Upload File

dna unit 7 quiz. what is the complimentary mrna sequence to the dna sequence a-t-t-g-c-a? a....

  • Home
  • Documents
  • DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T
23
DNA Unit 7 Quiz

Upload: jacoby-dickinson

Post on 14-Dec-2015

245 views

Category:

Documents


1 download

Report

Tags:

TRANSCRIPT

Page 1: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

DNAUnit 7 Quiz

Page 2: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What is the complimentary mRNA sequence to the DNA sequence

A-T-T-G-C-A?

a. T-A-A-G-C-Ab. U-A-A-C-G-Uc. T-A-A-C-G-Td. U-A-A-C-G-T

Page 3: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

If DNA is like a ladder, the “hand rails” are made up of:

a. Amino acids & proteinsb. Nucleotides & nitrogen basesc. Adenine & Uracild. Phosphate group and sugar

Page 4: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What kind of molecule is this?

a. tRNAb. RNAic. mRNAd. rRNA

Page 5: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

Which of the following would have a weak hydrogen bond between

them?

a. Phosphate group & Deoxyriboseb. Nucleotide & Uracilc. Guanine & Adenined. Adenine & Thymine

Page 6: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What kind of molecule is labeled X in the diagram below?

a. tRNAb. RNAic. mRNAd. rRNA

X

Page 7: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What does DNA and RNA have in common?

a. Both contain deoxyriboseb. Both contain thyminec. Both are single strandedd. Both contain phosphate groups

Page 8: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What is the complimentary DNA sequence to A-T-T-G-C-A?

a. T-A-A-C-G-Tb. U-A-A-C-G-Uc. T-T-A-C-G-Ad. U-A-A-C-G-T

Page 9: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What is the purpose of tRNA?

a. It translates DNA into mRNAb. It transports amino acids to the ribosomec. It transforms ribosomesd. It delivers codons from DNA

Page 10: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

The nucleus is removed from a somatic cell of 1 organism & is placed in an egg cell that has its nucleus removed. This process results in the production of organisms that are genetically

alike. This is called:

a. DNA fingerprintingb. Gene therapyc. Selective breedingd. Cloning

Page 11: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What is this structure called?

a. DNAb. Double helixc. RNAd. Nucleotide

Page 12: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

Which could cause mutations?

a. Old ageb. Exercise c. Radiationd. Bacterial infections

Page 13: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

DNA insertion mutations may be caused by the

invasion of:

a. Virusesb. Fungusc. Protozoansd. Amoebas

Page 14: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What type of mutation is in the diagram below?

a. Deletionb. Substitutionc. Inversiond. Insertion

Page 15: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

This nucleic acid is responsible for the transmission of information

from the genetic code in the nucleus to the ribosomes?

a. tRNAb. mRNAc. rRNAd. RNAi

Page 16: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What process is occurring in the diagram below?

a. Replicationb. Transcriptionc. Deletiond. Translation

Page 17: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

This contains the blueprint for making

proteins:

a. tRNAb. DNAc. rRNAd. ATP

Page 18: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

These organelles “read” mRNA instructions:

a. Ribosomesb. Mitochondriac. Golgi Bodyd. Lysosomes

Page 19: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

Which of the following sequence of processes

correctly reflects how proteins are made?

a. Protein synthesis, transcription, translation

b. Protein synthesis, translation, transcription

c. Transcription, translation, protein synthesis

d. Translation, transcription, protein synthesis

Page 20: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

What is a possible use of DNA fingerprinting?

a. Paternity testingb. Gene therapyc. Transgenic speciesd. Cloning

Page 21: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

Translate the following code into an polypeptide chain:

AUG GGG UAA

a. Methionine, Glycine, Stop

b. Valine, Alanine, Serine

c. Methionine, Alanine, Stop

d. Alanine, Valine, Serine

Page 22: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

The End

Page 23: DNA Unit 7 Quiz. What is the complimentary mRNA sequence to the DNA sequence A-T-T-G-C-A? a. T-A-A-G-C-A b. U-A-A-C-G-U c. T-A-A-C-G-T d. U-A-A-C-G-T

Answer Key1. B 11. C2. D 12. A3. C 13. D4. D 14. B5. A 15. D6. D 16. B7. A 17. A8. B 18. C9. D 19. A10. D 20. A


DNA - Model High Schoolfloydmodelhigh.sharpschool.net/UserFiles/Servers/Server_3121542... · strand to this DNA molecule? A A T C G T A C C G A T T T AG C A T G G C T A 21 C. Two

University of Groningen Modular assembly of functional DNA ...chapter 5 102 a c c t t g c g a a t g a c c t g g g t g g a c t g g a g t a tt gc ga g g a a g c agacatgtcagcgttctcaccagtc

T HE N EW T ESTAMENT C HURCH T HE C HURCH A T A NTIOCH

Alignment II Dynamic Programming. 2 Pair-wise sequence alignments A: C A T - T C A - C | | | | | B: C - T C G C A G C Idea: Display one sequence above

BIOLOGY 111 - gervind.faculty.mjc.edugervind.faculty.mjc.edu/biology_111/111_lectures/Topic 8 CH6.pdf · BIOLOGY 111 CHAPTER 6: DNA ... CG T C A T G T C C T A T G G G A C CG T A C

D C a n d A C S w i t c h i n g C h a r a c t e r i s t i

L U C A C A T T A N E O A R C H I T E T T O · 2017. 10. 11. · L U C A C A T T A N E O a r c h i t e c t . PORTFOLIO . LAC . ARCHITECTURE + INTERIORS . 2, Impasse de Perrosay, 74200

T G A C T T T C C C C G G A A A A A C T G A A A G G G G C C T T T T

C O N T R A C T - Connecticut

D C a n d A C S w i t c h i n g C h a r a c t e r i s t i c s V i r t e x U l t r … · 2020. 9. 4. · D C C h a r a c t e r i s t i c s A b s o l u t e M a x i m u m R a t i n

SCHOOL MESSAGE SAINT MARY CATHOLIC · Dedi c a t ed t o C a t hol i c v a l ues , S a i nt M a r y C a t hol i c S c hool i s a C hr i s t -c ent er ed educ a t i ona l c ommuni t

A G C C G A T G T C G T C G T C T A C C A T G C A T

C O N T A C T C A T A L O G - Farnell

CP 648-E Firestop Wrap Strip - FireProtection411 · Product Information C h a p t e r T a b s C h a p t e r T a b s C h a p t e r T a b s C h a p t e r T a b s C h a p t e r T a b

rulai.cshl.edurulai.cshl.edu/TissueSpecClass/predictors.pdf · Module Feature MotifName Factor Logo X1 PRODUCT M00800 AP-2 A C G T G CC T A G C T G A T C C A G C A G C G G C C A T

c o n t r a c t s

A C A C T 37 T G T G A th Annual Mid-Atlantic T G A C T C

C·O!N·G R A TiS · HEADLTNE . C •t" ,•,: ,..., !!,, "'"'""',." c ,t

T A T A C G A A T C T A A A PosACGT 1.49998.5.00001 2.49998.5 3.6.39998.00001 Wie oft matcht das Profil ?

1 Lecture 25: DNA mutation, proofreading, and repair Figure 16.7a, c (c) Space-filling model C T A A T C G GC A C G A T A T AT T A C T A 0.34 nm 3.4 nm

BaassiiccCCuutt017...C I B S C C U U T A B SC A C S I B C B S 2 I BC T U BU A B A S I C U C U T U I BC UA C AUB A A S C T B A S I C U S T A CUC C UB A I C C U SI C T A I

ri F s t - vistahonors.files.wordpress.com€¦ · I n t r n a t i n a a c c a a u r a t , a c c a a u r é a t I n t n r a t i n a . B I n i s s i t n e e t a s t T h r o c ruc m

Identification of Point Mutation Resulting Heat-labile ... · T A c fCG T C A T/C T Mutant U-T G C Norma I~~~~~ A T G A0.C T /G A c c [ Pro G-r, T C A T C T Figure1. Nucleotide sequenceofmutantandnormalcDNAs.There

A-T-T-A-C-G-G-T-G-C-C-A-T-A-G T-A-A-T-G-C-C-A-C-G-G-T-A-T-Cpeltonscience.weebly.com/.../7/2/46721149/dna_replication_chapter_12.3.pdf · 12.3 DNA Replication . 2/18/2015 2 ... How

Selection of XID target site Ani-wt: T G A G G A G G T T T C T C T G T A A m-XID: A G T G C C T G T T T C T C T T G A C -10 -9 -8 –7 –6 –5 -4 –3 –2 –1

i^i tiffn /x c ^ ^ y § y j^ ± ^ £ , · S c h o t t n ^ c ^ A l 6 £ 6 t ft o / a d : A - { / t/. d c g Z s ^ t^ A ^ C C ) _____ < % y C < /j / r e s /c C ^ c o < z e ~ * £ r

T C C A T A T C A T C A T C C A T A T ... - Fisher Scientific...c a t a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a t c a

A C G C A C TT C A G AA C G C G T A C T G A C T G AA

TURN BACK THE CLOCK OF TIME! - wellstarbyasturkey.comwellstarbyasturkey.com/.../uploads/2018/11/Imune_ReNewLife_Brosur_ENG.pdfC A T T T C C A T T A C G T A A A G G T A A T G 06. BE

A R T C O N E C S T A R T C O N E Together, Melbourne

arXiv:1807.01622v1 [cs.LG] 4 Jul 2018 · Neural Processes x C y T C T z y C x T (a) Graphical model y C x C h r C a z y T r h x T T g a r C T Generation Inference (b) Computational

2 0 1 6 T A C T I C A L C A T A L O G

YOSEMITEv NATIONAL PARK NATIONAL PARK P a c i f i c L A K E N H C r e s t L E T r a i l P a c i fi c T i t l C r e s t Y M 1 A C r T r a i l P a c i f i c h T C r e s t c T r a i l

C u b a n A r t & A r t i s t s i n “ P a c i f i c S t a

A C O U S T I C & E L E C T R I C A C O U S T I C G U … · 7 A C O U S T I C & E L E C T R I C A C O U S T I C G U I T A R S Nothing can compare to that big robust sound that a