 +LL G RG FTG Q TEG UG T,FCETRG AUUYNPSP LI

,,

8NO R G p L AFEKG K ,L

0 QE , m 7 4 1 c

(Ik

pN T ~ ~ ~ ~ ~ ~ ~ RHPE

quences that apparent ly corresponded to the 5 and 3 regionsof the cDN As. Preliminary sequence analysis of these clonesindicated, however, that they originated from a plasminogen-related gene(s), since there were a number of nucleot idechanges and in-frame stop codons in the apparent exons fromboth the 5 and 3 regions when their sequences were com-pared with the plasminogen cDNA sequence (8,9, 17).

The 5 and 3 Portions of the Gene for Plasminogen-Toobtain the correc t 5 and 3 portions of the gene coding forplasminogen, leukocyte DNA from normal individuals wasamplif ied by the polymerase chain react ion employing ol igo-nucleot ide primers (Table I). The sequence of these primerswas matched to the appropriate regions of the cDNA (8, 9,17). Primers were also prepared from the 5 and 3 ends ofthe exist ing clones (X1-X3). In addit ion, the genomic se-quenc es of the plasminoge n-related gene(s) were utilized todesign primers for the amp lification of the 5- and 3-flankingregions. Altogether, 13 overlapping DNA fragments were pre-pared from the 5 end (PCR 1-13) and three fragments fromthe 3 end (PCR 14-16) of the gene by the polymerase chainreact ion (Fig. 1). These fragments covered approximately 14.5and 3.5 kb of genomic DNA from the 5 and 3 port ions ofthe gene, respect ively (Fig. 1). DNA sequence analysis ofthese fragments revealed that the 5 port ion contained thegenomic sequence coding from the signal pept ide to the f irsthalf of kringle 2 (including exon s I-VI), and the 3 portioncoding for exons XVIII and XIX. Two addit ional X phageclones (h4 and X5) were then isolated by rescreening of thegenomic l ibrary of Lawn et al. (18) using the 5 portion of thecDN A as a probe, and one more clone (X6) was obtained byscreening a human lung fibroblast library using the 3 end ofthe cDNA (Fig. 1). The restriction digest ion and mapping ofthe genomic inserts in these clones with endonuclease EcoR Iwas consistent with that obtained by the amplif ied DNA bythe polymerase chain react ion. DNA sequence analysis alsoconf irmed that the nucleot ide sequences of these genomicclones were ident ical with those obtained from the amplif iedDNA generated by the polymerase chain react ion.

LP G L G U S T U 79 1RPNKPGUYURUSRFUTUIEGUMRNN~

Nucleot ide Sequences of the Exons and Intron-Exon Bound-aries--The DNA sequence of 7853 nucleot ides coding forhuman plasminogen and the f lanking regions of the gene isshown in Fig. 2. This sequence extended about 960 base pairsupstream from the cytosine which was arbitrari ly labeled asnucleot ide 1. Comparison of the DNA sequence o f the genewith the cDN A sequence (8, 9, 17) indicated that the geneconsisted of 19 exons (I-XIX) interrupted by 18 introns (A-R) (Fig. 3). The f irst exon contained the 5-noncoding regionand coded for a typical signal pe ptide including a hydropho biccore. The sequence of al l the intron-exon splice junct ions(Table I I ) agreed with the GT-AG rule of Breathnach et al.(27) and with the consensus sequence of Mount (28). Eight ofthe splice junct ions were type I ( introns A, C, E, G, I , K, M,and Q), eight were type I I ( introns B, D, F, H, J, N, 0, andP), and two were type 0 (introns L and R) (29). The e xonsvaried in size ranging from 75 to 387 nucleot ides. Exon XIXwas the largest of the 19 exons and included the coding regionfor the act ive site Ser, the COOH terminus of the protein andthe 3-noncoding region of the gene. The average size of the19 exons was 146 bp, which is similar to the average size of150 bp found in other eukaryot ic genes (30). The overlappingclones spanned about 52.5 kb. Thus, the gene for plasminogenis the largest of the known serine proteases involved in bloodcoagulation and fibrinolysis (31).

Nucleot ide Sequences of the 5- and 3-Flanking Region s-The DNA sequence analysis revealed that the 5-flankingregion of the gene for plasminogen contained two clusters ofregulatory elem ents for transcription (32), including forwardand reverse CCAAT boxes and TATAA sequences (Fig.2). At present, i t is not known whether or not either of thesesequences funct ions as a promoter element. Two sequenceelements of CTGGG A commo n to acute-phase reactant genes(33, 34) were found in the 5-flanking region of the gene forplasminogen. Howeve r, no GC boxes were present.

Seque nces in the 3-flanking region are also though t to playa role in polyadenylation and mRN A processing. A potent ialCAYTG signal (35) was ident if ied 13 bp downstream from



,2011

www.jbc.org

Downloadedfrom


6/8

Organization of the Gene fo r Human Plasminogen 6109TABLE II

Nucleotide sequence at the splice junctions and size of exonsInterrupted codons by introns are underlined . The exact size of exon I (shown in parentheses) is not known.

PAP l, amino-term inal half of the preactivation peptide; PAP S, carboxyl-terminal half of the preactivation peptide;Kla-K5a, amino-term inal half of the kringle; Klb-K5b, carboxyl-terminal half of the kringle; Act, activationcleavage site; Cnt, connecting region to the A chain; Loop, disu lfide loop prior to the active-site serine.

Size EXOII Boundary sequence Intron Boundary sequence EXOl l Junctiontype

5-NoncodingPAP1PAP2Kl aKl bK2 aK2 bK3 aK3 bK4 aK4 bK5 aK5 bActHisAspCntLoopSer + 3-noncoding

bp(169) I136 II107 III

115 IV140 V121 VI119 VII163 VIII146 IX160 X182 XI149 XII94 XIII121 XIV75 xv141 XVI107 XVII146 XVIII387 XIX

Consensus*

. CTGAAATCAG GTAAGA . . . A ..TCACCTGCAcGTATTT... B .

.GAAA AGAA ? GTGAGT. . . C ..ACAGACCTACGTAAGA... 0 .

.GAGTGTGAA?GTCAGG... E .

.TTCCTTCCAiiGTAAGT... F .

.CCCCGCTG cGTGAGT... G .

.TTCCCTGCAiiGTAAGT... H .

.GCTCCCAC=GTAAGC... I .

.ACCCAAATGeGTATG T... J .. TCCGAAGAA? GTAAGA . . K ..GGAAAAAAATGTAAGC... L .

.CCTCAGTGTGGTAGGT... M .

.TTAGAACA AG GTAAGA. . . N .

. GCTTGGAGG GTATGT . . . 0 ..AGCTAAGCzGTACTC....GAAACCC A.i.iGTGAGA... ; :.CAGTTGCCAGGTAAGC... R .

C AAAG GTGAGT -

.CTCTAGGTCM&GAGA..

.CTGCAG?%CATTCCAA..

.CTTCAGTGTATCTCTC..

.CCCCAGATTCTCACCT..

.GTCCAGxGGAATGTAT..

.ATTCAGATTTCCAAAC..

.TTCAAGCAACACCTCC...TTTCAG-AAATTTGGAT..

.TTTCAGCACCACCTGA..

.TTCCAG%CCTGACA..

.GTACAGACTGTATGTT..

.TTTCAG%TGCCGTA..

.CCACAGCGGCCCCTTC..

.TTCCAGETTGGAATG..

.TTCTAGGTCCCCAAGG..

.TTTCAG?;CCTGCCGTC..

.ACACAGGTACTTTTGG...GTATAGETGACAGTG..

TT T- CCNCAG GT

II IIII 11IV IV IIVI I

VII IIVIII IIX II

x III4 I

XIII 0XI V

xv 1:XVI II

XVII IIXVIII I

XIX 0

Sharp (29).*Mount (28).

PlasminogenSignal P*P ~r,n~le I Krlngle 2 Krlngle 3 Krlngl-3 Krlngle 5

tP A signal Type I EGF Krlngls 1 Krlngle 2: p. .-. . . I . * . .* . . . .: . 2 : t -2 : * . . . -.* : * . . . .** . . . -. : .* g. . . 2.2.. i :: : .* .* f . : : : . :4. . . . . , : .,.+. . 2. : c, f-f

: . =. :=..* -.A-*=t . . -. . . . . . : Kp .(-&qt tUP A

SIgnal EGF Kringle

Prothrombin Signal Gla Kringle 1 Kringle 2. .-T:*.:

: t ..y::*...*. : :\*,'.. 1.. '. '-' .:;:: ; : : -;: : : : :'-...* . :'-v.

.a. f . .*.... - '...+T**. .*'.$.....:A .t . . . . . . . . .:.:...@q3 tt tFactor XII : signa, Type II EGF 1 Type I EGF 2 Kri ngle

FIG. 4. Location of the introns in the genes for five kringle-containing proteins. Soli d arrows indicate the location of the in-trons in plasminog en, tPA (tissue-type plasminog en activator), uro-kinase-type plasmino gen activator (&A), prothrombin, and factorXII. Data are taken from the followin g references: tPA (37), uroki-nase-type plasmino gen activator (38), factor XII (39), and prothrom-bin (40). PAP , preactivation peptide; EGF, epiderm al growth factor;Gla, y-carboxyglutamic acid.

the conserved AATAAA sequence. This sequence was ident i-cal to the consensus sequence in four of the f ive nucleot ideposit ions. An alternative polyadenylation site for the cDNAreported by Forsgren et al. (9) was found 31 nucleot idesdownstream from the f irst polyadenylation site. Potent ialCAYTG signals for this cDNA were found two nucleot idesupstream and ten nucleot ides downstream from the secondpolyadeny lation site. The third polyaden ylation site for thecDNA obtained from a human Hep G2 l ibrary that containedan extra 750 nucleot ides of 3-noncoding DNA was alsoidentified in the gene. A potential CAY TG signal for thiscDNA was present 26 bp downstream from the alternativepoly(A) site. A consensus sequence of YGTG TTYY, which isrequired for eff ic ient formation of the 3 terminus of mRN A(36), was not present w ithin 50 nucleot ides downstream fromthe f irst AATAAA sequence. This consensus sequence, how-ever, was present 32 bp downstream from the AATAAAsequence for the third polyadenylation site.

Organization of the Gene for Plasminogen-Intron A waslocated between the nucleot ide sequence coding for the signalsequence and the f irst half of the preact ivation pept ide, whilethe second intron (intron B) in the gene for plasminogen waslocated in the middle of the preactiva tion peptide (Fig. 3).Each o f the f ive kringles was coded by two separate exonswith a single intron inserted in the middle of each structure.The splice junct ions of the introns within the kringles wereusually type I I , while the introns between the kringles weretype I (Table I I ). This was the same pattern as that found inother genes containing one or more kringle structures, includ-ing tPA, urokinas e, factor XII, and the first kringle in pro-thrombin (Fig. 4) (37-40). T hese results are consistent withthe concept that the kringle-containing proteins as well asother proteins with specif ic d omains have evolved in part bygene duplication and exon shuffling (41), and this shufflingoccurs primari ly at type I intron-exon splice junct ion bound-aries. The second kringle in prothrombin, however, was en-


HNOLOGYLIBRARY:(CSIR),onJuly27,2011

www.jb

c.org

Downloadedfrom


7/8

6110 Organization of the Gene for Human Plasminogen

FIG. 5. An alignm ent of portions of the gene for plasmino gen (PLG) and the cDNA for apolipopro-tein(a). Intron A, exons I I-IX, and intron I were inserted between serine a t position -4 and alanin e at position347 in the gene for plasminog en. The serine at position -4 and alanine at position -3 are adjacent to each otherin the cDNA for apolipoprotein(a) (10). An intron may be present between these 2 amino acid residues in the genefor apolipoprotein(a).

PlasminogenSig n a l PAP Kr in g le I K r in g le 2 Kr in g le 3 Kr in g le 4 Kr in g le 5

Apolipoprotein (a)Sig n a l Kr in g le 4 Kr in g le 5

.:

* . . * : I : : . * . . . , . . . .: t . .; . . . i: i * ; : : : ;

. t . *

I I

.

f. .. . : : . . &

f a * . .

. . . . . . . . . c t0

37 xp ..(-q

FIG. 6. Comparison of the structures for human plasmino-gen and apolipoprotein(a). Solid arrows indicate the location ofintrons in the gene coding for plasmino gen, and the open arrowsindicate those predicted in apolipoprotein(a) by homology in theamino acid and cDNA sequences of the two proteins. PAP , preacti-vation peptide.

TABLE IIIApparent polymorphisms of the amino acid residues in plasmino gen

as deduced from the genomic sequence an d cDNA sequence (8, 9, 17),as well as the peptide sequence (5-7)

Protein CDNA cDNA*(1.9 kb) (2.7 kb) cDNA Gene RFLPdE-53D-88N-91C-238V-272F-295 TTCE-342 CAA(Q)N-453 GAT(D)V-563 GTAG-743 GGT3 .NC45 GGAAC-

CANQ) CMQ) CANQ)AAT AAT AATAAC AAC AATTGT TGC TGC Mae11GTE GTT GTGTT C TTC TTT XmnICANQ) CAN&) CAN&)GAT(D) GAT(D) @T(N)GTA GTG GTAGGT GGT GG G AuaII-HaeII IGGAAC GGGAC GGGAC

3-NC49 CGAGG CGTGG CGTGG CGTGG From Malinowski et al. (8).b E. Mulvihi ll and M. Martzen, unpublished data. From Forsgren et al. (9).d Restrict ion fragment length polymorphism.

coded by a single exon (40), suggest ing that the internal intronin this kringle may have been lost during evolut ion. The geneorganization for the l ight chain of plasminogen was alsosimilar to that of other serine proteases, especial ly tPA,

urokinase, and factor XII (37-39), although the posit ions ofthe introns relat ive to the amino acid sequence were sl ight lydif ferent.The data show n in Fig. 2 are consistent with the conceptthat the gene described in the present study is the one thatexpresses plasminogen, since the nucleot ide sequence shownin Fig. 2 matches the cDNA prepared from human l iver ofHep G2 cells. Howe ver, other very closely related genes havebeen ident if ied during these studies and port ions have beensubjected to prel iminary DNA sequence analysis. One of therelated genes dif fered from the plasminogen cDN A in that i tcontained in-frame stop codons in the apparent exons, as wellas a number of nucleot ide subst itut ions, suggest ing that it isa pseudogene.

The gene coding for plasminogen is also closely related tothat of apolipoprotein(a), as previously discussed b y McLeanet al. (10) and Tomlinson et al . (11). Indeed, apolipoprotein(a)may have evolved via exon shuffl ing (41) and the delet ion ofexons I I-IX in the plasminogen gene, fol lowed by a recombi-nation even t that linked the signal pep tide precisely at intronA to kringle 4 precisely at intron I (Figs . 5 and 6). Alterna-t ively, exons II-IX in the plasminogen gene or port ions ofthis DNA may be present in the gene for apolipoprotein(a) asa large intron, and this intron seque nce is remo ved during theprocessing of the apolipoprotein(a) mR NA. Additional evo-lution o f the plasminog en gene would involve multiple dupli-cat ions of exons X and XI coding for plasminogen kringle 4generating up to 37 kringles presen t in apolipoprotein(a) aswell as a number of small insert ions and delet ions. An exoncoding for apolipoprotein(a) (or a very closely related gene)from the region that included the potent ial act ive site Aspresidue wa s also amplif ied by the polymerase chain react ionduring these studies and ident if ied by prel iminary sequenceanalysis. The intron/exon boundaries for this genomic DNAfragment were found to occur exact ly in the same posit ionsas those of exon XIV in the gene for plasminogen correspond-ing to amino acids 608 and 654 in the plasminogen polypept idechain. These results also support the conclusion that thekringle-containing proteins are a family o f proteins that haveevolved from one or more comm on ancestral genes. Thesegenes are al l apparent ly localized on chromosom e 6, bandq26-27, because the results obtained employing the part ofthe gene for plasminogen containing exon X or XIV (42), the3 end of the cDN A for apolipoprotein(a), and a cDNAfragm ent containing kringles l-3 of plasminog en (43) are inagreement. Results obtained from l inkage studies also supportthis conclusion (44, 45).

Apparent Polymorphism in the Gene for Plasminogen-Anumber of minor dif ferences were found w hen the DNAsequence of the gene for human plasminogen was comparedwith that of the cDN As isolated in dif ferent laboratories (8,



,2011

www.jb

c.org

Downloadedfrom


8/8

Organization of the Gene for Human Plasminogen 61119, 17) (Table I I I ). Five of the nucleot ide subst itut ions occur-ring in the coding region had no influence on the amino acidsequence, as was the ca se for two changes in the 3-noncodingregion located 45 and 49 bp downstream from the stop codonin the cDNA (9). Several dif ferences in the genomic DNAsequence and the cDN As did result , ho wever, in the subst i-tut ion of amino acids that are dif ferent from those determinedby amino acid sequence analysis of the plasma protein (TableII I ). In addit ion, I Ie-67 located in the second half of thepreact ivat ion pept ide region encoded by the three nucleot ides(CAA) in the genomic DNA sequence and the cDNA (9) wasnot ident ified by amino acid sequence analysis (5). Some ofthese dif ferences may be due to amino acid sequencing art i-facts. For instance, Glu and Gln (residues 53 and 342), andAsp and Asn (residue 88) some times were dif f icult to dif fer-ent iate when phenylthiohydantoin derivat ives were separatedby two-dimensional chromatography. Alternat ively, some ofthe differences, such as Asn-453, may be the result of poly-morphisms in the normal human po pulat ion, result ing inamino acid changes. Using the isoelectric focusing technique,several variant alleles for plasminog en have been reported indifferent populations (46-50). The subs titution of a chargedresidue, such as Asp-453 for the uncharged Asn residue (TableII I ), may contribute in part to the dif ferent ial electrophoreticmobil i ty of the gene products and to the heterogeneity ofplasminogen. This subst itut ion would be in addit ion to thewell known dif ferences in carbohydrate in plasminogen thatalso leads to changes in electrophoretic mobil i ty (51).

Some of the nucleot ide subst itut ions described above werealso conf irmed by restriction digest ion of amplif ied genomicDNA s from normal individuals showing that apparent poly-morphisms exist in the gene for plasminogen. A Mae11 site inexon VII (at Cys-238) and a XmnI site in exon VII I (at Phe-295) were found in some of the amplif ied genomic DNA s,while other genomic DNA s lacked these sites. Also, an AvaIIsite in exon XIX (at Gly-743) was not present in some of thegenomic DNA s, and these DNA s have an addit ional Hue111site which does not exist in other D NAs . These apparentrestriction fragment-length polymorphisms might be helpfulin studying various normal and abnormal genes.

Acknowledgments-We thank Drs. T. Maniatis and S. Yoshitakefor kindly providing genomic libraries, and Dr. F. Hagen for a HepG2 cDNA library. We also wish to thank Dr. J. E. Sadler for assistancein the initia l screening of the genomic library, Dr. D. Chung forhelpfu l discussions, E. Espling for technical assistance, and L. Swen-son for help in the preparation of the manuscript.

Note Added in Proof-The primary structure of an additio nalmember of the plasmino gen gene family (human hepatocyte growthfactor) containing four kringles has been reported (Nakamura, T.,Nishizawa, T., Hagiya, M., Seki, T., Shimon ishi, M., Sugimu ra, A.,Tashiro, K., and Shimizu , S. (1989) Nature 342, 440 -443 and Mi-yazawa, K., Tsubouchi, H., Naka, D., Takahashi, K., Okigaki, M.,Arakaki, N., Nakayama, H., Hirono, S., Sakiyama, O., Takahashi,K., Gohda, E., Daikuhara, Y., and Kitamura, N. (1989) Biochem.Biophys. Res. Comm un. 163, 967-973).

REFERENCES1. Robbins, K. C. (1981) Prog. Fibrinol . 5, 3-132. Wal len, P. (1978) Prog. Chem. Fibrinol . Thrombol. 3, 167-1813. Castel l ino, F. J. , and Powe l l , J. R. (1981) Methods Enzymol. 80, 365-378

4. Hoylaerts, M., Ri jken, D. C. , Li jnen, H. R. , and Col len, D. (1982) J. Biol .Chem. 257, 2912-29195. Wiman, B. , and Wal l&n, P. (1975) Eur. J. Biochem. 50,489-4946. Wiman, B. (1977) Eur. J. Biochem . 76, 12 9-1377. Sot t rup-Jensen, L. , Claeys, H: , Zajdel , M., Petersen, T. E. , and Magnusson,S. (1978) Prog. Chem. Fibnnol . Thrombol. 3, 191-2098. Mal inowski , D. P. , Sadler, J. E. , and Davie, E. W. (1984) Biochemistry 23,4243-42509. Forsgren, M., Rlden, B. , Israelsson, M., Larsson, K. , and Hedkn, L.-O.(1987) FEBS L&t . 213,254-26010. McLean, J. W., Ton&won, J. E. , Kuang, W.-J. , Eaton, D. L. , Chen, E. Y. ,Felss, G. M., Scanu, A. M., and Lawn, R. M. (1987) Nature 330, 132-.1.3,11. Toml inson, J. E. , McLean, J. W., and Lawn, R. M. (1989) J. Biol . Che m.264,5957-596512. Thorsen, S. , Clemme nsen, I . , Sot t rup-Jensen, L. , and Magnusson, S. (1981)Biochim. BioDhvs. Acta 668.377-38713. Lerch, P. G., f i ickl i , E. E. , Lergier, W., and Gi llessen, D. (1980) Eur. J.E iochem. 107,7-1314. Ichinose, A. , Takio, K. , and Fuj ikawa, K. (1986) J. Cl in. Inuest . 78 , 163-16 9-_15. von Zonnevel t , A. J. , Veerma n, H., and Pannekoek, H. (1986) Proc. Nat l .Acad. Sci . U. S. A. 83,4670-467416. Ichinose, A. , Espl ing, E. S. , Takamatsu, J. , Sai to, H. , Shinmyozu, K. ,Maruvama. I . . Martzen. M. R.. Petersen. T. E. . and Davie. E. W. (1989)T/work Hhekstas. 6i, 495 (kbstr.)17. Martzen, M. R., Petersen, T. E. , Ichinose, A. , and Davie, E. W. (1988)Fibrinolysis 2, 11 (abstr.)18. Lawn, R. M., Fri tsch, E. F. , Parker, R. C. , Blake, G., and Man&is, T.(1978) C el l 15,1157-117419. Yoshi take, S. , Schach, B. G., Foster, D. C. , Davie, E. W., and Kurachi , K.(1985) Biochemistry 24,3736-375020. Si lhavy, T. J. , Berman , W. L. , and Enquist , L. W. (1984) Experiments wi thGene Fusions, pp. 140-141, Cold Spring Harbor Laboratory, Cold SpringHarbor, NY21. D egen, S. J. F. , MacGi l l ivray, R. T. A. , and Davie, E. W. (1983) Biochemistry22,2087-209722. Sanger, F. , Nicklen, S. , and Coulson, A. R. (1977) Proc. Nat l . Acad. Sci . U.5 . A . 74 ,5463-546723. Biaein. M. D.. Gibson. T. J.. and Hone. G. F. (1983) Proc. Nat l . Acad. S ci .n 9 . A . 8d ,3963-$965 - 24. Poncz, M., Solowiejczyk, D. , Bal lant ine , M., Schwartz, E. , and Surrey, S.(1982) Proc. Nat l . Acad. Sci . U. S. A. 79,4298-430225. Saiki , R. K. , Gel fand, D. H. , Stof fel , S. , Scharf , S. J. , Higuchi , R. , Horn, G.T. , Mul l is, K. B. , and Erl ich, H. A. (1988) Science 239,487-49126. Bel l , G. I . , Karam, J. H. , and Rutter, W. J. (1981) Proc. Nat l . Acad. Sci . U.S . A . 78 .5759-576327. BreathnaiL, R. , Benoist , C. , OHare, K. , Gannon, F. , and Chamb on, P.(1978) Proc. Nat l . Acad. Sci . U. S. A. 75,4853-485728. Mount, S. M. (1982) Nucleic Acids Res. 10,459-47229. Sharp, P. A. (1981) Cel l 23,643-64630. Blake, C. (1983) Nature 306,535-53731. Davie, E. W. (1987) in Herno&& and Thrombosis (Colman, R. W., Hirsh,J. , Marder, V. J. , and Salzman, E. W., eds) 2nd Ed., pp. 242-267, J. B.L ipp incot t , Ph i l ade lph ia , PA

32. Breathnach, R. , and Chamb on, P. (1981) Annu. Reu. Biochem. 50, 349-38333. Fowlkes, D. M., Mul l is, N. T. , Come au, C. M., and Crabtree, G. R. (1984)Proc. Nat l . Acad. Sci . U. S. A. 82,8710-871434. Adrian, G. S. , Korinek, B. W., Bowman , G. H. , and Yang, F. (1986) Gene(Amst.) 49,167-17535. Berget , S. M. (1984) Nature 309,179-18236. McLauchlan, J. , Gaffney, D. , Whit ton, J. L. , and Clements, J. B. (1985)Nucleic Acids Res. 13,1347-136837. Ny, T. , Elgh, F. , and Lund, B. (1984) Proc. Nat l . Acad. Sci . U. S. A. 81,5355-536938. Riccio, A. , Grimaldi , G., Verde, P. , Sebast io, G., Boast , S. , and Blasi , F.(1985) Nucleic Acids Res. 13,2759-277139. Cool , D. E. , and MacGi l l ivray, R. T. A. (1987) J. Biol . Chem. 262, 13662-1 RWR--.-40. Deeen. S. J. F. . and Davie. E. W. (1987) Biochemistrv 26.6165-617741. Gi lbert , W. (lG78) Nature271,5bl _ ~I42. Lindahl , G., Gersdorf, E. , Menzel , H. J. , Duba, C. , Cleve, H. , Humphries,S. , and Utermann, G. (1989) Hum. &n et. 81,149-15243. Frank, S. L. , Kl isak, I . , Sparkes, R. S. , Mohandas, T. , Toml inson, J. E. ,McLean. J. W.. Lawn. R. M.. and Lusis. A. J. (1988) Hum. Genet. 7 9.x2-?..w.- ___44. Weitkamp, L. R. , Guttormsen, S. A. , and Schul tz, J. S. (1988) Hum. Genet.79,80-8245. Murrav. J. C. . Buetow. K. H. . Donovan. M.. Hornunn. S. . Motulskv. A. G..Dist%he, C!. , Dyer, ic. , Swisshelm, k. , Anderson, 3. diblet t , E. , Sadler:E. . Eddv. R. . and Shows. T. B. (1987) Am . J. Hum. Genet. 40 .338-35046. Hobart , d. J. (1979) Ann. Hum. denet. Lond . 42,419-423 47. Raum, D., Marcus, D. , and Alper, C. A. (1980) Am. J. Hum. Genet. 32,Ml -ma- _ _ Y 48. Nishimukai , H. , Kera, Y. , Sakata, K. , and Yamasaw a, K. (1981) VOX Sang.40,422-42549. Dykes, D. , Nelson, M., and Polesky, H. (1984) Electrophoresis 4, 417-42050. Aoki , N . , Tateno, K. , and Sakata, Y. (1984) Biochem. Genet. 22,871-88151. Hayes, M. L. , and Castel l ino, F. J. (1979) J. Biol . Chem. 254,87 72-8776



,2011

www.jb

c.org

Downloadedfrom

characterization of the gene for human plasminogen

Documents