characterizing the pyocin activity of …...ii characterizing the pyocin activity of diverse...
TRANSCRIPT
CHARACTERIZING THE PYOCIN ACTIVITY OF DIVERSE PSEUDOMONAS AERUGINOSA ISOLATES
by
Erik Michael MacKinnon
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Molecular Genetics
University of Toronto
© Copyright by Erik M. MacKinnon, 2011
ii
Characterizing the pyocin activity of diverse Pseudomonas aeruginosa isolates
Erik MacKinnon
Master of Science
Department of Molecular Genetics University of Toronto
2011
Abstract
Pseudomonas aeruginosa is a versatile Gram-negative pathogen that can infect a
diversity of immunocompromised patients. Interest in alternatives to traditional antibiotics has
inspired our investigation of R- and F-type pyocins as novel therapeutics. These phage tail-
like bacteriocins are produced by P. aeruginosa to kill competing strains via pore formation in
target cells. We aimed to characterize the diversity of pyocins and bacteriophages generated
by diverse P. aeruginosa strains so as to identify pyocins of therapeutic value. Strategies to
delineate pyocin and phage activities included physical methods, the modulation of pyocin
regulation, and antibody-based detection of tail-like pyocins. We have identified the
dominance of R- and F-type pyocins in impacting P. aeruginosa populations and revealed a
small number of strains producing particularly potent pyocins. In addition, the co-regulation
of phages and pyocins, the dependence of pyocins on pili for activity, and the striking
diversity of pyocin susceptibility have all been recognized.
iii
Acknowledgments
I would like to express my gratitude to my supervisor Dr. Alan Davidson for his
continual support and guidance throughout this project. I am grateful for having had an
opportunity to work in such an flexible, open, and positive environment for the duration of my
studies here.
Thanks also to my committee members Dr. Scott Gray-Owen and Dr. Jeremy
Mogridge for their time, willingness to help, and thought-provoking questions. As well,
thanks to Dr. Paul Sadowski and Dr. Karen Maxwell for their helpful suggestions at our
biweekly group meetings and elsewhere.
Special thanks to all members of the Davidson lab who have made my experience a
memorable one: Bianca, Eurema, Joe, Dave, Lia, Lisa, Maryna, Will, Senjuti, Tom, Kelly,
Nichole, Mostafa, and Devon. I have learned extensively from many of you, so thank you for
your support! In particular, I need to thank Joe for his enthusiasm and ideas throughout the
duration of our twin Pseudomonas projects.
Finally, thanks to my friends and family, and especially my girlfriend Jenny, for their
continued support and encouragement.
iv
Table of Contents
Abstract ii
Acknowledgments iii
Table of Contents iv
List of Tables vi
List of Figures vii
1. Introduction 1 1.1 Pseudomonas aeruginosa 1
1.2 Alternatives to traditional antibiotics 2 1.3 Pyocins 2
1.3.1 R-type pyocin morphology 3 1.3.2 F-type pyocin morphology 4 1.3.3 S- / M-type pyocins and their relationship to colicins 4
1.4 The pyocin loci 5 1.5 Induction of pyocins 7 1.6 Action of a pyocin 10 1.7 Phages and pyocins as therapeutics 12 1.8 Differentiating killing agents from P. aeruginosa 14 1.9 Objective 14
2. Materials and Methods 16 2.1 P. aeruginosa strain collection 16
2.2 Creation of pyocin regulator constructs 18 2.3 Mutagenesis of PrtR 18 2.4 Creation of tail tube and sheath constructs 20 2.5 Creation of Fab expression constructs 20 2.6 PCR reactions and colony screening 21 2.7 P. aeruginosa inductions 22 2.8 Spot assays 22 2.9 Transformations 23 2.10 Protein purification 23 2.11 Immunoblot assays 24 2.12 Identification of overlapping activities with spin filters 25 2.13 Competitive pyocin binding using Fabs 25
3. Results 26
3.1 Regulatory constructs 26 3.1.1 Overexpression of PrtN 26 3.1.2 Overexpression of PrtR mutants 27
3.2 Screen of pyocin and phage activity 30 3.2.1 Methods and interpretation of spotting 30
v
3.2.2 Killing activities generated 34 3.2.3 Killing susceptibility 37 3.2.4 Pyocin and phage co-regulation 39
3.3 Pyocin tail tube binding proteins 40 3.4. Tail fibre PCR analysis 44
4. Discussion and Future Directions 46 5. References 52 Appendix A – Pyocin purification experiments 60 A.1 Genomic island cloning 60
A.2 Pyocin loci cloning using long-range PCR 61 A.3 FPLC purification 62 A.4 Pyocin purification using tagged tail proteins 63
Appendix B – PrtN troubleshooting 65
vi
List of Tables
Table 1 16 Pseudomonas aeruginosa strain collection characteristics. Table 2 19 PCR primers used in this study. Table 3 36 Host ranges of 43 P. aeruginosa strains grouped together based on similarity. Table 4 37 Host range of selected P. aeruginosa strains producing tail-like pyocins of unique potency. Table 5 40 Summary of interactions between pyocin regulatory proteins and P. aeruginosa phages by producing strain.
vii
List of Figures
Figure 1 5 Pyocin morphology. Figure 2 6 The PA01 R- and F-type pyocin loci. Figure 3 9 Schematic of pyocin regulation. Figure 4 21 Fab morphology and expression. Figure 5 26 Induction of pyocins and phages in PrtN overexpression lysates. Figure 6 27 Putative PrtR domain topology based on sequence identity to phage ! repressor cI. Figure 7 28 PrtR mutagenesis strategy. Figure 8 29 Effects of PrtR overexpression on pyocin and phage production. Figure 9 31 Identification of different killing agents produced by, and killing, P. aeruginosa. Figure 10 33 Differentiation between overlapping killing activities versus a single activity. Figure 11 34 Relative contribution of each P. aeruginosa killing agent to total observed killing activity.
viii
Figure 12 35 Frequency of pyocin and phage production in P. aeruginosa. Figure 13 38 Total number of agents capable of killing each P. aeruginosa lawn strain broken down by agent category. Figure 14 42 Sample Western blots for detecting pyocin production. Figure 15 44 Test of Fab binding capacity for whole pyocin and potential inhibitory activity. Figure 16 45 Sequence diversity of P. aeruginosa R-type pyocin tail fibre region. Figure 17 60 Capture vector strategy for cloning the R- and F-type pyocin loci. Figure 18 62 Cloning R-/F-type pyocins by long-range PCR. Figure 19 63 Pyocin purification attempt by FPLC. Figure 20 64 Spotting of pyocin purification by 6-His tagged tail proteins.
1
Chapter 1 Introduction
1.1 Pseudomonas aeruginosa
Pseudomonas aeruginosa is a rod-shaped Gram-negative bacterium found
ubiquitously in diverse soil and water environments. This bacterium expresses a wide
spectrum of virulence factors that enable it to infect a diversity of plant, insect, and
mammalian hosts. As an opportunist and generalist, it has the capacity to infect humans that
are injured, burned, or immunocompromised. Specifically, P. aeruginosa infections of the
eye, bloodstream, urinary tract, and burn wounds are common, and are frequently acquired in
the hospital (nosocomial infections)1. Pseudomonas aeruginosa is also commonly responsible
for lung infections in cystic fibrosis (CF) patients. In these patients, the thick airway mucus
generated is thought to prime the lungs for infection by a diversity of pathogens, among which
P. aeruginosa often rises to prominance2. These pathogens, in combination with the
constitutively active (but largely ineffective) host defenses targeted against them, cause
extensive lung tissue damage.
Infections of P. aeruginosa can be difficult to treat because multiple-drug resistant
strains are commonplace in the healthcare setting. Contributing to the drug resistance of P.
aeruginosa is the low permeability of its membrane to drugs. It has been estimated that the
outer membrane of P. aeruginosa is less permeable by two orders of magnitude than that of E.
coli for small hydrophilic compounds3. Furthermore, this bacterium invests in the constitutive
expression of efflux pumps and antibiotic-inactivating enzymes that are active against the
three major classes of anti-pseudomonal drugs in common use ("-lactams, aminoglycosides,
and fluoroquinolones)4. In addition, P. aeruginosa has the capacity for the surface-attached
biofilm style of growth in which complex communities of bacteria are encased in a
predominantly polysaccharide extracellular matrix. This matrix may prevent antibiotics from
accessing most cells and provide conditions, such as low pH and low oxygenation, that reduce
drug activity5. These same features protect the bacteria from the host immune response, as
seen in the CF lung where entrenched biofilm communities can persist indefinitely.
2
1.2 Alternatives to traditional antibiotics
A 2004 study surveying the Research and Development programmes of 15 major
pharmaceutical companies revealed that only five antibacterial agents were undergoing
development, representing zero new classes of antibiotics6. Given the widespread resistance of
P. aeruginosa infections to antibiotics and the evidently sluggish pace of new drug
development, there is great interest in developing alternatives to traditional antibiotics against
this bacterium and others. One such alternative would capitalize on the bacteria-specific
killing action of bacteriophages (phages) to treat infections, a process known as phage
therapy. These viruses (phage) have been in use as antimicrobials in eastern Europe since
1919, however, in the West the rise of broad-range antibiotics led to slim interest for
investigating their use as therapeutics. The comparatively narrow host range of phages (as
compared to antibiotics like penicillin) was seen as a hindrance, but is now recognized as a
potential boon. Specifically, it is increasingly recognized that beneficial bacteria exist in the
human body, and treatment with broad-range antibiotics can both disturb these ‘good’ bacteria
and ‘make room’ for other pathogens.
Tailed dsDNA phages of the order Caudovirales comprise over 95% of characterized
phages. This order is subdivided into three families based on tail morphology: Myoviridae
(contractile tail), Siphoviridae (long non-contractile tail), and Podoviridae (short non-
contractile tail)7. These phages infect host bacteria by adsorption to the cell surface,
penetration of the cell wall and cell membranes, and subsequent injection of DNA and viral
replication. This activity causes membrane depolarization that is transient in normal phage8,
but permanent in phage lacking DNA (ghosts)9 and independent phage tails10 causing cell
death. Our goal is to investigate the potential for phage-tail like structures to be used as
antibiotics targeting Pseudomonas aeruginosa.
1.3 Pyocins
Bacteriocins are proteinaceous toxins produced by bacteria to kill competing strains of
the same species in addition to close relatives. They are thought to function as a means of both
invading and defending an ecological niche, and likely help to maintain microbial diversity at
the population and community levels11,12. Production of bacteriocins has been estimated to
3
occur in over 99% of bacteria13, and bacteriocins from over 16 different species had been
characterized as of 200714. Bacteriocins produced by Pseudomonas aeruginosa are termed
pyocins, and are characterized into four groups. The first two, R-type and F-type pyocins, are
large macromolecular structures homologous to phage tails. The others, S-type and M-type
pyocins, are small protein complexes homologous to the well-known colicins of E. coli. The
R-type pyocins are the most intensively studied group and have been shown to kill both a
diversity of P. aeruginosa strains in addition to a number of Campylobacter species15,
Neisseria gonorrhea16, Neisseria meingiditis16, Haemophilus ducreyi17, Pseudomonas
fluorescens18, and Pseudonomas putida18. In addition, all types of pyocins have been shown to
target the closely related Burkholderia cepacia complex19. The diversity of killing activities
(pyocins and phages) produced by each strain (ie. host range) has been historically used as a
typing technique for classifying new P. aeruginosa strains20. Further specificity was provided
by testing the susceptibility of the strain to a panel of known pyocins, and by serotyping
(characterizing the O-specific antigen)20. Genetic methods for typing Pseudomonas strains are
now predominantly used.
1.3.1 R-type pyocin morphology
The first pyocin was discovered by François Jacob in 195221. Derived from P.
aeruginosa strain R, the pyocin was termed an R-type pyocin and characterized extensively by
the Kageyama group beginning in 196222. Determined to be proteinaceous in nature,
transmission electron microscopy (TEM) images revealed the remarkable similarity between
R-type pyocin and Myoviridae phage tails23. Consistent with this observation, R-type pyocins
were found to be approximately 120 nm in length, 15 nm in width, and approximately 1-2x107
Da in weight24. Like Myoviridae phage tails, R-type pyocins were found to consist of four
major components (visible by TEM; see Figure 1a): a double hollow cylinder consisting of the
(i) outer sheath, and (ii) the inner core, both of which are attached to (iii) the baseplate, from
which extends (iv) six tail fibres. Two papers published in 1984 and 1989 cemented R-type
pyocins and Myoviridae phages as relatives by showing that pyocin proteins had the capacity
to complement a number of temperature sensitive mutant phage lysogens, producing active
phage particles25,26. Likewise, phage PS17 could complement chromosomal pyocin mutations,
and was also cross reactive with anti-R pyocin antibodies by Western blotting26. R-type
4
pyocins have also been shown to be highly efficient killers, with killing efficiencies of as low
as 1-2 pyocin particles per target bacterium (also known as the killing unit)24. To date, five R-
type pyocins have been characterized based on their host range and termed R1 to R5.
1.3.2 F-type pyocin morphology
In 1967, Takeya et al. identified a morphologically distinct but still phage-tail like
pyocin, terming it an F-type pyocin27. Further analysis revealed that F-type pyocins were
related to Siphoviridae tails and consisted of three major components (visible by TEM; see
Figure 1b): (i) the core, (ii) the baseplate, (iii) the tail fibres consisting of several short and
long filaments28. Compared to R-type pyocins, F-type pyocins are shorter (~105-108 nm) and
weigh approximately 3 x 106 Da each28. No serological cross reactivity was found with anti-R-
type pyocin antibodies, confirming their distinct morphology. To date, three F-type pyocins
have been identified and characterized: F1, F2, and F3. Interestingly, the killing efficiency of
these pyocins is generally much lower than R-type pyocins; the killing unit of F1 is
approximately 300 (on average 300 F1 pyocins are needed to kill one cell) whereas the killing
unit of F3 is 10028.
1.3.3 S- / M-type pyocins and their relationship to colicins.
S-type pyocins were first discovered in 1970 by Ito et al. by treating an R-type pyocin-
containing lysate with anti-R serum which revealed the presence of another bacteriocin29.
Biochemical analyses revealed these pyocins to be protein complexes smaller than 1x105 Da
that are not sedimentable by ultracentrifugation as the tail-like pyocins are (R- and F-types)29.
The first S-type pyocins discovered (S1, S2, S3, AP41, Sa) cause cell death by DNA
breakdown due to endonuclease activity at their C-terminal end30. Upon completion of the
genome sequence of the common P. aeruginosa lab strain PA01, two more putative S-type
pyocins (S4, S5) were identified and predicted to have tRNase and pore-forming activities,
respectively, based on homology to known colicins31,32. S5 has recently been experimentally
verified to cause cell death by pore-forming activity that causes the leakage of intracellular
materials and increases membrane permability33. The recently discovered M-type pyocin was
found, like its homolog colicin M, to degrade peptidoglycan precursors leading to cell death34.
This pyocin was shown to be present in very few P. aeruginosa strains and have a highly
5
limited host range. Given the similarity in size and morphology of M-type pyocins with S-type
pyocins, for the remainder of this thesis I will only refer to S-type pyocins, with the
understanding that this term also encompasses M-type pyocins for my purposes.
After purification, S-type pyocins can be broken down into two protein components
that make up the larger complex (depicted in Figure 1c). The larger of these proteins contains
the killing activity, whereas the smaller protein has been identified as an immunity protein that
grants the producing cell protection from its own pyocin29. The immunity protein binds
directly to the active domain of the killing protein. In addition to the domain responsible for
killing activity, all S-type pyocins have an N-terminal receptor binding domain, followed by a
domain of unknown function, and finally a translocation domain (for entry into the target
cell).
1.4 The pyocin loci
The R-type and F-type pyocin loci are located sequentially on the P. aeruginosa
chromosome between the trpE and trpG (tryptophan synthesis) genes of the PA01
chromosome. This region is characterized by four primary features depicted in Figure 2: (i)
6
the R-type pyocin region containing all genes encoding its structural and assembly proteins,
(ii) the F-type pyocin region containing its equivalents, (iii) the pyocin regulatory genes, and
(iv) the pyocin lysis cassette. Concomitant with the release of the PA01 genome sequence in
200035, Nakayama et al. published an in-depth comparison of the R-type pyocin open
reading frames (ORFs) to phages P2 and #CTX, and the F-type pyocin ORFs to phages
lambda (!) and HK02236. Of the 14 ORFs in the R-specific region, 11 had significant
sequence identity to ORFs in both phages P2 and #CTX (ranging from 31.3% to 64.8%),
outlining the shared ancestry of these agents. Likewise, of the 16 ORFs in the F-specific
region, 7 had significant sequence identity to phage ! and HK022 ORFs (ranging from 19.9%
to 45.5%)36. In addition to sequence identity, conservation of gene order between the pyocin
loci and the studied phage genomes aided in assigning putative functions to many of the
uncharacterized pyocin ORFs. Notably, there are no genes for head formation or replication,
defunct or otherwise, suggesting that pyocins have become evolutionarily specialized as
bacteriocins rather than defective phages. Consistent with this, the %GC content of the pyocin
regions is 66.1% like the wider genome itself (66.0% GC), suggesting that these loci have
existed in Pseudomonas for substantial time36. Exceptions to this rule are found only in some
tail fibre loci, suggesting more recent horizontal transfer and indicating a region of greater
variability.
Since this characterization of the first pyocin loci in PA01, a number of other strains
have been identified that do not produce both R- and F-type pyocins. The LESB58 strain was
7
found to lack the entire F-type pyocin locus37, strain PA14 was found to have a defective F-
type pyocin14, and strain PAC1 was found to lack the entire R-type locus36. These examples
suggest that Pseudomonas aeruginosa genomes are mosaics with respect to the tail-like
pyocin loci. Notably, there are no known strains which are deficient for both R- and F-type
pyocins38.
S-type pyocin loci are found scattered throughout P. aeruginosa genomes, unlike the
tail-like pyocin loci that are always found between trpE and trpG homologs. S-type pyocin
loci consist only of the two ORFs encoding the large (killing) protein and small (immunity)
protein described above. The frequency of S-pyocin loci in P. aeruginosa strains is largely
unknown, however, it is likely that each strain produces multiple S-type pyocins similar to
PA01, which contains S2, S4, and S5 (in addition to R2 and F2). Thus, each new P.
aeruginosa strain identified is likely to possess a highly variable set of pyocin loci encoding a
unique combination of bacteriocins used to combat its competitors.
1.5 Induction of pyocins
P. aeruginosa grown in rich media is known to frequently produce a basal level of
pyocin activity. However, since the discovery of R-type pyocins it has been known that UV
radiation will induce P. aeruginosa to produce pyocins before causing cellular lysis21, at a rate
of approximately 200 particles (for R-type) per cell24. In searching for other inducing
conditions, Kageyama identified mitomycin C, a DNA crosslinker, as a potent inducer of
pyocins23. The ~200 fold induction of pyocin by this drug suggested that DNA damage, and
therefore the conserved bacterial SOS response, play a role in pyocin regulation. It is likely
that basal pyocin production derives from a subset of cells that, during normal replication,
suffer DNA damage and are induced to produce pyocins. Perhaps the larger population of
cells receives a competitive advantage (in the context of a natural environment) by the
production of bacteriocins from individuals that are irreparably damaged.
The SOS response in bacteria is responsible for DNA repair and is largely dependent
on the master regulator RecA. In response to DNA damage, RecA is activated and induces
LexA, a repressor, to self-cleave, allowing the production of SOS proteins for DNA repair.
With this knowledge in hand, Matsui et al. investigated a chromosomal mutation of P.
8
aeruginosa PA01 that was known to be deficient in R2 pyocin production but also found to be
deficient in F2 and S-type pyocin production39. This suggested that the mutation affected a
regulator of pyocin production, and efforts were made to map its location. In doing so, the
authors identified PrtN, the pyocin activator protein whose encoding gene harbored the
original mutation, and PrtR, the pyocin repressor protein. Overexpression of PrtN was found
to induce pyocins, while overexpressing a larger DNA fragment containing both the PrtN and
PrtR genes revealed the latter to have a repressive effect on pyocin production. Utilizing an E.
coli system that had an AP41 (S-type) pyocin locus-containing plasmid, the authors
introduced various combinations of RecA, PrtN, and PrtR to delineate their roles as measured
by pyocin production. PrtN induced constitutive pyocin expression that was only repressed in
the presence of PrtR. Inducible pyocin production (by mitomycin C) was only achieved when
all three proteins were present39. Sequence analysis revealed PrtN to have no sequence
identity to known ORFs (at the time), representing a novel type of activator. PrtR, however,
was shown to have substantial identity to both LexA and numerous phage repressors,
including the well-characterized cI repressor of phage !. Based on these and other data, the
authors concluded that in response to DNA damage, RecA becomes activated and induces
PrtR, the pyocin repressor, to self-cleave. The alleviation of repression resulting from this
cleavage allows the PrtN protein to be produced, which itself goes on to induce the pyocin loci
(both tail-like and S-type pyocins), as depicted in Figure 3. The authors further went on to
show that a short DNA motif (ATTGNN(N)GTNN(N)), termed the P-box motif, was the
binding site of PrtN found upstream of all S-type pyocin loci and the adjacent R- and F-type
pyocin loci39.
Nakayama et al. identified four genes surrounding the R-type pyocin locus that share
significant sequence identity to known phage lysis genes36. Encoded from the first gene is a
holin that was shown to induce cell lysis when overexpressed in P. aeruginosa. A second
ORF, encoding a putative lytic enzyme, produced cell lysis when overexpressed only in the
presence of the holin or after chloroform treatment, consistent with its inferred role of
hydrolyzing peptidoglycan. Both these experimental data and sequence comparisons with
known phages suggest that pyocins utilize a phage-like lytic system that relies on a holin
binding to the inner membrane, through which a lytic enzyme passes and degrades
peptidoglycan substrates resulting in cellular lysis36. The remaining two lysis-related ORFs
9
identified in P. aeruginosa are presumed to be regulators. The S-type pyocins are assumed to
also escape the producing cell using this system given the lack of lysis-related proteins
encoded within or near their loci.
Mitomycin C is also known to induce phages 10-1000 fold20 by mechanisms that are
certainly similar to its effects on pyocin regulation. It is well known that most, if not all,
phages are also induced as part of the SOS response via the mechanism of induced self-
cleavage of phage repressors. However, in the context of P. aeruginosa it is not clear to what
extent phages and pyocins, sharing such similar systems, are co-regulated. In current
databases, a number of phage sequences exist that share substantial sequence identity to the
pyocin regulators, suggesting potential interactions. For example, bioinformatic analyses in
our lab have revealed a number of PrtN-like sequences in Pseudomonas prophages: P. putida
phage KT2440, P. fluorescens phage Pf5, and P. syringae phage DC3000. Conversely, PrtR is
known to have substantial sequence identity with phage repressors: 62% sequence identity
with the P. aeruginosa phage F116 repressor, 44% to P. putida phage W619, 40% to E. coli
phage phi80, etc. The presence of these homologs suggest that pyocin regulators may, in some
cases, regulate phage production.
10
Recent studies have revealed that pyocins are induced in clinically relevant settings. A
2005 study by Brazas and Hancock investigated (by microarrays) the response of P.
aeruginosa to lethal and sublethal concentrations of ciprofloxacin, a DNA gyrase-inhibiting
antibiotic in common clinical use38. Their most striking finding was the widespread induction
of all R- and F-type pyocin genes, including the regulatory and lysis proteins. Mutants in the
R and F loci showed increased resistance to ciprofloxacin, suggesting that in response to drug-
induced stress the pyocin lysis system is enhancing cell death. Another microarray study
investigated the effects of hydrogen peroxide (H2O2), a common reactive oxygen species that
P. aeruginosa would encounter exogenously from the host immune system during an
infection40. Similar to the ciprofloxacin study, all pyocin proteins were found to be uniformly
upregulated. The authors suggest that P. aeruginosa populations might dissipate the effects of
oxidative stress by lysing some cells (perhaps those on the outer layer of a biofilm) that have
been damaged and gain some benefit (pyocin production)40. A third microarray study revealed
that pyocins are also induced in a biofilm setting, and to particularly high levels in
anaerobically grown biofims41. This result was confirmed by assaying pyocin activity, and
suggests that pyocins may be active in the clinically important hypoxic lung biofilms of CF
patients.
1.6 Action of a pyocin
The mechanism of pyocin killing has been studied largely in the context of R-type
pyocins. In fact, no studies to date have investigated the specific mechanisms with which F-
type pyocins kill, and most studies of the S-type pyocins have investigated and confirmed
putative killing activities of the major protein in vitro without investigating in vivo activity or
pyocin entry extensively33,34,42. With respect to R-type pyocins, early experiments
demonstrated that DNA, RNA, and protein synthesis all stop within minutes of cellular
exposure to these bacteriocins43. However, pyocins do not degrade these macromolecules
actively. It is now understood that R-type pyocins kill by forming a pore in the bacterial
membrane that causes the leakage of intracellular ions and elimination of the membrane
potential10. This activity causes a quick halt to cellular respiration (and therefore adenosine
triphosphate (ATP) production), and ATP levels plummet as ATP is used by the dying cell10.
11
Lipopolysaccharide (LPS) extracts from pyocin-sensitive P. aeruginosa strains were
found to neutralize R-type pyocin preparations, suggesting that LPS plays a role in the pyocin-
cell surface interaction44. Lipopolysaccharide is a complex glycolipid anchored to the outer
membrane of Gram-negative bacteria that acts a shield protecting the bacterium from harmful
substances but also is itself an endotoxin that can trigger and activate host immune responses
during an infection45. LPS consists of three domains: lipid A, which contains the fatty acid
chains responsible for anchoring LPS to the outer membrane, a branched oligosaccharide
called the core, and a repetitive carboyhydrate polymer known as the O antigen. In P.
aeruginosa, the O antigen consists of two distinct polysaccharides, the A- and B-band
polysaccharides, the latter of which is investigated to serotype a strain (reviewed by King et
al.45). Interestingly, a recent paper by Kohler et al. found that strains of certain serotypes
tended to be more resistant to R pyocins (O10, O11, O12), and whereas those with other
serotypes were more susceptible (O1, O3, O6)46. The authors suggest that serotypes O1, O3,
and O6 could have lower packing densities of their A- and B- band sidechains, allowing
pyocins freer access to the necessary yet unknown cellular receptors. Furthermore, these
authors found specific residues near the base of the core domain that were necessary for
pyocin activity, such that PA01 mutants eliminating these residues were resistant to specific
pyocins. These included two separate glucose residues that were necessary for R2 and R5
pyocin activity, and an L-rhamnose residue for R146. These data taken together suggest that
LPS acts both as a shield against pyocin activity in some cases, but also a necessary receptor
for all R-type pyocins. However, despite the apparent interactions between R-type pyocins
and LPS, there may remain unidentified bacterial factors necessary for the membrane
depolarization activity of tail-like pyocins.
With respect to pyocin specificity, analysis of fractionated pyocin preparations
revealed the LPS binding capacity to reside in a two-protein complex, later revealed to consist
of the tail fibre and baseplate36,47. Recently, sequence analysis of the tail fibre regions of
strains containing the five known R-type pyocins (R1-R5) revealed that R2, R3, and R4 have
almost identical DNA sequences despite having different host ranges46. This suggests that
only a few changes in the tail fibre structure can have substantial effects on pyocin specificity.
Regardless, the authors characterized a diversity of stains for their R-pyocin content by PCR
and found that 25% of strains had an R1 locus, 17% had R2, 29% had R5, and 28% had no
12
detectable R tail fibre46. The R2 category included potential R3 and R4-pyocin containing
strains by virtue of their almost identical DNA sequences. Furthermore, Williams et al. also
showed that the specificity of an R pyocin is entirely defined by its tail fibre and associated
chaperone. Using N-terminal tail fibre truncations of PA01, they showed that expressing the
N-terminal fibre domains and chaperones from R1, R3, R4, or R5 DNA sequences in trans
were sufficient to produce intact pyocin particles of identical specificity to their parental
pyocin48. Put simply, a PA01 R2 pyocin with an R1 tail fibre fusion acted identically to an R1
pyocin. The authors then proceeded to show that this N-terminal tail fibre truncation is
capable of accepting tail fibre fusions from E. coli and Y. pestis phages, resulting in pyocins
that were capable of killing these same species48. Remarkably, the tail spike from an E. coli
Podoviridae phage #V10 was also successfully fused and generated a pyocin capable of
specifically targeting E. coli O157:H7 strains49. This particular tail spike exists as a
homotrimer, suggesting that R-type tail fibres are also homotrimers49. In summary, pyocin
specificity is defined by its tail fibre and associated chaperone, and depends, at least in part,
on a number of conserved core residues of P. aeruginosa lipopolysaccharide.
1.7 Phages and pyocins as therapeutics
The use of bacteriophages as therapeutics has continued largely unhindered in Eastern
Europe and is spearheaded by the Elivava Institute in Tblisi, Georgia50. However, interest in
phage therapy in the West has recently increased, and in 2008 the US Food and Safety
Inspection Service approved a Salmonella-specific phage preparation to reduce contamination
of live poultry51. Phage therapy can be advantageous compared to traditional antibiotics
because phages target specific bacteria, and thus can be used to target pathogens of interest
while ignoring benign microflora50. In addition, many phages encode exopolysaccharide-
degrading enzymes that may help their activity in biofilm settings, and furthermore, many can
target non-replicating bacteria such as those in an entrenched infection52. Despite these
advantages, phages can frequently integrate into the host chromosome (lysogeny) and lay
dormant there for many bacterial generations (as a prophage), conferring resistance to further
phage infection. It is difficult to isolate phages that never lysogenize (lytic phages). In
addition, phages are capable of transferring bacterial DNA such as virulence factors in a
process known as transduction. For example, it was recently shown that a phage is capable of
13
transferring super-antigen islands between S. aureus and L. monocytogenes53. Finally, during
phage replication target cells undergo lysis, releasing harmful endotoxins and immunogenic
DNA.
Utilizing phage-tail like bacteriocins instead of whole phages in therapy should be
advantageous for the reasons listed above, but without the detractions of phage therapy. In
short, phage-tail like bacteriocins (of which I focus on R- and F-type pyocins herein) kill
without causing cell lysis, do not possess DNA and so cannot integrate into the bacterium
(providing resistance) or transfer potentially harmful DNA sequences. In addition, in
comparing the suitability of phages and pyocins for strain typing, Farmer and Herman found
that dissocation mutants newly resistant to phage frequently appeared in previously-
susceptible strains20. This phenomenon was not observed for the pyocins tested.
R-type pyocins have shown the capacity for impacting P. aeruginosa populations in a
number of settings. One such study revealed capacity for the R2 pyocin to target strain PAK,
allowing its producer, strain PA14, to achieve dominance in coculture14. This effect was
abolished in an R2-mutant of PA14. Taking this type of experiment one step further, Waite
and Curtis demonstrated that the R2 producer PA01 could outcompete a susceptible strain in a
mixed artificial biofilm setting41. Furthermore, Kohler et al. showed that pyocins can mediate
a new strain coming to dominance in the context of a natural lung infection, by measuring
levels of two competing strains over time by qRT-PCR46. The authors demonstrated that the
eventual dominant clone could kill the other strain, but not vice versa. Finally, R-type pyocins
have been tested most recently in an in vivo model of therapeutic efficacy by Scholl and
Martin in 200854. These authors found that R-type pyocins were capable of rescuing mice
infected by a pyocin-sensitive strain when treated 1-4 hours post-infection by the
intraperitoneal route (IP) or 1-2 hours post infection by the intravenous (IR) route. The
infecting dose of P. aeruginosa was such that, left untreated, 90% of mice would die 48 hours
post-infection.
It should be noted that R- and F-type pyocins are relatively protease resistant (as are
phages)22,28, but the smaller S-type pyocins are not and therefore would be poor therapeutics
in the context of a human body. Additionally, creating mutants in the capsid (head) genes of
potential phages could, in theory, generate phage tails of similar killing mechanism with tail-
14
like pyocins. However, one such mutant created in P. aeruginosa phage PS17 produces tails
that were 200 fold less efficient at killing than R-type pyocins55, suggesting that pyocins may
be better adapted for such killing. Thus, of the various pyocin and phage agents discussed
herein, R- and F-type pyocins appear best adapted for use as novel therapeutics. In particular,
R-type pyocins may be the ideal candidate given that they have been identified to have
typically larger host ranges than F-type pyocins and can be intelligently re-targeted, as was
shown by the tail fibre fusion experiments described earlier48,49.
1.8 Differentiating killing agents from P. aeruginosa
Prior to the start of my experiments, no studies had been published investigating (on a
large scale) the relative contribution of each pyocin and phage type to the capacity for P.
aeruginosa strains to compete with, and kill each other. In order to do this, methods must exist
for differentiating the relative contribution of each killing agent to the overall host range of
each strain. Induction of pyocins by mitomycin C or UV radiation causes the production of all
pyocins and phages in a strain, generating a supernatant with potentially many different
agents. Traditionally, each pyocin under consideration was then purified using a lengthy
process typically involving one or more precipitation, ultracentrifugation, cellulose
chromatography and sucrose gradient steps22. Only then could its features and host range be
characterized. To do this on a large scale is unfeasible, necessitating different strategies. These
strategies must be able to differentiate between each agent’s activity, and must also be able to
identify those instances where multiple agents (eg. an R-type and an S-type pyocin) kill the
same strain. One such strategy traditionally used capitalized on the adsorption of one agent to
a sensitive strain, leaving the other agent(s) in the solution at hand. This was done successfully
to separate R- and F-type pyocins but requires prior knowledge of the specific host ranges of
each agent (which we lack)56.
1.9 Objective
My project was inspired by an investigation into the killing activities of 88 P.
aeruginosa strains undertaken largely by Senjuti Saha. These strains, kindly provided to us by
David Guttman’s laboratory (University of Toronto), were chosen for their diversity both
genetically (by multi-locus sequence typing) and geographically (clinical and environment
15
isolates from around the world), as outlined in Table 1. Senjuti induced each of the 88 strains
with mitomycin C to produce lysates containing all pyocin and phage activities generated by
each strain. These undiluted lysates were spotted against lawns of the same 88 strains and
visible clearings present after an overnight incubation were denoted as killing activities. From
this data set, a remarkable diversity of pyocin and phage activity was identified but the
relative contribution of each type of killing agent could not be assessed. Simply put, each
activity may have been caused by any of the pyocins types or by phages (phages are
differentiable only if visible plaques are present in each undiluted lysate).
My goal has been to delineate the activity of each killing agent from a panel of these
same 88 Pseudomonas aeruginosa isolates. In doing so, we aimed to distinguish the relative
importance of each killing agent in impacting P. aeruginosa population dynamics and identify
those tail-like pyocins that may have the most therapeutic value. Such tail-like pyocins would
have comparatively wide host ranges. In addition, we aimed to investigate the determinants of
pyocin specificity so as to aid in long-term goals of pyocin (re)engineering.
In order to differentiate between the different killing agents produced by
Pseudomonas, I took advantage of five strategies:
(1) The selective inactivation of S-type pyocins by proteinase K.
(2) The capacity for phage populations to form minute plaques upon dilution that are
visibly distinct from pyocins.
(3) The selective induction of pyocins using a pyocin activator (PrtN) construct.
(4) The selective repression of pyocins using a pyocin repressor (PrtR mutant)
construct.
(5) Western blotting for differentiating R- and F-type pyocins
Combined, these strategies have allowed for extensive characterization of a subset of our P.
aeruginosa collection with respect to killing agents. In addition, substantial effort was directed
toward developing faster tools to purify pyocins of interest. Unfortunately, efforts to this end
were largely fruitless and are outlined briefly in the appendix.
16
Chapter 2 Materials and Methods
2.1 P. aeruginosa strain collection Strain Designation Place of Isolation Source Origin
A1 PA14 Australia human burn
A2 CF017 Hoiby, Denmark human Cystic Fibrosis
A3 RYC97083283 Hospital Ramon y Cajal. Madrid, Spain human bacteraemia
A4 STH_U9-19005 Malmo, Sweden human urine
A5 PA100420 Toronto, ON human cystic fibrosis
A6 PA1032 San Francisco, CA human acute infection-resp. tract
A7 CF040 N. Carolina, USA human Cystic Fibrosis
A8 EnvJH Joker's Hill, ON soil
A9 RYC25616 Hospital Ramon y Cajal. Madrid, Spain human Cystic Fibrosis
A10 PA131533 Toronto, ON human liver abcess
A11 ERC-1 Bozeman, MT, USA, Stoodley Environment
A12 CFS2 UBC, D. Speert (CF-97) human Cystic Fibrosis
B1 114199 Houston, TX, USA, Guymon human sputum
B2 RR1 Madrid, Sapin oil-contaminated soil
B3 CF25 Scotland, Govan human Cystic Fibrosis
B4 OR West Virginia, USA, Somerville Environment
B5 PA01 Australia human burn
B6 PA103 human
B7 PA191517 Toronto, ON human cystic fibrosis
B8 PA87110594 Toronto, ON human endotracheal tube
B9 PA4944 Toronto, ON human rectal swab
B10 PA100683 Toronto, ON human cornea
B11 PA5196 Toronto, ON human rectal swab
B12 PA5525 Toronto, ON human rectal swab
C1 CF011 Denmark, Hoiby human Cystic Fibrosis
C2 Env24 DJ Toronto soil
C3 104035 Houston, TX, USA, Guymon human biopsy
C4 PA2048 San Francisco., CA human lung transplant-trachea C5 CECT116 Spain water bottle
C6 PAK (PA06) human cystic fibrosis
C7 ITL_134MG IRCCS (S.Maugeri), Pavia, Italy human
C8 PA2046 San Francisco., CA human acute infection-resp. tract
C9 Env23 DJ Toronto soil
C10 ITL_85MG IRCCS (S.Maugeri), Pavia, Italy human
C11 EnvKY2 Farm, Maysville, KY, USA soil
C12 HUN_PA576 Ajka, Hungary human trachea
D1 ITL_PPV108 San Matteo, Pavia, Italy human
D2 RYC28290 Hospital Ramon y Cajal. Madrid, Spain human Cystic Fibrosis
D3 ATCC15528 U. S. A soil
D4 EnvBC13 Near geese, Stanley Island, Vancouver, BC soil
D5 PHU56 Federal University of Rio de Janeiro, Brazil human osteomyelitis
D6 RYC16469 Hospital Ramon y Cajal. Madrid, Spain human bacteraemia
D7 Env201 Spadina/Harbord intersection, Toronto, ON soil
D8 STH_PA3 Stockholm, Sweden human tracheal secretion
D9 T4347 Trinidad human
D10 EnvSG4 Cedarvale Ravine, Toronto water
D11 HUN_PA555 Pecs, Hungary human urine
D12 Env110 BP 23 D'arcy St, front yard, Toronto soil
E1 Env34 DJ Bloor West, flower bed, Toronto soil
17
Strain Designation Place of Isolation Source Origin
E2 STH_PA84 Stockholm, Sweden human pancreatic secretion, CF
E3 ATCC14886 America soil
E4 OR West Virginia, USA, Somerville Environment
E5 T4464 Trinidad human
E6 CFS4 UBC, D. Speert (CF-98) human Cystic Fibrosis
E7 2709 Brussells, Belgium human Urinary tract
E8 PHU149 Federal University of Rio de Janeiro, Brazil human urine
E9 ITL_TS832035 Trieste, Italy human
E10 ATCC7700 Ponce, Puerto Rico water
E11 CF5 Scotland, Govan human Cystic Fibrosis
E12 EnvBC17 Garden, UBC, BC soil
F1 T5255 Trinidad human
F2 203097 Houston, TX, USA, Guymon human wound
F3 EnvJH2 Joker's Hill, ON soil
F4 311058 Houston, TX, USA, Guymon human sputum
F5 CF37 Scotland, Govan human Cystic Fibrosis
F6 EnvHM Near Hwy400, Holland Marsh, ON soil
F7 EnvBC15 Granville Island, BC soil
F8 EnvBC10 Stanley Park, Vancouver soil
F9 ATCC15524 America soil
F10 EnvCIN1 Creek, Cincinatti, OH, USA soil/water
F11 EnvKY1 Farm, Maysville, KY, USA soil
F12 ENV42 UBC, D. Speert Environment
G1 Env203 Trinity Quad, UofT, Toronto, ON soil
G2 SA2 South Africa water golf course pond
G3 EnvBC20 Victory Park, Vancouver, BC soil
G4 Env63 BP Cow pasture near Damascus, ON soil
G5 Env25 DJ Toronto soil
G6 CF049 UBC, D. Speert human Cystic Fibrosis
G7 AFC-02 Kenya, Africa via Calgary, AB, Canada human Pus
G8 ATCC21472 America soil
G9 C-6 U of Calgary, Calgary, Alberta (R.A. Moore)
G10 ATCC260 USA human pathological lesions
G11 HUN_PA583 Pecs, Hungary human throat
G12 T4826 Trinidad human
H1 PsVir03 Calgary Lab Services, Calgary, Alberta human urine, ACC1 - outpatient
H2 PsVir05 Calgary Lab Services, Calgary, Alberta human urine, ACC1 outpatient
H3 CF149 Boston, MA, USA, Pier human Cystic Fibrosis
H4 ATCC97 Walter Reed Army Medical Center, USA human pathological lesions
PA14 Lysogenized PA14 Provided to us by the Cho Lab, Sogang University burn
Table 1. Pseudomonas aeruginosa strain collection characteristics. In yellow are strains
investigated in my large scale screen of killing activities.
18
2.2 Creation of pyocin regulator constructs
The PrtN ORF was amplified from PA01 genomic DNA using primers ‘prtN-F-
EcoR1’ and ‘prtN-R-HindIII’ (all primers listed in Table 2). The forward primer was designed
with an extension containing an EcoRI site while the reverse primer contained a HindIII site to
facilitate cloning into the P. aeruginosa/E. coli shuttle vector, pMMB67EH. This vector is an
autoregulated high-level expression vector possessing an isopropyl "-D-1-
thiogalactopyranoside (IPTG) inducible tac promoter with rrnB terminators and lacIQ for lac
repression57. It can be mobilized into various Gram-negative bacteria by conjugation with
IncP helper plasmids, and imparts carbenicillin resistance via "-lactamase. For cloning, PCR
product was digested, gel purified, and ligated with linearized pMMB67EH vector DNA,
transformed into electrocompetent DH5$ cells and then plated on LB + ampicillin (50 µg/ml)
plates. All colony screens (for this and other constructs) were performed with primers
‘pMMB67EH-ProMCS-F’ and ‘pMMB67EH-ProMCS-R’, which were designed to amplify
the MCS of pMMB67EH independent of the insert type. Colonies generating appropriately
sized DNA were confirmed by DNA sequencing (using custom primers ‘67EH-Seq2-F’ and
‘67EH-Seq2-R’) to possess the correct construct.
The full length PrtR ORF was amplified from PA01 genomic DNA using primers
‘PrtR-pBTK29-LIC-F’ and ‘PrtR-pBTK29-LIC-R’, which possess 20 bp extensions matching
the multiple cloning site (MCS) of the target backbone, vector pMMB67EH. These extensions
contained an EcoRI site in the forward primer and a HindIII site in the reverse primer and
were designed for use in a ligation independent cloning (LIC) method with the Clontech In-
Fusion Dry-Down PCR Cloning Kit. PCR products were gel purified and were combined with
linearized pMMB67EH in the LIC reaction as per the manufacturer’s protocol.
2.3 Mutagenesis of PrtR
Generation of PrtR mutants A121T and S162A was achieved according to the
QuikChange Site-Directed Mutagenesis guidelines (Stratagene). Briefly, primers ‘PA01-PrtR-
A121T-F’ and ‘PA01-PrtR-A121T-R’ for A121T and ‘PA01-PrtR-S162A-F’ and ‘PA01-PrtR-
S162A-R’ for S162A were used in a full-circle PCR amplification reaction using pMMB67EH
PrtR as the template. Conditions were according to the manual. The PCR program was as
19
follows: 95°C for 30 sec, followed by 16 cycles of 95°C for 1 min, 55°C for 1 min, and 68°C
for 12 min. To each reaction 1 µl of DpnI was added to digest parental methylated DNA. After
transformation into DH5$, the plasmid DNA from all colonies was isolated and sent for
sequencing to confirm the mutations.
Primer name Sequence (5' to 3') Restriction site
prtN-F-EcoR1 GCGCGAATTCATGCAGCCATCCATCGC EcoRI
prtN-R-HindIII GAACAAGCTTTCAGGATGCGATGCTGTC HindIII
prtR-F-EcoR1 GCGCGAATTCATGGCCGTGTCCGTGGCC EcoRI
prtr-R-HindIII GAACAAGCTTTCACCGCACCAGGGAC HindIII
PrtR-pBTK29-LIC-F ACAGGAAACAGAATTCATGGACAAGAGCACCCAGAT EcoRI
PrtR-pBTK29-LIC-R CAAAACAGCCAAGCTTTCACCGCACCAGGGACGGGC HindIII
PA01-PrtR-S162A-F GACGAAGTGGAACTGCTGCTGTACAAGGAAGTG -
PA01-PrtR-S162A-R CACTTCCTTGTACAGCAGCAGTTCCACTTCGT -
PA01-PrtR-A121T-F GAAGTGGAGATGTCCACCGGCGCCGGACGCACT -
PA01-PrtR-A121T-R AGTGCGTCCGGCGCCGGTGGACATCTCCACTTC -
PA0622/623pBTK29LICF ACAGGAAACAGAATTCATGGGCAGCAGCCATCATCA EcoRI
PA0622-pBTK29-LIC-R CAAAACAGCCAAGCTTTTAGGCGACATCCAGAACTT HindIII
PA0622/623pBTK29LICF ACAGGAAACAGAATTCATGGGCAGCAGCCATCATCA EcoRI
PA0623-pBTK29-LIC-R CAAAACAGCCAAGCTTTTACAGGCCGAGGTCGTTGC HindIII
PA0633-pAD-LIC-F AGGAAACAGACCATGGATGTCCATCCTGACTCAAGG NcoI
PA0633-pAD-LIC-R GTCCTTGTAGTCTAGAGCCGACTTCGGCGTCCACTT XbaI
PA0633-pBTK29-LIC-F ACAGGAAACAGAATTCATGTCCATCCTGACTCAAGG EcoRI
PA0633-pBTK29-LIC-R CAAAACAGCCAAGCTTTCAGTGATGGTGATGATGGT HindIII
PA01-R-fibreC-F ACAGGAAACAGAAAGCATCCGGGAGT. EcoRI
PA01-R-fibreC-R CAAAACAGCCAAGAAACCCCGCACGA. HindIII
PaTrpE-P1-F ATATTACCCTGTTATCCCTAGCGTAACTATCGATCTCGAGATG -
PaTrpE-P2-R CATATATACTTTAGATTTTAATTAAACGCGTTCTAGAAAATT -
PaTrpG-30-P3-F CATTTTCACCGTTTTTTGTTTAAACGTTAACTCTAGAGGGCTTC -
PaTrpF-P4-R TAACAGGGTAATATAGAGATCTGGTACCCTGCAGGAGCTCTCA -
pLLx8-P2-F TTTTCTAGAACGCGTTTAATTAAAATCTAAAGTATATATGAG EcoRI
pLLx8-P3-R CCCTCTAGAGTTAACGTTTAAACAAAAAACGGTGAAAATGGG EcoRI
PA01-F-locus-F ACAGGAAACAGAATCTTTTCATGTGC. EcoRI
PA01-F-locus-R CAAAACAGCCAAGTTGCGTCCATCAG. HindIII
PA01-R-locus-F ACAGGAAACAGAAAAACTGATCGAAG. EcoRI
PA01-R-locus-R CAAAACAGCCAAGCCTCCTGCACTCC. HindIII
pMMB67EH-ProMCS-F TTTCACATTCACCACCCTGA -
pMMB67EH-ProMCS-R ACGGCGTTTCACTTCTGAGT -
67EH-Seq2-F TCTGAAATGAGCTGTTGACAAT -
67EH-Seq1-R CGCCAGGCAAATTCTGTTT -
Table 2. PCR primers used in this study
20
2.4 Creation of tail tube and sheath constructs
All R-/F-type pyocin tail sheath and tube constructs were created by the same method
described for full length PrtR, utilizing the EcoRI and HindIII sites of pMMB67EH in LIC
cloning. The R-type pyocin sheath (PA0622) ORF was amplified from an E. coli expression
vector, p11, already bearing this insert using primers ‘PA0622/623pBTK29LICF’ and
‘PA0622-pBTK29-LIC-R’ which also amplified the N-terminal 6His tag. The R-type pyocin
tail tube (PA0623) ORF was also amplified from an E. coli expression vector, p11, already
bearing this insert using primers ‘PA0622/623pBTK29LICF’ and ‘PA0623-pBTK29-LIC-R’
which also amplified the N-terminal 6-His tag. The F-type pyocin tail tube (PA0633) ORF
was amplified from an E. coli expression vector, p15TV-L, already bearing this insert using
primers ‘PA0633-pAD-LIC-F’ and ‘PA0633-pAD-LIC-R’. This fragment was first cloned
into pAD100 (another E. coli expression vector) in order to tag the ORF with a C-terminal
6His + FLAG tag. Amplification from this construct was then performed using primers
‘PA0633-pBTK29-LIC-F’ and ‘PA0633-pBTK29-LIC-R’ and subsequently cloned into
pMMB67EH. Thus, both R-type pyocin ORFs were cloned into pMMB67EH with N-terminal
6His tags, and the F-type pyocin ORF (tail tube, PA0633) was cloned into the same vector
with a C-terminal 6His + FLAG tag.
2.5 Creation of Fab expression constructs
In collaboration with the Sidhu lab, we generated Fab (antigen binding fragment, see
Figure 4a) protein expression vectors according to the protocols in Fellouse and Sidhu58,59.
Using phage display (M13 bacteriophage), Helena Persson from the Sidhu lab selected for
phage-displayed Fabs that bound with high specificity to the target native-state antigens
PA0623 (R-type tail tube) and PA0633 (F-type tail tube). After confirmation of binding
strength using ELISA assays59, sequence analysis was used to confirm that each phage-
displayed Fab contained a different binding pocket. My involvement began with modifying
the phagemid vectors encoding the Fab proteins of interest for use as expression vectors.
Primers designed to insert a stop codon between the constant region of the heavy chain and
the fusion coat protein (geneIII) were employed to create an expression vector that would
express Fab independent of phage proteins. To do this, ssDNA from each Fab-encoding
21
phagemid was isolated as template for the PCR reaction with mutagenic primers. After
transformation, colony dsDNA was isolated and sequenced to ensure the insertion of the stop
codon and retention of unique sequence in the variable regions. Succesful clones were then
retested by ELISA to confirm production of antigen-specific Fabs.
2.6 PCR reactions and colony screening
All colonies potentially containing the desired constructs were screened by PCR prior
to sequencing. The PCR amplification reaction consisted of 0.5 µM of each primer, 200 µM
dNTPs, 1x ThermoPol buffer (from 10x, NEB), and 1-3 U of Taq polymerase (NEB). The
PCR program consisted of 2 minutes at 95°C, followed by 30 cycles of: 95°C for 1 minute,
50°C for 30 seconds, 68°C for 1.5 minutes, and ending with 10 minutes at 68°C. All
amplification reactions to generate fragments for cloning were performed identically except
using Vent polymerase (NEB) instead of Taq. The programs typically were run for 35 cycles
and used higher annealing temperatures to enhance specificity. R-type pyocin tail fibre PCR
amplifications were performed with primers ‘PA01-R-fibreC-F’ and ‘PA01-R-fibreC-R’.
22
2.7 P. aeruginosa inductions
From an overnight (O/N) culture grown at 37°C, fresh LB was inoculated to 1% with
O/N culture (typically 50 µl O/N into 5 ml LB) and grown in a shaking incubator at 37°C and
200 rpm until a cell density of OD600=0.5-0.8 was reached. Inducing agents were added at this
point: mitomycin C to 3 µg/ml, IPTG to 1 mM for cells bearing the PrtN construct, and IPTG
to 1 mM followed by mitomycin C 30 minutes later for cells bearing the PrtR S162A
construct. Uninduced (UI) controls were removed from the incubator during the addition of
mitomycin C and IPTG. Shaking incubation at 37°C was resumed for 3-3.5 hours or until
most mitomycin C lysates were cleared. Chloroform (CHCl3) was added to all inductions (1-2
drops/ml), to aid in lysis and ensure no viable bacteria remained. To ensure full lysis of PrtN
cells, 10 µg/ml lysozyme was added prior to chloroform. In order to prevent biasing my
uninduced lysates, these cells were also treated with lysozyme. After the addition of lysozyme
and chloroform where appropriate, inductions were returned to the shaking incubator for 10
minutes prior to centrifugation at 10000+ rpm for 10 minutes to remove cellular debris.
Supernatants containing pyocin and phage activity were stored at 4°C for spotting the
following day.
2.8 Spot assays
Pyocin and phage activity was assessed using the spot assay. In brief, 5 ml of molten
top agar (LB + 0.7% agar) was mixed with 250 µl of O/N culture and spread onto LB + 1.5%
agar plates (rectangular plates, Nunc OmniTray) containing 10 mM MgCl2. For proteinase-
positive plates, 10 µg/ml of proteinase K was added to the molten top agar mixture prior to
spreading. For standard circular plates, 3 ml of top agar and 150 µl of O/N culture were used
instead. After cooling for at least 15 minutes, serial dilutions of P. aeruginosa lysates were
spotted onto the plate and allowed to sit at room temperature until the liquid dried. Plates were
then incubated at 30°C overnight in an inverted orientation. Assessment of activity was
recorded by noting the highest dilution to which each agent was active, the strength of
clearing (eg. clouded versus clear), variations in the edges of each clearing (diffuse or faint
edges versus crisp edges), clearing size (equal to the liquid spotted originally or diffusing
beyond this region) and by noting plaquing as opposed to pyocin-like clearings. All spotting
23
for the large scale screen of pyocin and phage activity was performed using a 96-pronged
pinning device that transfers ~1ul of liquid per sample from a 96-well plate. All other spotting
was performed using a multi-channel pipette dispensing 2 ul per spot.
2.9 Transformations
Transformations in E. coli were done using calcium chloride competent DH5$ cells.
Cold cells were mixed with 1 µl of vector DNA and heat shocked at 42°C for 45 seconds
before plating on selective plates. Transformation of Fab-expressing constructs into E. coli
55244 cells were done by the KCM method of Chung and Miller60.
Transformations in P. aeruginosa were performed either by triparental mating or
electroporation. The triparental mating protocol was adapted from Goldberg and Ohman61. In
brief, E. coli cells bearing the plasmid of interest are mixed with pRK2013-bearing E. coli
cells and the target P. aeruginosa cells. pRK2013 expresses factors that facilitate conjugation
between the plasmid-bearing E. coli cells and target P. aeruginosa cells. The mix of cells is
plated on LB plates and incubated at 30°C overnight. Successful conjugation events are
selected for first on Pseudomonas Isolation Agar (BD) to kill all E. coli cells, followed by
selection on LB + carbenicillin (50 µg/ml) plates. Electroporations were done by the method
of Choi et al62. Briefly, this method required washing cells from overnight cultures with 300
mM sucrose prior to electroporation at 1600 kV and plating on selection plates. Both methods
were employed because some strains were not transformable by one method, necessitating the
other.
2.10 Protein purification
Proteins PA0622 (R-type sheath), PA0623 (R-type tail tube), and PA0633 (F-type tail
tube) were expressed in the E. coli strain BL21. Overnight cultures from a fresh
transformation were used to inoculate LB media. Cells were grown to an OD600 of 0.6-0.8
prior to induction with 100 µg/ml IPTG. After 3-4 hours of induction, cells were harvested by
centrifugation at 6000g for 10 minutes and the pellets were stored at -70°C. Pellets were
thawed and resuspended in 1/30 of original media volume in binding buffer (50 mM
NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0). Protease inhibitor complex (PIC) and
24
lysozyme were added to the resuspension and incubated on ice for 30 min. Sonication lasted
for 5 minutes (30 sec on/30 sec off), after which debris was pelleted at 12000g for 30 minutes
at 4°C. The supernatant was incubated for 15 minutes at 4°C with 1 ml of Ni-NTA resin that
had been pre-equilibrated with binding buffer. This mixture was transferred to a 1-inch
diameter protein purification column. Resin was washed 5-8 times with 10 ml of wash buffer
(50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0) prior to elution in elution buffer
(50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0). Protein preparations were
dialyzed against 2x 4L of PBS. Proteins were visualized on 15% polyacrylamide Tris-Glycine
gels stained with Coomassie blue. Protein concentrations were calculated based on absorbance
of the samples at 280 nm or using the standard Bradford assay (BioRad reagant).
Purifications of AbA through AbF were performed identically excepting the growth
conditions. Overnight cultures (5 ml) from a fresh transformation were used to inoculate 500
ml of CRAP media (27 mM (NH4)2SO4, 2.4 mM NaCitrate-2H20, 14 mM KCl, 0.53% w/v
yeast extract, 0.53% w/v Hy-Case SF Casein, 110 mM MOPS pH 7.3, 0.55% glucose, 7 mM
MgSO4) + 100 µg/ml carbenicillin. Cells were incubated for 24 hours in a rotating incubator at
30°C prior to harvesting as described above.
2.11 Immunoblot assays
All immunoblot assays were performed by transferring proteins from SDS
polyacrylamide gels to nitrocellulose membranes (BioRad) in a semi-dry transfer apparatus
(BioRad). Transfer duration was 45 minutes at 10V. Ponceau staining (Sigma) according to
manufacturer’s instructions was used to verify proper transfer. Blots were blocked in 5% non-
fat milk in TBST (50 mM Tris-HCL pH 7.5, 150 mM NaCl, 0.05% Tween-20) or PBST (137
mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.4 mM KH2PO4, 0.05% Tween-20) for 1 hour
and then transferred to primary antibody (synthetic antibodies (Fabs): AbA-AbF, typically
1/50 dilution) for overnight incubation at 4°C. Anti-FLAG (mouse) antibody (Sigma, 1/15000
dilution) was incubated the next day for 1 hour at room temperature, followed by goat anti-
mouse IgG-HRP (Santa Cruz Biotechnology, 1/2000 dilution) for 1 hour. At least 3 vigorous
washes with TBST or PBST for 5 minutes were performed between each antibody application
and before developing. Blots were developed using enhanced chemiluminescence (ECL Plus,
25
Amersham) according to manufacturer’s instructions. All antibodies were diluted in 5% milk
TBST or PBST consistent with the blocking solution.
2.12 Identification of overlapping activities with spin filters
Using 100 kDa spin filters (Centricon), lysates were investigated for overlapping
pyocin activities. Briefly, lysates of interest were dialyzed against 4L of PBS. 15 ml of the
pyocin/PBS solution was spun through the filter such that 1 ml remained in the retentate and
14 ml in the eluate (typically 2 hours at 5.3 k RPM). Fractions of this eluate and retentate were
stored before adding 14 ml of PBS to the filter. A second spin was performed and the
respective eluates and retentates were stored. All fractions were spotted on lawn strains with
or without proteinase K (10 µg/ml) to detect separable activities.
2.13 Competitive pyocin binding using Fabs
Two methods for selective inhibition of tail-like pyocins were attempted. In the first,
purified Fab solutions were diluted to 1/10 in crude PA01 mitomycin C lysates and incubated
at room temperature for 1 hour prior to spotting. Each sample was compared to unincubated
lysate and lysate incubated with PBS (control). In the second method, Ni-NTA resin was also
incubated with Fab and lysate at 4°C for 20 minutes. After centrifugation, supernatant was
removed. Resin mixture was washed twice in binding buffer (see section 2.9) and elution
buffer was used to extract potential binders. Both supernatant and eluates were spotted with
controls to test for pyocin activity.
26
Chapter 3 Results
3.1 Regulatory constructs
3.1.1 Overexpression of PrtN
To induce pyocins cheaply and independently of phage, the ORF of PrtN, the pyocin
activator (from strain PA01), was cloned into an E.coli / P. aeruginosa shuttle vector
pMMB67EH. By inducing the production of PrtN independently of the DNA damage
response in P. aeruginosa, we expected that pyocins of all types would be induced and
prophages would not be induced as they would generally be regulated by different proteins.
As seen in Figure 5a, initial tests of PrtN overexpression in P. aeruginosa strain PA01 cells
revealed that PrtN induces pyocins beyond uninduced concentrations, as anticipated. Pyocin
concentrations in PrtN lysates were comparable and often higher than in mitomycin C lysates.
Variations in induction length and concentration of IPTG (the inducing agent) had minimal
effect on pyocin induction by PrtN. Some troubleshooting aimed at generating consistent
lysates was required and is described in Appendix B.
27
We anticipated that prophages should not be induced in PrtN overexpression lysates.
However, it quickly became clear that some P. aeruginosa phages are produced beyond basal
concentrations (titre) in the presence of PrtN and absence of mitomycin C, as shown in Figure
5b. More commonly, prophages were not induced by PrtN and thus had equal or lower titres
than an uninduced lysate of the same producing strain, as shown in Figure 5c. The existence
of some responsive prophages suggests their regulation by PrtN-like sequences, and more
generally, the possibility of pyocin and phage co-regulation. The frequency of this
phenomenon in a larger sample of P. aeruginosa strains will be discussed further on.
3.1.2 Overexpression of PrtR mutants
To induce phages in the absence of pyocins we pursued a strategy of manipulating the
pyocin repressor, PrtR. The pyocin repressor belongs to a family of phage repressors known to
bind regulatory DNA sequences as dimers in non-stress conditions, achieving transcriptional
repression of target genes by interference of RNA polymerase. The phage ! repressor, cI, has
a well characterized domain topology that is conserved in PrtR, depicted in Figure 6.
As described in the introduction, PrtR must self-cleave to allow for the production of PrtN
protein and subsequently pyocin particles. This self-cleavage is achieved by nucleophilic
attack by the catalytic site on the cleavage site in the presence of activated RecA under stress
conditions (eg. DNA damage). Well characterized mutations in cleavage and catalytic sites of
cI have been shown to be cleavage deficient63,64,65. We hypothesized that cleavage-deficient
mutants of PrtR will completely inhibit pyocin production in the presence of activated RecA
28
during the DNA damage response, maintaining repression of the PrtN locus even while
wildtype PrtR is cleaved. Point mutations in PrtR (S162A, A121T) were created to mirror
known cleavage-deficient mutants of the cI cleavage and catalytic sites. The matching
locations of these sites were determined based on multiple sequence alignments between
PrtR, cI, LexA, and other related repressors (Figure 7).
In order to test our hypothesis, cells overexpressing PrtR S162A and A121T were induced
with mitomycin C and assayed for pyocin activity compared to uninduced and mitomycin C
controls (Figure 8a). Both mutants were shown to completely downregulate pyocin activity in
response to mitomycin C either when not induced by IPTG or when induced with IPTG before
mitomycin C. The former result suggests that leaky expression from the pMMB67EH vector
is sufficient to induce PrtR S162A and A121T to concentrations that are able to completely
shutdown pyocin induction. Furthermore, the complete repressive effect on pyocin production
seen herein can be attributed to the specific mutations created. Indeed, overexpression of
wildtype PrtR from the same vector decreased pyocin production ~100 fold compared to
mitomycin C lysates in all cases tested (see example in Figure 8b), but did not cause total
repression. Thus, the PrtR mutants create the expected phenotype and thus are assumed to be
cleavage deficient, providing us with a mechanism of shutting down pyocin production in
Pseudomonas aeruginosa cells.
With respect to phage activity, our initial expectation was that overexpression of PrtR
point mutants should not restrict phage induction during the DNA damage response. However,
in investigating these constructs it became evident that a number of phages were repressed by
29
PrtR expression, suggesting that these phages are regulated by a homologous repressor. As
seen in Figure 8c, a phage produced from strain A9 was induced to a lower titer in a PrtR
mutant background with mitomycin C as compared to the wildtype mitomycin C control.
Further, the strength of repression was directly related to both the presence of IPTG,
confirming the expression or PrtR is causing the effect, and to the specific mutant
overexpressed, demonstrating that S162A has a stronger effect. For this reason, PrtR S162A
was used throughout the remainder of my work. Initial investigations also revealed a number
of non-repressed phages (as originally anticipated), as shown in Figure 8d. As shown, a phage
produced from strain F9 was not affected by PrtR mutant overexpression as demonstrated by
its identical titre in response to mitomycin C regardless of background.
30
3.2 Screen of pyocin and phage activity
3.2.1 Methods and interpretation of spotting
In order to delineate the relative activities of each killing agent from a panel of strains,
we capitalized on the unique attributes of the regulatory constructs above, the capacity for
proteinase K to inhibit S-type pyocins, and the resolution of phage infections into individual
plaques. The strains investigated consisted of roughly half of our total collection (43/88).
These strains were selected based on their sensitivity to carbenicillin and therefore their
capacity to be used in tandem with the pMMB67EH ("-lactamase) regulator constructs. For
each strain, four lysates were generated in tandem under the following conditions: (1)
uninduced wildtype cells as a negative control, (2) mitomycin C-induced wildtype cells, (3)
PrtN-overexpressing cells induced with IPTG, and (4) PrtR S162A-overexpressing cells
induced first with IPTG followed by mitomycin C 30 minutes later. Each of these lysates was
serially diluted (10-fold to 10-3) and replica spotted against lawns of eighteen P. aeruginosa
strains with and without proteinase K in the top agar. These eighteen strains were chosen by
another student, Joe Bondy-Denomy, for their diverse susceptibility to phage infection. Given
the shared ancestry of phages and pyocins, it is reasonable to expect that this strain collection
will also be diversely susceptible to pyocin killing (as is confirmed later in this thesis). As
well, using this same strain set allows for direct comparisons between our respective work.
Thus, for each strain, lysates generated under the four different conditions were spotted
against a total of 36 lawn/proteinase K combinations to assess pyocin and phage activity.
Killing activities observed in this screen were categorized based on their response to
proteinase K, dilution, and the regulatory constructs, as depicted in Figure 9. Tail-like pyocin
activities were identified as protease-resistant circular clearings (not plaques) generated by
mitomycin C and/or PrtN lysates (Figure 9a). S-type pyocin activities were identified as
protease-sensitive circular clearings generated by mitomycin C and/or PrtN lysates (Figure
9b). S-type pyocins typically generated ‘diffuse’ activities characterized by clearing beyond
the initial diameter of spotted lysate with a jagged or faded edge (diffuse edge), as shown in
Fibure 9b. Bacteriophages were identified as protease-resistant activities that resolve into
plaques upon dilution (Figure 9c). Phage activities were commonly induced by mitomycin C
31
beyond basal (uninduced levels), and were variably responsive to regulation by the pyocin
regulators. Furthermore, all pyocin activities were confirmed by their downregulation in PrtR
S162A lysates, and this also allowed for the discovery of phage activity that was previous
hidden by pyocins. Such activities were also often observable in the uninduced lysates, where
background phage levels are typically much higher than pyocin. Conversely, in the case of
phages obscuring underlying pyocin activity, PrtN overexpression lysates frequently revealed
an underlying pyocin in instances where phages were not induced by PrtN.
PrtN overexpression was also found to induce S-type pyocins greatly. These protease-
senstive pyocins were commonly induced to a higher concentration in PrtN lysates compared
32
to mitomycin C lysates, and further, 55 S-type pyocin activites were only identified in PrtN
lysates (which would have otherwise been missed). Their favourable induction by PrtN also
allowed for the identification of numerous overlapping tail-like and S-type pyocin activities.
As depicted in Figure 9d, when a tail-like pyocin is observed in the mitomycin C lysate, a
larger, more diffuse protease-sensitive activity observed from the PrtN induced lysate can be
characterized as an S-type pyocin. This diffuse activity is removed by proteinase K, and its
absence (or more likely, obfuscation) in the mitomycin C lysate suggests it is a separate agent
from the tail-like pyocin. Thus, the regulatory constructs allow for finer specificity in
characterizing the various killing agents, and, in particular, allow for the more precise
identification of overlapping activities (both pyocin-pyocin and pyocin-phage).
In cases where mitomycin C and PrtN-induced lysates identically produce a protease-
resistant (tail-like) pyocin that appears visually different (but still active) between the protease
positive and negative plates, there can be two explanations. The first is that this pattern
represents two overlapping activities, one of which is an S-type and the other an R-/F-type
pyocin. The overlying S-type pyocin activity appears diffuse and is visible beyond the border
of the R-/F-type range, but is absent in the presence of protease. The second possibility is that
the protease is modifying some component of a tail-like pyocin such as an exopolysaccharide
(EPS)-degrading enzyme. The protease may not inhibit basal killing activity but nevertheless
produces a visually distinct and likely disadvantageous morphology (for the pyocin). Such
EPS-degrading enzymes are frequently found in phage genomes and are known to be
important for phage infectivity in biofilm structures66. Given the capacity for pyocins to infect
in biofilm settings67, it is reasonable to expect that such enzymes be displayed on tail-like
pyocins.
In order to test these possibilities, I utilized 100 kDa spin filters that should allow S-
type pyocins to flow through the device (elution) while tail-like pyocins, being much larger
than 100 kDa, should remain in the top of the device (retentate). In doing so, I identified
instances where both the dual-pyocin and pyocin-encoded enzyme hypotheses seem likely. In
Figure 10a, I demonstrate a case where the visually distinct (diffuse) activity was retained in
the top of the device, implying its association with the tail-like pyocin (Figure 10a).
Oppositely, in Figure 10b, the visually distinct activity eluted through the device, implying its
33
generation by an S-type pyocin. In my current data set, I have scored these cases as tail-like
pyocin only, because I did not have sufficient time to verify all instances where the activity
appears different with the addition of protease. Thus, in my current data set I may be
underestimating the frequency of S-type pyocin action while correctly recording the frequency
of R-/F-type pyocin activity.
34
3.2.2 Killing activities generated
In total, 774 lysate and lawn combinations (43 lysates x 18 indicator strains) were
surveyed under the above conditions, from which 431 pyocin and phage activities were
observed. The methods described so far can characterize each killing activity as coming from
one of three groups: an S-type pyocin, a tail-like (R-/F-type) pyocin, or a bacteriophage.
Among these 431 activities, the relative contribution of each type of agent breaks down as
follows: 52.4% were caused by tail-like pyocins, 38.5% by S-type pyocins, and the remaining
9.1% by phages (see Figure 11).
Generally, this suggests that tail-like pyocins have larger host ranges, and thus a stronger
capacity to modulate P. aeruginosa populations. If we investigate the P. aeruginosa collection
on a strain-by-strain basis, we reveal similar patterns with respect to the production of each of
these agents. Specifically, at least one tail-like pyocin was produced in 93% of strains, at least
one S-type pyocin was produced in 79% of strains, and phage was produced in 35% of strains
35
(See Figure 12). In total, 93% (40/43) of strains tested displayed some level of pyocin activity.
Taken together, these data indicate the relative importance of tail-like pyocins for contributing
to intraspecific population dynamics in this organism.
In order to assess the similarity between the host ranges of each strain, strains were
manually clustered into groups of strains possessing similar host ranges, as shown in Table 3.
Investigation of the clustergram suggests that there are groups of strains possessing very
similar complements of pyocins. For example, strains A7, A8, B7, and B8 largely target the
same strains with variation mostly in the type of pyocin responsible for these activities. Even
more similar are strains B1 and B5, which have identical host ranges except for one activity
(against F11). Despite the existence of such similar groupings, close investigation reveals that
no two strains produce exactly the same complement of pyocins and phages. Thus, there is a
remarkable diversity of killing agent types and combinations, that together allow for P.
aeruginosa strains to uniquely target a subset of their competitors. Interestingly, no
statistically significant correlation was found between the source of each strain (categorized as
clinical or environmental) and the number of killing activities it generates in this screen.
36
Table 3. Host ranges of 43 P. aeruginosa strains grouped together based on similarity. Organized roughly according to number of killing agents produced (highest at top).
37
From this diversity of host ranges, we can identify a number of strains that produce
tail-like pyocins of particular potency as seen in Table 4. These tail-like pyocins are each
capable of killing over half the strains tested, suggesting that a cocktail of these pyocins could
be effective against all strains tested in this screen. Thus, these pyocins merit further
investigation as potential therapeutic agents. Assessment of their stability and reconfirmation
of their host range after purification should be pursued.
3.2.3 Killing susceptibility
With respect to pyocin and phage resistance, these strains displayed a marked diversity
in their capacity to resist killing. The most resistant strain (B8) was killed by only 9 different
agents, whereas the most susceptible strain (C5) was susceptible to 49 different agents (see
Figure 13). It is interesting to note that no strains were resistant to all tail-like and S-type
pyocins, whereas just under half (8/18) of the strains were completely resistant to the phages
tested. Neither S-type or tail-like pyocins were dominant in their capacity to target the most
resistant strains. Nevertheless, the most proficient pyocins found by my screen (Table 4) were
capable of killing these highly resistant strains, highlighting the capacity for finding potential
therapeutic agents against a diversity of target strains from within a relatively small subset of
pyocin-producing P. aeruginosa strains. Similarly to pyocin production, no statistically
significant correlation between the strain source and pyocin/phage susceptibility was found.
38
With respect to susceptibility, another experiment performed sheds further light onto
the necessary receptors for pyocin activity. Briefly, pyocin-containing lysates from six strains
were spotted onto lawns of isogenic mutants of the pilus and flagella in strain PA01 and the
pilus in strain PAK (received from the Burrows lab, McMaster University). These mutants
contain chromosomal deletions of structural proteins necessary for proper pilus (pilA locus)
and flagella (fliC locus) formation. No phage or pyocin activity was observed to be inhibited
in a flagellar mutant versus wildtype, suggesting that these structures do not play a role in
phage or pyocin binding. However, five of six phage and pyocin activities that killed wildtype
PA01 and PAK were incapable of killing their pilus mutants. The sole exception was a tail-
like pyocin produced from E5. We are confident these strains accurately possess abnormal
pilus function because another student in my lab, Joe Bondy-Denomy, confirmed that the
mutants show the expected deficiencies in pilus activity as measured by twitching motility.
Twitching motility is a type IV pili-dependent form of bacterial translocation characterized by
39
extension and retraction of the pilus for movement over abiotic and biotic (eg. lung) surfaces
and is frequently used as a measure of pilus function.
Joe also determined the twitching motility of our entire P. aeruginosa collection as
measured by the diameter of bacterial diffusion on the plastic surface of a plate. Close
investigation of the twitching diameters for the most sensitive strains in my screen (average
diameter = 29.8 +/- 10.6, n = 8) versus the most resistant strains (average diameter = 12.7 +/-
8.1, n = 9) reveal the two groups to be significantly different (p < 0.003, unpaired t-test).
These data suggest that pilus function is correlated to susceptibility, such that the most
resistant strains are also the poorest at twitching. Nevertheless, there are exceptions to these
categories: C5 twitches poorly (average diameter = 4.3 +/- 1.3) and is the most susceptible,
while B8 and E7 twitch strongly (average diameters = 20.3 +/- 2.8 and 26.5 +/- 1.0,
respectively) and are highly resistant. Taken together, these two lines of evidence suggest the
importance of pili to successful pyocin binding. It is known that Pseudomonas phages are
frequently dependent on host pili for normal infection68,69. Given their ancestry, it is not
surprising that tail-like pyocins may also require these structures for normal activity.
However, in the literature this association has not been previously reported; indeed, our
knowledge of pyocin receptors is limited to the LPS interactions described above. These
highly suggestive results do much to encourage further investigation of the pyocin-pilus
interaction.
3.2.4 Pyocin and phage co-regulation
Analysis of the spotting data described so far revealed a remarkable relationship
between the expression of pyocin regulators and the production of numerous P. aeruginosa
bacteriophages. Specifically, 4 of 16 phages identified were found to be upregulated in
response to PrtN overexpression and without mitomycin C induction, when compared to basal
(uninduced) phage titres (see Table 5). Additionally, 7 of 16 phages were found to be
repressed to basal or lower titres in response to mitomycin C induction against the background
of PrtR S162A overexpression. Together, the majority of phages (10/16, 62.5%) had their
regulation affected either positively or negatively by the overexpression of pyocin regulators.
Given our discovery of numerous PrtN and PrtR-like sequences in Pseudomonas genomes, it
40
is possible that the pyocin proteins are directly binding phage regulatory sequences to affect
their regulation.
3.3 Pyocin tail-tube binding proteins
In collaboration with Dr. Sachdev Sidhu and his post-doc, Helena Persson, we
generated antigen-binding fragments (Fabs; substructures of full antibody molecules) that bind
specifically to our target antigens PA0623 (R-type pyocin major tail tube) and PA0633 (F-
type pyocin major tail tube) using established phage display methods. Our primary goal was to
utilize these binding proteins in Western blot analysis to identify the production of R- and F-
type pyocins in lysates from our strain collection. Secondary to this goal, we aimed to use
these binding proteins as a mechanism for purification of pyocin particles, enabling
downstream investigation of pyocins of interest. In light of these dual goals, Fab proteins were
41
selected against native-state antigens in hopes that both denatured and native-state epitopes
would be recognized. The antigen targets were chosen for two reasons: (1) they are both major
components of their respective pyocins and exist in many copies in each pyocin particle, and
(2) among sequenced P. aeruginosa strains these proteins are highly conserved. Specifically,
the average pairwise identity between all known PA0623 homologs is >99% and between
PA0633 homologs it is >95%. Thus, binding proteins raised against antigens purified from
strain PA01 should, in theory, be able to detect homologs among diverse Pseudomonas
strains.
We generated four Fab proteins capable of binding PA0623, termed AbA through
AbD, and two Fab proteins capable of binding PA0633, termed AbE and AbF. Each Fab
contains a 6-His tag that allowed for its purification and a FLAG tag enabling its use as a
primary antibody in western blotting. After initial purification of all six Fab proteins, it
became evident that AbA and AbB performed exceedingly poorly in the context of Western
blotting when used to detect purified antigen and highly concentrated pyocin. Given this, the
remaining four Fab proteins were subsequently utilized for the assessment of pyocin activity
in lysates of interest. Frequent issues with sensitivity (extremely faint bands, non-detection of
controls) necessitated investigation into methods to improve my protocol. Increasing the
concentration of Fab in my primary antibody solution, and concentrating tail-like pyocins
from mitomycin C lysates by ultracentrifugation were found to be reasonably effective. Over
time, it became evident that the consistency of pyocin concentration by ultracentrifugation
was poor. Further troubleshooting revealed that utilizing PBST versus TBST was ideal, and
concentration by a more consistent (albeit ‘dirtier’) method, namely precipitation by
ammonium sulphate, was necessary.
Using these methods, I aimed to test all 43 strains investigated in my screen for the
production of R- and F-type pyocins. From the four best Fab proteins (AbC-F) I selected AbD
and AbF to move forward with for their greater consistency of signal. With respect to R-type
pyocins, I detected their production in 34/43 strains (79%), seven of which are shown in
Figure 14a. Detection of a band in ammonium sulphate-concentrated lysates at the predicted
molecular weight of PA0623 (~18 kDa) was taken as a positive identification given the signal
in both positive controls (PA01 lysate and purified PA0623). Of the four strains found to
42
possess no tail-like pyocins by spotting, only one was shown to produce an R-type pyocin by
Western blotting. It is reasonable to expect that my limited number of lawn strains (18) did not
include a strain susceptible to this particular R-type pyocin. Both strains PA01 and PA14 were
found to always produce an R-type pyocin, consistent with the literature. Efforts to use AbF in
screening for F-type pyocin production were problematic. As shown in Figure 14b, this
antibody (and AbE earlier) was found to consistently detect purified antigen (PA0633) and
PA01 controls, but detected F-type pyocins in only two other strains (C2 and B9). It may be
possible that this limited detection represents the real frequency of F-type production in our
strains or, more likely, that there exists substantial sequence divergence at the PA0633 locus
that prevents proper binding by AbF (beyond what is represented among the four sequenced
strains deposited in NCBI). Perhaps AbF recognizes an epitope of PA01 antigen that is
structurally dissimilar or absent in the PA0633 homologs tested herein.
Given the known relationship between tail-like pyocins and P. aeruginosa phages, Fab
proteins were tested for cross reactivity with phage proteins. Twelve phages isolated from the
same strain collection by another student in the lab, Joe Bondy-Denomy, were used as a test
panel to check for Fab cross reactivity. In Western blots using AbD and AbE, no phage
proteins were found to produce signal while the positive control (purified antigen) did. Phage
preparations used were highly concentrated and pure after cesium chloride purification. That
no phage proteins produced signal suggests that all immunoblotting data described herein
accurately reflect pyocin production (not phage production).
43
The detection of pyocin production by Western blotting is beneficial for its relative
ease (both technically and for its rapidity), however, these confirmed tail-like pyocins cannot
be associated with specific killing activities. In other words, knowing that a particular strain
produces an R-type pyocin does not suggest which strains that pyocin is responsible for killing
(out of the larger host range). Thus, I pursued alternative strategies with these binding proteins
for identifying the specific host range of individual tail-like pyocins. One method aimed to test
whether Fab binding proteins could bind to and selectively inhibit whole pyocin particles as a
means of removing their activity. In theory, a lysate containing both R- and F-type pyocins
could be cleared of F-type pyocins by competitive binding with AbF (for example), and tested
against protease-containing lawns to reveal the host range of the R-type pyocin. Our
expectation is that F-type pyocin antigen (tail tube) should be exposed for Fab binding but that
the R-type antigen is likely obscured by the sheath; nevertheless, all Fab proteins were tested.
Initial testing revealed that simply incubating a mitomycin C-induced lysate with 1/10
volume of purified Fab prior to spotting had no effect on pyocin activity tested against a
diversity of strains, as seen in Figure 15a. In other words, the active concentration of pyocin in
the PA01 lysates tested were the same when incubated with any Fab protein or PBS.
Traditional pyocin inactivations using serum derived from whole pyocin inoculation of mice
have used this methodology70. That no effect on spotting activity was observed against any
strain suggests that these Fabs either do not bind whole pyocin, or do bind whole pyocin
without inhibiting activity. To test this second possibility, nickel resin was incorporated into
the incubation. After spinning down to concentrate the resin and any bound particles (Fab
protein and pyocin if they bind), the supernatant was taken to measure for a detectable
decrease in spotting activity. In addition, after washing, elution buffer that inhibits the 6-His-
resin interaction was used to generate an eluate tested for pyocin activity. As shown in Figure
15b, no evidence of Fab binding to native state pyocin particles was seen.
44
3.4. Tail fibre PCR analysis
As described above, there are five known R-type pyocins characterized to date: R1
through R5. These pyocins are defined by their unique host ranges. However, pyocins R2, R3,
and R4 have highly similar tail fibre sequences (despite different host ranges) and are thus
frequently lumped together, creating three R pyocin groups at the DNA sequence level: R1,
R2, and R5. Given the large diversity of tail-like pyocin activity observed in my screen, we
aimed to assess the sequence diversity of R-type pyocin tail fibres and their 3’ chaperone. This
data was expected to inform our comparison of strain host ranges and investigate the diversity
within.
In order to achieve this, I PCR amplified the R pyocin fibre and chaperone locus using
a primer set that binds conserved sequences flanking these regions. In doing so, we were able
to generate a PCR product of appropriate size (~1.4 kB) for 64% of strains tested (28/44).
Unfortunately, consistently successful sequencing has been elusive and I have therefore only
sequenced seven products to date. These sequences are shown in an alignment with
representative sequences from pyocins R1, R2, and R5 (Figure 18). To date, all sequences fall
45
perfectly into the R1 or R2 categories defined by known sequences. Strain PA14 was
confirmed to contain an R2 pyocin as expected. A comparison of the spotting results of these
strains possessing identical R-type pyocins reveals substantial overlap of tail-like pyocin
activity. One exception to this is strain D3, from which I did not detect tail-like pyocin activity
in my screen. This could suggest that D3 harbors an R-type pyocin locus (or at least the tail
fibre region) but does not produce an R-type pyocin, or perhaps my induction of this strain
was improperly done. The R2 grouping found here (PA14, C2, C12) have closely related host
ranges, suggesting that the R2 pyocin is responsible for much of this killing.
Using a similar strategy to assess the sequence diversity of the F-type pyocin locus is
infeasible. Specifically, the region encoding the putative tail fibre and baseplate in F-type
pyocins is highly variable both in terms of flanking diversity and number of ORFs (among
sequenced strains). As such, a PCR strategy to assess this region would require a new primer
set for each strain, an impossibility given that this strain collection remains unsequenced. In
addition, the exact determinants of specificity in F-type pyocins remain unknown.
46
Chapter 4 Discussion and Future Directions
The experiments described herein have aimed to assess the diversity of pyocin and
phage activity generated from a collection of P. aeruginosa strains. Upon initiation of this
project, no large scale screen of pyocin activity had been reported. However, in the meantime
two papers have been published that investigated the pyocin activity and susceptibility of
clinical strain collections. The first of these, by Kohler et al., surveyed the susceptibility of P.
aeruginosa isolates from tracheal aspirates to R1, R2, and R5 pyocins46. Efforts were made to
correlate the serotype of each strain with both R-type pyocin production and susceptibility,
and to identify the frequency of R-type pyocin production by PCR. The second paper, by
Bakkal et al., outlined an all-by-all screen (similar to my own) investigating the killing
activities and susceptibilities of 38 P. aeruginosa strains and 28 Burkholderia cepacia strains
derived from cystic fibrosis patients19. Efforts were made to group the observed killing agents
as from R-/F-type pyocins, S-type pyocins and bacteriophages. A particular focus was put on
investigating the capacity for these two species to kill each other via bacteriocins. While both
of these studies investigate pyocin production and susceptibility, neither paper gives
consideration to the contribution of bacteriophages, the possibility of overlapping activities, or
the regulation of these agents.
In my own screen, 98% (42/43) of strains produced at least one killing agent,
consistent with the Bakkal et al. paper which reported a similar value of 92%19. More
specifically, the frequency of tail-like pyocin production (93%) and S-type pyocin production
(79%) found herein are consistent with the literature. For example, R-type pyocin loci have
been estimated to be present in 74 and 72 percent of strains, and 90 percent or more are
thought to possess at least one tail-like pyocin locus19,30,46. Furthermore, the Bakkal paper
identified S-type pyocin loci in 95% of strains, and another review suggests that
approximately 70 percent of strains encode one or more S-type pyocins30, in general
agreement with my data. Thus, P. aeruginosa appears to be a prolific producer of bacteriocins.
The totality of the spotting data generated herein suggests a larger role for S-type
pyocins and bacteriophages in affecting P. aeruginosa populations than previously
47
recognized. Earlier studies have focused largely on the contribution of tail-like pyocins. One
such paper claims that 98% of intraspecific killing in P. aeruginosa results from pyocin
activity but was published before the discovery of S-type pyocins and so does not comment on
their contribution20. Recently, Bakkal et al. identified no bacteriophage activity in 38 P.
aeruginosa isolates and identified the specific contribution of S-type pyocins to killing in
only 2 cases versus 24 for the tail-like pyocins19. This may suggest that P. aeruginosa isolates
from cystic fibrosis patients are differentially susceptible to these classes of agents. In my
data, the activity of S-type pyocins and bacteriophages together represent almost half (48%) of
all killing, and are derived from diverse environmental and clinical strains. This diversity of
killing activities is highlighted particularly by my finding that no two strains of our 43 strain
collection produce identical host ranges. As such, the pyocin and phage diversity generated
from this broad subset of P. aeruginosa strains is enormous.
In general, this study reveals tail-like pyocins to be the dominant player among the
milieu of P. aeruginosa killing agents, representing 52% of all killing. In particular, these
agents appear to have larger host ranges than S-type pyocins or bacteriophages, a promising
result in light of the long-term goal of developing therapeutics based on these structures. This
greater host range can likely be explained, at least in part, by the limited number of host
systems within which resistance can develop, as compared to those necessary for phage
replication. Specifically, a complete phage infection relies at the very least on the proper
binding to the target cell surface, injection of DNA, manipulation of host transcriptional and
translational machinery, the packaging of new virions, and subsequent cellular lysis.
Comparatively, phage-tail like pyocins require only the proper interaction with host
membrane structures for the generation of a lethal pore. Regardless, the capacity to target a
wider variety of strains is surely a benefit for a potential therapeutic. Furthermore, the Bakkal
paper suggests that R-/F-type pyocins are dominant in their capacity to kill cystic fibrosis
isolates, a beneficial feature in the context of P. aeruginosa therapy.
The construction of pyocin regulatory constructs has allowed us to achieve a higher
degree of specificity and accuracy when assessing the pyocin and phage activity of our strain
collection. The overexpression of PrtN was found to induce pyocins to concentrations
comparable with mitomycin C lysates, consistent with our prediction. In this manner, we were
48
frequently able to doubly identify putative pyocin activities. As well, PrtN overexpression was
found to commonly induce the diffusible S-type pyocins to a huge extent, generating lysates
that, when spotted, produced visibly larger clearings through higher dilutions. This particular
result suggests that S-type pyocins are solely under the control of PrtN whereas other factors
present in the context of induction through the SOS response may help to induce tail-like
pyocins. Indeed, tail-like pyocins were more inconsistently produced in PrtN lysates.
Nevertheless, the stark effect on S-type pyocin production by PrtN allowed for the discovery
of these pyocins in numerous cases where they would otherwise have been obscured.
The PrtR cleavage-deficient mutant constructs were found to completely repress
pyocin activity in all cases (43 strains), demonstrating the dominance and conservation of this
repression system for controlling pyocin production. Using this construct, all putative pyocin
activites could be definitively confirmed as pyocins, and not phages. Furthermore, the
combined use of PrtN and PrtR S162A allowed for the separate identification of overlapping
phage and pyocin activities in a number of cases. In addition, a fortuitous result of this study
was the demonstration of pyocin and phage co-regulation by the pyocin regulatory system.
The majority of the small phage collection isolated in this work was either positively induced
in the presence of PrtN (without mitomycin C) or negatively repressed in the presence of PrtR
S162A (during mitomycin C induction). One phage was demonstrated to be affected by both
regulators. This co-regulation could represent an evolutionary relic given the shared ancestry
of pyocin and phages. In particular, it is possible that PrtR and PrtN recognize regulatory
DNA sequences in those phages from which they have most recently diverged. This effect
may be enhanced by the presence of a huge overabundance of pyocin regulator protein which
may have negative impact on their specificity. Alternatively, this co-regulation could be the
result of selection. It could be advantageous for phages to only induce when pyocins do,
particularly in the case of escaping a cell that will lyse imminently due to pyocin activation.
Conversely, perhaps the co-regulation of phages and pyocins can benefit P. aeruginosa by
preventing unwanted phage-induced lysis in lysogenized cells.
Another interesting discovery of this study was the identification of tail-like pyocins
that are visibly different in protease negative and positive backgrounds. This result suggests
some tail-like pyocins may encode enzymes that aid in diffusion of these particles away from
49
the original spotted liquid, which might suggest the presence of an EPS-degrading enzyme.
Given the abundance of these structures in bacteriophages and the capacity for pyocins to act
in biofilm settings, their expression would be not surprising. To date, there are no reports of
such pyocin-encoded enzymes in the literature, but these data justifies further exploration of
this phenomenon.
With respect to susceptibility, the eighteen strains used as lawns displayed a huge
diversity in their capacity to resist killing by pyocins and phages. The strains were susceptible
to between 9 and 49 killing agents each, and none was completely resistant to S-type and tail-
like pyocins. This diversity of resistance may be attributable to the previously reported
pyocin-LPS interaction. However, a previously unreported dependence of pyocins on type IV
pili was demonstrated in a small number of cases herein, and may be related to this variable
susceptibility. In particular, there was a strong association between P. aeruginosa sensitivity
to all killing agents and pilus function assessed by twitching motility. The most resistant
strains generally had lower pilus function, implicating this structure in pyocin binding. These
preliminary results could be followed by an investigation into the frequency of this
phenomenon among a larger sample of pyocins. If most pyocins are pilus-dependent as these
data suggest, then a more thorough investigation of the interaction is warranted. Many
avenues could be pursued, perhaps beginning with investigating the effects of pili regulation
on pyocin susceptibility and testing the capacity for purified pili to bind pyocins.
In order to separate the contributions of R- and F-type pyocins from the broader
category of ‘tail-like pyocins’, we pursued a strategy of generating Fab binding proteins to
identify each agent. In the Fab selection process, native state antigen (tail tube protein) was
used as the target with the goal of generating antibodies that would be capable of binding fully
formed pyocin particles yet also retain specificity when binding denatured antigen in Western
blotting. We successfully identified R-type pyocin production in 79% of P. aeruginosa strains
tested. This number is highly consistent with the reported frequency of R-type pyocin loci
(77%) detected by PCR in Kohler et al.46. My attempts to assess F-type pyocin production
using these Fab proteins were largely unsuccessful given the positive identification of only
three strains (including PA01). Likewise, all attempts at using Fabs to inhibit pyocins were
unsuccessful. There is no evidence to suggest that these proteins can bind whole pyocins as
50
hoped. It is likely that the target epitopes recognized by the Fab protein in the native state
monomer are hidden after polymerization into a complete tail. Similarly, these epitopes may
not even exist in the polymerized form if the tail tube structure is significantly changeable
during this process.
Another method for investigating the specific contributions of the tail-like pyocins
capitalized on sequencing analysis of the R-type pyocin tail fibre locus. This method has been
pursued only recently but shows promise given that we have successfully identified a number
of pyocins in agreement with known sequences. To date, all pyocins have fallen into the R1
and R2 groups, which are expected to represent about half the pyocin population based on
previous estimates46. However, the recent paper by Kohler et al. was unable to detect R-type
pyocin loci by PCR in 28% of isolates46. Using primers that bind independently of R pyocin
type, like those used in this study, could help elucidate whether this 28% contains novel
pyocin types and whether the three R-type pyocin groups accurately represents the total R-
type pyocin population at the sequence level (beyond simple primer binding).
Despite the setbacks in identifying the specific host range of tail-like pyocins revealed
in this study, I have generated substantial information from which further investigations can
spring. The huge diversity of pyocin activity revealed in this screen suggests that naturally
occurring pyocins exist that are capable of targeting most, if not all strains of therapeutic
interest. Indeed, the recent paper by Bakkal et al. identified strains producing pyocins that
could kill the majority of their strain collection19, similar to my own findings. Furthermore, I
have identified a subset of strains possessing tail-like pyocins of ideal potency (minimally,
four, but this could be enlarged based on the next strongest killers). Focusing on these strains,
effort could be put toward identifying the relative contribution of each tail-like pyocin by
purifying these pyocins using the traditional methods of Kageyama et al.22. As well,
expanding the strain collection upon which pyocins of interest are tested could help to answer
whether these pyocins are exceptional or perhaps are targeting the eighteen strains tested so
far more frequently (by chance) than other potential strains. Furthermore, should purification
of these pyocins prove troublesome, a genetic knockout approach has been shown to be
effective for abolishing R-type pyocin production in two sequenced and one unsequenced P.
aeruginosa strain46. These strains were made to harbor a 2.2 kB deletion at the tail fibre locus.
51
This strategy could be utilized to determine the specific host ranges of tail-like pyocins by
subtraction.
The need for novel antibiotics targeting P. aeruginosa and other pathogens is greater
than ever given the epidemic of highly drug resistant strains appearing worldwide. R- and F-
type pyocins represent strong candidates for Pseudomonas therapy given their capacity to
target a diversity of strains and reliance on few host structures. In addition, the two host
structures identified to be important for pyocin binding, the type IV pili and
lipopolysaccharide, are both important for the establishment of infection and biofilm
formation45,71,72,73 . Thus, mutations in these structures that grant resistance to pyocins may
also compromise virulence. Identification and characterization of strong therapeutic
candidates (begun here) is necessary to move forward. An ideal strategy might begin with
pyocins known to be highly stable and identified to have a large host range. Cocktails of such
pyocins could be used in the manner of phage therapy to combat entrenched infections.
Further specificity could be engineered by the tail-fibre fusion methods pioneered by Williams
et al48. These strategies capitalize on the strengths of phage therapy without its major
detractions (lysogeny for resistance, horizontal transfer, cellular lysis, etc.).
52
References
1. Lyczak JB, Cannon CL, Pier GB. Establishment of Pseudomonas aeruginosa infection :
lessons from a versatile opportunist. Microbes and Infection. 2000;2(9):1051-1060.
2. Hassett DJ, Korfhagen TR, Irvin RT, et al. Pseudomonas aeruginosa biofilm infections in
cystic fibrosis: insights into pathogenic processes and treatment strategies. Expert Opinion on
Therapeutic Targets. 2010;14(2):117-30. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/20055712.
3. Yoshimura F, Nikaido H. Permeability of Pseudomonas aeruginosa outer membrane to
hydrophilic solutes. Journal of bacteriology. 1982;152(2):636-42. Available at:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=221510&tool=pmcentrez&rendert
ype=abstract.
4. Hancock RE. Resistance mechanisms in Pseudomonas aeruginosa and other
nonfermentative gram-negative bacteria. Clinical Infectious Diseases. 1998;27:S93-99.
5. Foweraker J. Recent advances in the microbiology of respiratory tract infection in cystic
fibrosis. British medical bulletin. 2009;89:93-110. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/19155262.
6. Spellberg B, Powers JH, Brass EP, Miller LG, Edwards JE. Trends in antimicrobial drug
development: implications for the future. Clinical infectious diseases. 2004;38(9):1279-86.
Available at: http://www.ncbi.nlm.nih.gov/pubmed/15127341.
7. Uchiyama J, Sakurai S, Ujihara T, et al. Bacteriophage therapy : a revitalized therapy
against bacterial infectious diseases. Journal of Infection and Chemotherapy. 2005;11:211-
219.
8. Boulanger P, Letellier L. Characterization of ion channels involved in the penetration of
phage T4 DNA into Escherichia coli cells. The Journal of Biological Chemistry.
1988;263(20):9767-75. Available at: http://www.ncbi.nlm.nih.gov/pubmed/2454920.
53
9. Duckworth DH. Biological Activity of Bacteriophage Ghosts and " Take-Over " of Host
Functions by Bacteriophage. Bacteriological Reviews. 1970;34(3):344-363.
10. Uratani Y, Hoshino T. Pyocin R1 Inhibits Active Transport in Pseudomonas aeruginosa
and Depolarizes Membrane Potential. Journal of Bacteriology. 1984;157(2):632-636.
11. Kerr B, Riley MA, Feldman MW, Bohannan BJ. Local dispersal promotes biodiversity in
a real-life game of rock-paper-scissors. Nature. 2002;418:171-4. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/12110887.
12. Riley MA, Goldstone CM, Wertz JE, Gordon D. A phylogenetic approach to assessing the
targets of microbial warfare. Journal of Evolutionary Biology. 2003;16:690-7. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/14632232.
13. Klaenhammer TR. Bacteriocins of lactic acid bacteria. Biochimie. 1988;70(3):337-49.
Available at: http://www.ncbi.nlm.nih.gov/pubmed/8398217.
14. Heo Y, Chung I, Choi K, Cho Y. R-Type Pyocin is Required for Competitive Growth
Advantage Between Pseudomonas aeruginosa Strains. Journal of Microbiology
Biotechnology. 2007;17(1):180-185.
15. Blackwell C, Winstanley F, Brunton T. Sensitivity of thermophilic Campylobacters to R-
type pyocines of Pseudomonas aeruginosa. Journal of Medical Microbiology. 1982;15(2):247-
251.
16. Morse SA, Vaughan P, Johnson D, Iglewski BH. Inhibition of Neisseria gonorrhoeae by a
bacteriocin from Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy.
1976;10(2):354-362.
17. Campagnari AA, Karalus R, Apicella M, et al. Use of Pyocin To Select a Haemophilus
ducreyi Variant Defective in Lipooligosaccharide Biosynthesis. Infection and Immunity.
1994;62(6):2379-2386.
18. Jones LF, Thomas ET, Stinnett JD, Gilardi GL, Farmer JJ. Pyocin Sensitivity of
Pseudomonas Species. Applied Microbiology. 1974;27(1):288-289.
54
19. Bakkal S, Robinson SM, Ordonez CL, Waltz DA, Riley MA. Role of bacteriocins in
mediating interactions of bacterial isolates taken from cystic fibrosis patients. Microbiology.
2010;156:2058-67. Available at: http://www.ncbi.nlm.nih.gov/pubmed/20378653.
20. Farmer JJ, Herman LG. Epidemiological Fingerprinting of Pseudomonas aeruginosa by
the Production of and Sensitivity to Pyocin and Bacteriophage. Applied Microbiology.
1969;18(5):760-765.
21. Jacob F. Biosynthese induite et mode d'action d'une pyocine, antibiotique de Pseudomonas
pyocyanea. Annales de l'Institut Pasteur. 1952;86:149-160.
22. Kageyama, M, Egami F. On the purification and some properties of a pyocin, a bacteriocin
produced by Pseudomonas aeruginosa. Life Sciences. 1962;1(9):471-476.
23. Kageyama M. Studies of a Pyocin. I. Physical and Chemical Properties. The Journal of
Biochemistry. 1964;55(1):49-53.
24. Kageyama M, Ikeda K, Egami F. Studies of a Pyocin. III. Biological Properties of the
Pyocin. The Journal of Biochemistry. 1964;55(I):59-64.
25. Shinomiya T. Phenotypic Mixing of Pyocin R2 and Bacteriophage PS17 in Pseudomonas
aeruginosa PAO. Journal of Virology. 1984;49(2):310-314.
26. Shinomiya T, Ina S. Genetic comparison of bacteriophage PS17 and Pseudomonas
aeruginosa R-type pyocin. Journal of Bacteriology. 171(5):2287-2292.
27. Takeya K, Minamishima Y, Amako K, Ohnishi Y. A Small Rod-Shaped Pyocin. Virology.
1967;31(1):166-168.
28. Kuroda K, Kageyama M. Comparative study of F-type pyocins of Pseudomonas
aeruginosa. The Journal of Biochemistry. 1981;89:1721-1736.
29. Ito S, Kageyama M, Egami F. Isolation and Characterization of Pyocins from Several
Strains of Pseudomonas aeruginosa. Journal of General and Applied Microbiology.
1970;16:205-214.
55
30. Michel-Briand Y, Baysse C. The pyocins of Pseudomonas aeruginosa. Biochimie.
2002;84:499-510.
31. Parret A, De Mot R. Novel bacteriocins with predicted tRNase and pore-forming activities
in Pseudomonas aeruginosa PA01. Molecular Microbiology. 2000;35(2):472-473. Available
at: http://doi.wiley.com/10.1046/j.1365-2958.2000.01803.x.
32. Soelaiman S, Jakes K, Wu N, Li C, Shoham M. Crystal structure of colicin E3:
implications for cell entry and ribosome inactivation. Molecular Cell. 2001;8(5):1053-62.
Available at: http://www.ncbi.nlm.nih.gov/pubmed/11741540.
33. Ling H, Saeidi N, Rasouliha BH, Chang MW. A predicted S-type pyocin shows a
bactericidal activity against clinical Pseudomonas aeruginosa isolates through membrane
damage. FEBS letters. 2010;584(15):3354-8. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/20580355.
34. Barretau H, Bouhss A, Fourgeaud M, et al. Human- and Plant-Pathogenic Pseudomonas
Species Produce Bacteriocins Exhibiting Colicin M-Like Hydrolase Activity towards
Peptidoglycan Precursors. Journal of Bacteriology. 2009;191(11):3657-3664.
35. Stover CK, Erwin AL, Mizoguchi SD, et al. Complete genome sequence of Pseudomonas
aeruginosa PAO1 , an opportunistic pathogen. Nature. 2000;406(August):959-964.
36. Nakayama K, Takashima K, Ishihara H, et al. The R-type pyocin of Pseudomonas
aeruginosa is related to P2 phage, and the F-type is related to lambda phage. Molecular
Microbiology. 2000;38(2):213-231.
37. Winstanley C, Langille MG, Fothergill JL, et al. Newly introduced genomic prophage
islands are critical determinants of in vivo competitiveness in the Liverpool Epidemic Strain
of Pseudomonas aeruginosa. Genome Research. 2009;19:12-23.
38. Brazas MD, Hancock RE. Ciprofloxacin induction of a susceptibility determinant in
Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy. 2005;49(8):3222-3227.
56
39. Matsui H, Sano Y, Ishihara H, Shinomiya T. Regulation of Pyocin Genes in Pseudomonas
aeruginosa by Positive (prtN) and Negative (prtR) Regulatory Genes. Journal of Bacteriology.
1993;175(5):1257-1263.
40. Chang W, Small DA, Toghrol F, Bentley WE. Microarray analysis of Pseudomonas
aeruginosa reveals induction of pyocin genes in response to hydrogen peroxide. BMC
Genomics. 2005;6:115.
41. Waite RD, Curtis MA. Pseudomonas aeruginosa PAO1 pyocin production affects
population dynamics within mixed-culture biofilms. Journal of Bacteriology.
2009;191(4):1349-1354.
42. Sano Y, Matsui H, Kobayashi M, Kageyama M. Molecular structures and functions of
pyocins S1 ans S2 in Pseudomonas aeruginosa. Journal of Bacteriology. 1993;175:2907-2916.
43. Tanaka M, Kaziro Y. Studies on the Mode of Action of Pyocin I . Inhibition of
Macromolecular Synthesis in Sensitive Cells. The Journal of Biochemistry. 1965;57(5):689-
695.
44. Ikeda K, Egami F. Receptor Substance for Pyocin RI . Partial Purification and Chemical
Properties. The Journal of Biochemistry. 1969;65(4):603-609.
45. King JD, Kocíncová D, Westman EL, Lam JS. Review: Lipopolysaccharide biosynthesis
in Pseudomonas aeruginosa. Innate immunity. 2009;15(5):261-312. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/19710102.
46. Kohler T, Donner V, van Delden C. Lipopolysaccharide as Shield and Receptor for R-
Pyocin-Mediated Killing in Pseudomonas aeruginosa. Journal of Bacteriology.
2010;192(7):1921-1928.
47. Kumazaki T, Ogura Y, Ishii S. Isolation and characterization of pyocin R1 fibers. The
Journal of Biochemistry. 1982;91:825-35. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/6804455.
57
48. Williams SR, Gebhart D, Martin DW, Scholl D. Retargeting R-Type Pyocins To Generate
Novel Bactericidal Protein Complexes. Applied and Environmental Microbiology.
2008;74(12):3868-3876.
49. Scholl D, Cooley M, Williams SR, et al. An Engineered R-Type Pyocin Is a Highly
Specific and Sensitive Bactericidal Agent for the Food-Borne Pathogen Escherichia coli O157
: H7. Antimicrobial Agents and Chemotherapy. 2009;53(7):3074-3080.
50. Hamilton GW. Bacteriophages: an appraisal of their role in the treatment of bacterial
infection. International Journal of Antimicrobial Agents. 2007;30:118-128.
51. Capparelli R, Nocerino N, Iannaccone M, et al. Bacteriophage Therapy of Salmonella
enterica: A Fresh Appraisal of Bacteriophage Therapy. The Journal of Infectious Diseases.
2010;201:52-61.
52. Hughes Ka, Sutherland IW, Jones MV. Biofilm susceptibility to bacteriophage attack: the
role of phage-borne polysaccharide depolymerase. Microbiology. 1998;144:3039-47.
Available at: http://www.ncbi.nlm.nih.gov/pubmed/9846739.
53. Chen J, Novick RP. Phage-Mediated Intergeneric Transfer of Toxin Genes. Science.
2009;323:139-141.
54. Scholl D, Martin DW. Antibacterial Efficacy of R-Type Pyocins towards Pseudomonas
aeruginosa in a Murine Peritonitis Model. Antimicrobial Agents and Chemotherapy.
2008;52(5):1647-1652.
55. Shinomiya T, Shiga S. Bactericidal Activity of the Tail of Pseudomonas aeruginosa
Bacteriophage PS17. Journal of Virology. 1979;32(3):958-967.
56. Govan JR. Studies on the Pyocins of Pseudomonas aeruginosa : Production of Contractile
and Flexuous Pyocins in Pseudomonas aeruginosa. Journal of General Microbiology.
1974;(80):17-30.
57. Furste JP, Pansegrau W, Frank R, et al. Molecular cloning of the plasmid RP4 primase
region in a multi-host-range tacP expression vector. Gene. 1986;48:119-131.
58
58. Michnick SW, Sidhu SS. Submitting antibodies to binding arbitration. Nature Chemical
Biology. 2008;4(6):326-329.
59. Fellouse FA, Sidhu SS. Making and using antibodies. (Howard GC, Kaser MR). Boca
Raton: CRC Press; 2007:157-180.
60. Chung CT, Miller RH. A rapid and convenient method for the preparation and storage of
competent bacterial cells. Nucleic Acids Research. 1988;16(8):3580.
61. Goldberg JB, Ohman DE. Cloning and Expression in Pseudomonas aeruginosa of a Gene
Involved in the Production of Alginate. Journal of Bacteriology. 1984;158(3):1115-1121.
62. Choi KH, Kumar A, Schweizer HP. A 10-min method for preparation of highly
electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer
between chromosomes and plasmid transformation. J. Microbiol. Methods. 2006;64:391-397.
63. Gimble FS, Sauer RT, Hi B. Mutations in Bacteriophage X Repressor That Prevent RecA-
Mediated Cleavage. 1985;162(1):147-154.
64. Gimble FS, Sauer RT. ! Repressor inactivation - Properties of purified ind% proteins in the
autodigestion and RecA-mediated cleavage reactions. Journal of Molecular Biology.
1986;192:39-47.
65. Bell C, Frescura P, Hochschild A, Lewis M. Crystal Structure of the ! Repressor C-
Terminal Domain Provides a Model for Cooperative Operator Binding. Cell. 2000;101:801-
811.
66. Labrie SJ, Samson JE, Moineau S. Bacteriophage resistance mechanisms. Nature reviews.
Microbiology. 2010;8(5):317-327. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/20348932.
67. Waite RD, Curtis MA. Pseudomonas aeruginosa PAO1 Pyocin Production Affects
Population Dynamics within Mixed-Culture Biofilms. Journal of Bacteriology.
2009;191(4):1349-1354.
59
68. Ceyssens P, Noben J, Ackermann H, et al. Survey of Pseudomonas aeruginosa and its
phages: de novo peptide sequencing as a novel tool to assess the diversity of worldwide
collected viruses. Environmental microbiology. 2009;11(5):1303-13. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/19207572.
69. Heo Y, Chung I, Choi KB, Lau GW, Cho Y. Genome sequence comparison and
superinfection between two related Pseudomonas aeruginosa phages, D3112 and MP22.
Microbiology. 2007;153:2885-95. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/17768233.
70. Ikeda K, Kageyama M, Egami F. Studies of a Pyocin. II. Mode of Production of the
Pyocin. The Journal of Biochemistry. 1964;55(I):54-58.
71. Watnick P, Kolter R. Biofilm , City of Microbes. Journal of Bacteriology.
2000;182(10):2675-2679.
72. Giltner CL, Schaik EJ, Audette GF, et al. The Pseudomonas aeruginosa type IV pilin
receptor binding domain functions as an adhesin for both biotic and abiotic surfaces.
Molecular Microbiology. 2006;59(4):1083-1096.
73. Beachley E. Bacterial adherence: adhesin-receptor interactions mediating the attachment
of bacteria to mucosal surface. Journal of Infectious Disease. 1981;143(3):325-425.
74. Wolfgang MC, Kulasekara BR, Liang X, et al. Conservation of genome content and
virulence determinants among clinical and environmental isolates of Pseudomonas
aeruginosa. Proceedings of the National Academy of Science USA. 2003;100(14):8484-8489.
60
Appendix A Pyocin purification experiments
A.1 Genomic island cloning
My first attempts at pyocin purification utilized the strategy of Wolfgang et al. to
capture and clone the large genomic fragment encompassing the R- and F-type pyocin loci in
PA0174. This method utilizes yeast recombinational cloning to synthesize a capture vector
possessing large regions of homology flanking of the region of interest. This vector is used to
‘capture’ (flip out by recombination) the target genomic island for subsequent overexpression
studies. We aimed to use this system as a means of producing tail-like pyocins in an E. coli
system devoid of interfering pyocins. An outline of the important features of the capture
vector is shown in Figure 17.
61
In order to construct the capture vector, PCR amplification was performed to generate the
following: (1) the trpE fragment using primers ‘PaTrpE-P1-F’ and ‘PaTrpE-P2-R’ and
genomic PA01 DNA as template, (2) the trpG/D fragment using primers ‘PaTrpG-30-P3-F’
and ‘PaTrpF-P4-R’ and genomic PA01 DNA as template, and (3) the pLLx8 fragment using
primers ‘pLLx8-P2-F’ and ‘pLLx8-P3-R’ using pLLx8 vector as template. To prepare for
cloning, pLLx13 was linearized with NheI, and the pLLx8 PCR product was cut with EcoRI.
Each PCR product was designed to possess a 40 bp overlap with both adjoining fragments to
aid in recombination. 600 ng of pLLx8 and 200 ng of the other products were co-transformed
into S. cerevisiae strain CRY1-2. DNA from successful transformants was purified and
transformed into competent E. coli cells and plated in LB + ampicillin plates. I was frequently
able to generate yeast transformants and purify their DNA, but was unable to produce colonies
in E. coli. The likely explanation was that yeast transformants possessed uncut or resealed
pLLx13 (background), not possessing the desired inserts. Alternatively, the transformation
efficiency of the E. coli cells used may have been too low to accept such a large plasmid.
Many cloning attempts with new DNA preps (for all fragments) and under varying
transformation conditions were attempted, to no avail.
A.2 Pyocin loci cloning using long-range PCR
A similar cloning strategy involved amplifying the individual R- and F-type pyocin
loci separately for cloning into the E. coli / P. aeruginosa shuttle vector pMMB67EH, as seen
in Figure 18. Our goal was to produce dual constructs capable of producing both tail-like
pyocins separately in an E. coli host. Amplifications were performed using primers ‘PA01-R-
locus-F’ and ‘PA01-R-locus-R’ for the R locus, and primers ‘PA01-F-locus-F’ and ‘PA01-F-
locus-R’ for the F locus. These >10 kb long regions were amplified using Phusion DNA
polymerase (NEB) according to the manufacturer’s protocol except for the use of 5xGC buffer
(NEB) and DMSO. DNA digestion strategies confirmed the PCR fragments to be from the
pyocin loci as expected. Both PCR fragments and pMMB67EH were linearized with EcoRI
and HindIII to prepare for cloning. Both ligation-dependent and LIC (ligation independent
cloning – Clontech) methods were mostly unsuccessful. Only a few transformants in total
were ever recovered, and restriction digests of their plasmid DNA did not match the desired
62
constructs. Transformation efficiency into competent cells was likely the main stumbling
block to cloning these large fragments.
A.3 FPLC purification
Another strategy aimed to utilize fast protein liquid chromatography (FPLC) to
separate the R2 and F2 pyocins produced by strain PA01. Pyocins from mitomycin C induced
lysates were precipitated by gradually adding ammonium sulphate to 70% saturation while
stirring overnight at 4°C. Centrifugation at 22000 g for 10 minutes followed by resuspension
in phage storage media (SM – 100 mM NaCl, 8 mM MgSO4&7H20, 50 mM Tris-Cl, 0.002%
w/v Gelatin). Resuspensions were subjected to ultracentrifugation at 156000 g for 3 hours.
The pellet was resuspended in SM from which 1 ml was run in the MonoQ anion exchange
column (GE Healthcare). Conditions were as follows: 0-100% gradient of elution buffer
(10mM Tris, 1 M NaCl) over 8 column volumes emitting 1 ml fractions. An example FPLC
output is shown in Figure 19. The protein profile of the generated fractions suggested that R-
and F-type pyocins were incompletely separated in these conditions, as evidenced by dual but
overlapping peaks. SDS-Page analysis and spotting analysis of fractions spanning the peak
63
regions showed no evidence for separate pyocin activities. Further troubleshooting of the
column conditions or a switch to cation exchange columns may provide better peak
separation.
A.4 Pyocin purification using tagged tail proteins
The final pyocin purification protocol aimed to test whether lysates generated in the
presence of overexpressed 6-His-tagged R-type pyocin sheath (PA0622) or F-type pyocin tail
tube (PA0633) generated active pyocin particles that could be purified with Ni-NTA resin. If
incorporation of these tagged proteins into active particles occurred (even at a very low
frequency) we expected to be able to purify these pyocins away from wildtype particles.
Lysates were generated by mitomycin C as normal except for the addition of IPTG to 1 mM
20 minutes prior to mitomycin C induction. Lysates were concentrated by ammonium sulfate
prior to purification as described in section 2.9. Pyocin activity (as measured by spotting
against the susceptible stain A3) was measured for all elutions and input lysates, as seen in
Figure 20. Wildtype cells were used as a control throughout this purification process.
Unfortunately, the elution fraction from wildtype cells was shown to have a low level of
pyocin activity, indicating that pyocins can stick to Ni-NTA resin in a non-specific manner.
64
Given there is the same low level pyocin activity in the tagged protein eluates, it is unlikely
that pyocin particles are successfully formed with the 6-His tag displayed for purification
purposes.
65
Appendix B PrtN Troubleshooting
When the PrtN construct was transformed into numerous P. aeruginosa strains two
inconsistencies were revealed. First, some PrtN-overexpressing strains were not lysing as well
as PA01 with the equivalent vector, suggesting that some pyocin activity, if induced, may not
be liberating properly from the producing cells. Investigation into the use of lysozyme and/or
EDTA in addition to choloroform revealed that the application of 10 µg/ml lysozyme was
sufficient to produce consistent lysis (visually) equivalent to PA01 levels in all strains tested
(Figure 5b). Thus, from this point onward, lysozyme was always used in PrtN-overexpression
cells to achieve lysis comparable to mitomycin-C induced lysates. A similar treatment was
applied to uninduced cells so as to not bias this control. That this defect exists suggests that
the pyocin lytic system (identified by homology to known phage lytic protein) might be
improperly induced in PrtN overexpression cells, or perhaps that there are additional lysins
induced in the context of a mitomycin C induction that aid in cellular lysis.
Next, it has been recognized that tail-like pyocins from some preparations of PrtN-
induced lysates are sensitive to high levels of proteinase K in some cases, whereas those
induced by mitomycin C were not. This result may imply the existence of some protective
factor that is present in mitomycin C lysates but absent in the induction of PrtN. Oddly, this
protease sensitivity was not consistently seen among all tail-like pyocins.
These observations suggest that pyocin regulation is more complicated than originally
assumed. In particular, PrtN may not be the only positive activator of pyocin production as
suggested by the lysis defects of some PrtN-induced cells and the sensitivity of some tail-like
pyocins to protease. Regardless, the results discussed herein are unchanged because lysozyme
allowed for consistent lysis while no tail-like activities were scored solely based on production
in PrtN lysates alone.