chmi 4226e – w20051 recombinant dna technology chmi 4226 e week 3 19 january 2009 toolbox part 3...
TRANSCRIPT
![Page 1: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/1.jpg)
CHMI 4226E – W2005 1
Recombinant DNA TechnologyCHMI 4226 E
Week 3
19 January 2009
Toolbox part 3
PCR
![Page 2: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/2.jpg)
CHMI 4226E – W2005 2
PCR
• Very powerful method
• Allows for the in-vitro synthesis of a specific DNA molecule from very limited amounts.
• 3 basic steps (1 PCR cycle):– DNA denaturation– Primer annealing– Extension with DNA
polymerase
![Page 3: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/3.jpg)
CHMI 4226E – W2005 3
PCR• The increase in the amounts of the
DNA on interest is exponential: doubles after each cycle (in theory)
• Fold increase can be determined as follows:
– Increase = 2n
• n = number of cycles – So, 25 PCR cycles will give you a
theoretical amplification of 34 million fold!!!
• In reality, a two-fold increase per cycle is rarely, if ever, obtained, due to:
– Presence of inhibitors– GC-rich regions in the template.
![Page 4: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/4.jpg)
CHMI 4226E – W2005 4
PCR
![Page 5: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/5.jpg)
CHMI 4226E – W2005 5
PCR - Reagents
![Page 6: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/6.jpg)
CHMI 4226E – W2005 6
PCR-Selecting primers
![Page 7: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/7.jpg)
CHMI 4226E – W2005 7
PCR
![Page 8: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/8.jpg)
CHMI 4226E – W2005 8
PCR
![Page 9: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/9.jpg)
CHMI 4226E – W2005 9
PCR5’ primer: 5’atg gac ggg tcc ggg gag cag ccc 3’ – Coding strand
5’atggacgggtccggggagcagcccagaggcggggggccca3’3’tacctgcccaggcccctcgtcgggtctccgccccccgggt5’
5’atggacgggtccggggagcagcccagaggcggggggccca3’
5’atggacgggtccggggagcagccc 3’3’tacctgcccaggcccctcgtcgggtctccgccccccgggt5’
95oC, 1 min
![Page 10: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/10.jpg)
CHMI 4226E – W2005 10
PCR
![Page 11: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/11.jpg)
CHMI 4226E – W2005 11
5’ctcaccgcctcgctcaccatctggaagaagatgggctga3’ 3’gagtggcggagcgagtggtagaccttcttctacccgact5’
3’gagtggcggagcgagtggtagaccttcttctacccgact5’
3’tggtagaccttcttctacccgact5’5’ctcaccgcctcgctcaccatctggaagaagatgggctga3’
95oC, 1 min
3’ Primer:
5’acc atc tgg aag aag atg ggc tga3’ Coding strand3’tgg tag acc ttc ttc tac ccg act5’ Template strand
5’ tca gcc cat ctt ctt cca gat ggt 3’
![Page 12: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/12.jpg)
CHMI 4226E – W2005 12
PCR
![Page 13: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/13.jpg)
CHMI 4226E – W2005 13
PCR• Desired properties of PCR primers:
– Length: 20-24 nt;
– Melting point (Tm) = 50-70oCTm= 2(A+T) +4(G+C)
T anneal = Tm-4oC
– %GC: 35%-65%;
– 3’ end is rich in GC (acts as a clamp);
– No sequence complementary between or within the two primers;
– No significant pairing (even incomplete) to other DNA molecules unrelated to the DNA of interest (perform Blast on primers).
• More on primer design guidelines:
– http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html
• Software and algorithms:– http://www.humgen.nl/
primer_design.html
– http://www.biocenter.helsinki.fi/bi/Programs/fastpcr.htm
– http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
![Page 14: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/14.jpg)
CHMI 4226E – W2005 14
PCR-Annealing temperature
55oC 50oC
1 2 3 1 2 3
Primer sets
M
603 bp
310 bp281 bp234 bp194 bp
118 bp
![Page 15: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/15.jpg)
CHMI 4226E – W2005 15
PCR – Fidelity of target amplification
![Page 16: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/16.jpg)
CHMI 4226E – W2005 16
PCR-primers
![Page 17: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/17.jpg)
CHMI 4226E – W2005 17
PCR-number of cycles
• While the yield of amplified product increases with the number of cycles, so is the possibility of:– Amplification of
partially related sequences;
– Introduction of mutations in the amplified DNA.
![Page 18: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/18.jpg)
CHMI 4226E – W2005 18
PCR-number of cycles
![Page 19: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/19.jpg)
CHMI 4226E – W2005 19
PCR-Effect of Mg+2
• Mg2+ is a co-factor for all DNA polymerases
• However, don’t forget that:– Primers and dNTPs
bind Mg2+
– Too much Mg2+ will favor non-specific DNA hybridization
• So: an optimal DNA concentration must be found for each pair of primers.
![Page 20: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/20.jpg)
CHMI 4226E – W2005 20
PCR-Effect of Mg+2
Stoffel fragment: less heat sensitive and no 5’-3’ exonuclease activity.
![Page 21: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/21.jpg)
CHMI 4226E – W2005 21
PCR-Effect of Mg+2
http://www.promega.com/guides/pcr_guide/070_04/promega.html
![Page 22: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/22.jpg)
CHMI 4226E – W2005 22
PCR-Effect of Mg+2
http://info.med.yale.edu/genetics/ward/tavi/p14.html
![Page 23: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/23.jpg)
CHMI 4226E – W2005 23
PCR- DNA polymerases
![Page 24: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/24.jpg)
CHMI 4226E – W2005 24
PCR- DNA polymerases
• Processivity: number of nucleotides polymerized before the DNA pol leaves the DNA molecule.
• Fidelity: accuracy of the enzyme.
![Page 25: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/25.jpg)
CHMI 4226E – W2005 25
PCR- DNA polymerases
![Page 26: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/26.jpg)
CHMI 4226E – W2005 26
PCR- DNA polymerases
![Page 27: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/27.jpg)
CHMI 4226E – W2005 27
PCR- DNA polymerases
• IMPORTANT: Fidelity and yield are mutually exclusive!
![Page 28: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/28.jpg)
CHMI 4226E – W2005 28
PCR-Plateau effect
http://www.biotechlab.northwestern.edu/pe/sld021.htm
![Page 29: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/29.jpg)
CHMI 4226E – W2005 29
PCR-Plateau effect
http://www.biotechlab.northwestern.edu/pe/sld021.htm
![Page 30: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/30.jpg)
CHMI 4226E – W2005 30
PCR-Plateau effect• Plateau Effect - The plateau effect is an attenuation of the normally
exponential rate of product accumulation in a PCR reaction. It can be caused by:– depletion of dNTPs
– depletion of primers
– stability of the reactants (e.g. enzyme activity; particularly at the denaturation temperature)
– end product inhibition by duplex DNA
– non-specific competition for resources (production of incorrect product)
– reannealing of specific products to one another instead of to the primers (this is particularly problematic when product concentration is high).
![Page 31: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/31.jpg)
CHMI 4226E – W2005 31
Major PCR problem: specificity
![Page 32: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/32.jpg)
CHMI 4226E – W2005 32
Increasing PCR specificity Hot start method
http://www.biotechlab.northwestern.edu/pe/sld021.htm
![Page 33: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/33.jpg)
CHMI 4226E – W2005 33
PCR-Specificity
![Page 34: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/34.jpg)
CHMI 4226E – W2005 34
Increasing PCR specificity Use of nested primers
• Using two sets of primers to amplify a DNA fragment:– A first set of primers is used to amplify a
longer piece of the DNA of interest;– A second set of primers is used to amplify a
smaller section from the amplified region.
![Page 35: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/35.jpg)
CHMI 4226E – W2005 35
Increasing PCR specificityTouchdown PCR
• In touchdown PCR, the reaction is first set with an annealing temperature a few degrees (e.g. 5oC) above the optimal temperature for the primers;
• During the first few cycles, the annealing temperature is slowly decreased (1oC per cycle);
• The aim is to favor the amplification of the DNA of interest over possible competing DNA molecules during the first few cycles of PCR, limiting the amplification of non-specific products in subsequent cycles.
![Page 36: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/36.jpg)
CHMI 4226E – W2005 36
PCR-GC-rich templates
Betaine+-
Betaine
![Page 37: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/37.jpg)
CHMI 4226E – W2005 37
PCR vs DNA cloning
![Page 38: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/38.jpg)
CHMI 4226E – W2005 38
![Page 39: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/39.jpg)
CHMI 4226E – W2005 39
![Page 40: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/40.jpg)
CHMI 4226E – W2005 40
![Page 41: CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR](https://reader037.vdocument.in/reader037/viewer/2022110101/56649ec75503460f94bd3da6/html5/thumbnails/41.jpg)
CHMI 4226E – W2005 41
Assignment #4!