UNIVERSITÀ DEGLI STUDI DELLA TUSCIA DI VITERBO

DIPARTIMENTO DI SCIENZE ECOLOGICHE E BIOLOGICHE

Corso di Dottorato di Ricerca in

Genetica e Biologia Cellulare - XXVII Ciclo

DOWN – rEgulation of the lamin a/C in neuronal

cells correlates with immature phenotype

(BIO/11)

Tesi di dottorato di: Dr. Marta Nardella Coordinatore del corso Tutore

Prof. Giorgio Prantera Dr. Igea D’Agnano

8 maggio 2015

The best way to know God is to love many things

Vincent Van Gogh

To my parents,

my sisters

and my grandparents

To my husband

and

my son

INDEX

ABSTRACT I

1 INTRODUCTION 1

1.1 ARCHITECTURE OF THE NUCLEUS AND IMPLICATION IN DISEASE 1

Nucleus and nuclear lamina 1

Nuclear lamins 2

Functions of Lamins in Nuclear and cellular architecture 5

Lamins during development and differentiation processes 8

Lamins and diseases 8

Lamins and cancer 10

1.2 NEUROBLASTOMA 11

Neuroblastoma as a sympathetic nervous system-derived tumor 12

1.3 CANCER STEM CELLS AND NB-TUMOR INITIATING CELLS 16

The cancer stem cell theory 16

Isolation and characterization of neuroblastoma tumor initiating cells 18

1.4 microRNAS 19

miRNa biogenesis 20

miRNA may function as oncogenes or tumor suppressor genes in NB 22

miRNA regulation of CSC 22

2 AIM 24

3 MATERIALS AND METHODS 25

Human NB biopsy RNA extraction and real-­‐time RT-­‐PCR 25

Cell line maintenance and sphere formation 25

Primary cell coltures of Granule Cells 26

Generation of Lentiviral Infection of Granule Cells 26

Glutamate toxicity and neuronal survival 26

Colony-forming assay 27

Tumor sphere CD133 immunofluorescence 27

Immunoistochemistry 27

Western blot analysis 28

N-Myc FACS analysis 28

Side population 29

In vivo experiments 29

Histopathological analysis 29

Total RNA preparation 30

PCR Array 30

miRNA Assays 30

Hsa-miR-101 inhibitor and mimic 31

Real-­‐time RT-­‐PCR analysis 31 Statistical analysis 32

4 RESULTS 33 Abundance of LMNA in NB tumors is inversely correlated with that of MYCN gene 33

LMNA gene knock-down induces a stem-like phenotype in SH-SY5Y cells 40

LMNA-KD sphere-derived adherent cells maintain stemness characteristics and acquire a more aggressive phenotype 42

The LMNA-KD sphere-derived adherent cell line is able to initiate tumors in vivo 44

LMNA-KD sphere-derived adherent cells maintain stemness characteristics and acquire a more aggressive phenotype. 46

Lamin A/C increased during GCs maturation process both in vivo and in vitro 48

Lamin A/C silencing prevents the complete maturation of GCs 50

5 DISCUSSION 52

6 BIBLIOGRAFY 55

APPENDIX 67

 I  

ABSTRACT

Le lamine nucleari sono proteine che appartengono alla classe dei filamenti intermedi di tipo V.

Esse formano una struttura reticolare al di sotto della membrana nucleare interna e svolgono diverse

funzioni, alcune delle quali non sono state ancora del tutto chiarite. Le lamine di tipo A sono

espresse nei tessuti differenziati e sono coinvolte nei processi differenziativi che avvengono durante

lo sviluppo embrionale. La loro espressione risulta ridotta o assente in molti tumori umani, tuttavia

il loro ruolo nella tumorigenesi non è stato ancora caratterizzato. La perdita della Lamina A/C è di

particolare interesse, poiché la progressione del tumore è spesso associata ad una regressione dello

stato differenziativo delle cellule tumorali.

Nel nostro laboratorio è stato precedentemente dimostrato che la Lamina A/C è necessaria per

il differenziamento delle cellule di neuroblastoma e che la sua perdita è associata ad un aumento

dell’aggressività tumorale. Il neuroblastoma (NB) è un tumore altamente aggressivo del sistema

nervoso autonomo ed è il più comune tumore solido extracranico in età pediatrica.

Nonostante l’identificazione di marker molecolari - come l’amplificazione del fattore di

trascrizione MYCN - si sia rivelata molto utile dal punto di vista della stratificazione dei pazienti e

della realizzazione di protocolli terapeutici, sono necessari nuovi target molecolari per rendere

maggiormente chiara l’eterogeneità e la progressione del tumore.

Sulla base dei dati precedentemente ottenuti e considerando che la Lamina A/C si esprime

esclusivamente nei tessuti differenziati, l’obiettivo del lavoro è consistito nell’individuare il ruolo

della Lamina A/C nei processi di maturazione delle cellule di origine neuronale. In particolare, è

stato osservato che l’assenza della Lamina A/C predispone le cellule a un fenotipo staminale,

favorendo così lo sviluppo di cellule capaci di iniziare il tumore con le caratteristiche di auto-

rinnovamento.

Inoltre, prendendo in considerazione il ben noto marcatore del NB, MYCN - normalmente

amplificato nei tumori poco differenziati che mostrano caratteristiche immature - abbiamo

esaminato la possibile esistenza di una relazione inversa tra LMNA e MYCN nel NB.

In questo studio abbiamo osservato una relazione inversa tra i livelli di espressione di LMNA e

MYCN in 23 biopsie di NB. Utilizzando due modelli cellulari di NB che esprimono o LMNA o

MYCN abbiamo dimostrato come questa correlazione inversa sia da attribuire ad un’alterazione del

profilo di espressione di microRNAs che controllano la proliferazione e il differenziamento

cellulare. Inoltre, abbiamo dimostrato che il silenziamento della Lamina A/C nelle cellule di NB

SH-SY5Y comporta lo sviluppo di una popolazione di cellule inizianti il tumore (TIC), ovvero una

 II  

piccola popolazione di cellule responsabili della crescita del tumore, delle metastasi e delle recidive,

nota come popolazione di cellule staminali tumorali. Tali cellule hanno molte caratteristiche

specifiche delle cellule staminali - come la capacità di formare sfere e di espellere coloranti - ed

esprimono marcatori di cellule staminali: POU5f, che codifica Oct4, Nanog, SOX2, nonché PROM-

1, che codifica per CD133, e ABCG2. Inoltre, questa popolazione cellulare – diversamente da

quella di origine – presenta un elevato potenziale tumorigenico in quanto le cellule sono in grado di

generare un tumore quando inoculate in topi nudi. La caratterizzazione di NB TIC comporta un

passo cruciale per il miglioramento delle terapie antitumorali.

Inoltre, come osservato nelle biopsie di NB, lo sviluppo di una popolazione di TIC in linee di

NB correla all’incremento dei livelli di espressione del gene MYCN, come osservato in queste

cellule. Infatti, sovraesprimendo MYCN, le cellule di controllo SH-SY5Y acquisiscono un fenotipo

con caratteristiche staminali; al contrario, regolando negativamente i livelli di espressione di

MYCN nelle cellule SH-SY5Y silenziate per Lamina siamo stati in grado di ripristinare il fenotipo

più maturo.

Coerentemente con i nostri dati nei modelli di NB, il silenziamento della Lamina A/C nelle

colture primarie di cervelletto di ratti neonati blocca la morte neuronale glutammato-mediata, che

rappresenta un segnale della completa maturazione dei granuli cerebellari. Tale risultato rafforza

l'ipotesi che l’espressione della Lamina A/C sia una caratteristica esclusiva delle cellule che

iniziano il processo di maturazione e di quelle terminalmente differenziate.

Questo lavoro di tesi fornisce un modello di sviluppo di una popolazione di TIC nel

neuroblastoma. Strategie mirate a colpire la popolazione di cellule staminali all’interno del tumore

rappresentano una sfida per la riduzione della massa tumorale e/o dell'incidenza di recidive. Questi

studi potrebbero consentire lo sviluppo di protocolli terapeutici personalizzati sulla base del profilo

molecolare del singolo tumore.

 

 

 

 

 

 

 

 

 III  

Nuclear lamins are type V intermediate-filament proteins that form a meshwork-like scaffold

underlying the inner nuclear membrane providing mechanical support to the nucleus. It is now clear

that lamins exert many different functions within the cell, most of them still largely unknown.

Among lamins, the A-type ones (Lamin A/C) are expressed in differentiated tissues and are

involved in differentiation processes during the embryonal development. Their expression is

reduced or absent in several human malignancies, even though their role in the tumorigenesis has

not been characterized yet. It is widely accepted that tumor progression is often associated with

regression from a more differentiated to a less differentiated state, therefore loss of Lamin A/C

expression is of particular interest.

We previously demonstrated that Lamin A/C is necessary for the acquisition of a differentiated

phenotype in neuroblastoma cells and its loss is associated to an increased cell aggressiveness.

Neuroblastoma (NB) is a highly aggressive embryonic tumor originating from the autonomic

nervous system and represents the most common extracranial solid cancer in childhood. Despite the

identification of molecular markers, such as MYCN amplification, turned out to be greatly useful in

terms of patients’ stratification and therapeutic protocols implementation, new molecular targets are

required to clarify the heterogeneity and progression of this tumor.

Thus, based on our previous results and considering that Lamin A/C expression uniquely in

differentiated tissues, we intended to examine a possible role of Lamin A/C in the maturation of

cells of neuronal origin. In particular, we reasoned that NB differentiation impairment in the

absence of Lamin A/C was mainly due to the acquisition of a stem-like phenotype and a concurrent

development of tumor-initiating cells with self-renewal features. In addition, considering the well-

known hallmark of NB MYCN, normally amplified in poorly differentiated tumors displaying

immature characteristics, we intended to investigate whether an inverse relationship between

LMNA and MYCN gene could exist in NB.

In this study, we observed an inverse relationship between LMNA and MYCN expression

levels in 23 biopsies of NB. Using two NB cellular models, expressing LMNA or MYCN

alternatively, we demonstrated that this inverse correlation is due to changes of members of miRNA

signatures controlling cell proliferation and differentiation. Moreover, we provide evidence that the

down regulation of Lamin A/C expression in the SH-SY5Y NB cells allows the development of a

tumor-initiating cells (TIC) population, a rare tumorigenic cell population known to be responsible

for sustaining tumor growth, metastases and relapse, and usually named cancer stem cell

population. Stem cell characteristics, such as sphere-forming, dye exclusion ability and an increased

expression of the stem cell regulatory network (POU5f, which encodes Oct4, NANOG and SOX2)

as well as of PROM-1, encoding for CD133, and ABCG2 were detected in our TIC population.

 IV  

Furthermore, TIC-derived tumors obtained after TIC cells implantation in nude mice showed a

more malignant phenotype with respect to the parental cell line. The characterization of NB TICs

may be a crucial step for the improvement of antitumoral therapies.

In agreement with the aforementioned NB biopsies, the development of a TIC population in

NB correlates with the increased expression of MYCN gene observed in these cells. Indeed, by up-

regulating MYCN, control cells acquired a stem-like phenotype; while down-regulating MYCN in

the LMNA silenced cells, we were able to restore a more mature phenotype. Consistently with our

data in the NB models, we also showed how Lamin A/C knock down in primary cells explanted

from the cerebellum of neonatal rats prevents glutamate-mediated neuronal death which is a signal

of the complete maturation of granule cells. This evidence strongly supports the idea that Lamin

A/C expression is an exclusive characteristic of the cells that begin the maturation process and

terminally differentiate.

This thesis work provides new mechanistic insight into the development of a stem-like NB TIC

population. Targeting of the TICs in a tumor represents a challenge for the reduction of the tumor

mass and/or the incidence of tumor recurrences. Therefore, our data may provide opportunities to

develop new personalized therapeutic strategies based on the molecular profile of the tumor.

 

1

1 INTRODUCTION

1.1 ARCHITECTURE OF THE NUCLEUS AND

IMPLICATIONS IN DISEASE

Nucleus and nuclear lamina

The nucleus is the defining feature of eukaryotic cells and is separated from the cytoplasm by

the nuclear envelope (NE). The NE is composed of three distinct elements, i.e., the nuclear

membrane, nuclear pore complexes, and the nuclear lamina. The nuclear membrane is a double-unit

nuclear membrane, in which the outer nuclear membrane (ONM) is continuous with and shares

biochemical and functional properties with the endoplasmic reticulum (ER). In contrast, the inner

nuclear membrane (INM) is distinct from both the ONM and ER and is defined by a subset of

integral membrane proteins, termed nuclear envelope transmembrane proteins (NETs) that are

anchored to the INM during interphase. The ONM and INM are separated by a luminal space of 100

nm in width (perinuclear space). The nuclear membrane is punctuated by nuclear pore complexes

(NPCs), which regulate the passage of macromolecules between the nucleus and the cytoplasm. At

NPCs the ONM and INM converge at the so-called pore membrane, which again is defined by its

own subset of integral membrane proteins. Underneath the INM is the nuclear lamina (NL). The NL

is a polymeric protein meshwork of 10 nm filaments. It is a complex network of type V

intermediate filaments (IF) proteins, the nuclear lamins, and inner nuclear membrane–associated

proteins. The NL provides the mechanical and structural support for the nuclear membrane and

anchoring sites for chromosomes and nuclear pore (Gerace and Burke, 1998).

2

Schematic representation of nucleus structures.

http://www.slideworld.org/slideshow.aspx/Cytoskeleton-2865193

Nuclear lamins

The major components of the NL are type V intermediate filament (IF) proteins, the nuclear

lamins. Like all proteins, they are synthesized in the cytoplasm and then transported into the

nucleus, where they are assembled before being incorporated into the existing network of NL (Aebi

et al., 1986).

Lamins are divided into A and B types based on sequence homologies. A-type lamins are 70

and 60 kilodaltons (Gerace and Blobel, 1980; Goldberg et al., 2008), are encoded by the LMNA

gene located on chromosome 1q21.2-q21.3 (Wydner et al., 1996; Lin and Worman, 1997) and are

generated by alternative splicing to produce different isoforms, lamins A, A∆10, C and C2, which

are all found in different cell types (Foster and Bridger, 2005; Martin et al., 2009). Lamin C2 is

restricted only to spermatocytes during rat spermatogenesis whereas, A∆10 is found only in a few

carcinoma cell lines (Alsheimer and Benavente, 1996). A∆10 results from the deletion of exon 10

(Hutchison, 2002) and is localised at the nuclear envelope (Broers et al., 1999).

The LMNA gene contains 12 exons. Exon 1 codes for the N-terminal head domain and the first

part of the central rod domain of this gene. Exon 2-6 code for the central α-helical rod domain.

Exons 7-9 code for the C-terminal tail domain for lamin A and lamin C. The nuclear localisation

3

signal (NLS) is contained in exon 7. Exon 10 contains a splicing site to generate lamin A and lamin

C. Exon11 and 12 are specific for lamin A and coding for the CAAX box of pre-lamin A (Lin and

Worman, 1993).

There are three types of B-type lamins (67 kilodaltons) in mammals: lamin B1, lamin B2 and

lamin B3. Lamins B1 and lamins B2 are regulated and expressed in both embryonic and somatic

cells during development whereas lamins B3 is regulated and expressed only in spermatocytes

(Gerace and Blobel, 1980; Hutchison, 2002). Lamin B1 is encoded by LMNB1 and lamin B2 and

lamin B3 are encoded by LMNB2 genes on chromosomes 5q23.2-q31.3 and 19p13.3, respectively

(Lin and Worman, 1995; Dechat et al., 2008). LMNB1 gene contains 11 exons. Exon 1 codes for

the N-terminal head domain and the first part of the central rod domain of this gene. Exon 2-6 code

for the central α-helical rod domain. Exons 7-11 code for the C-terminal tail domain of lamin B.

The nuclear localisation signal (NLS) is contained in exon 7. Exon11 contains a specific sequence

for the CAAX box lamin B for post-translational farnesylation (Lin and Worman, 1993).

Little is known about the regulation of lamins gene expression. Some information are available

on the regulation of LMNA gene expression. LMNA promoter presents different regulatory motifs

among which a retinoic acid-responsive element (Okumura et al., 2000), binding sites for various

transcription factors such as c-Jun, c-Fos and Sp1/3 (Okumura et al., 2004) or transcriptional

coactivator such as CREB-binding protein (Janaki and Parnaik, 2006). Within the first intron of

LMNA gene there are also binding sites for two transcription factors, the hepatocyte nuclear factor-

3β and the retinoic X receptor β (Arora et al., 2004).

The nuclear lamins have a well-defined conserved domain structure consisting of an amino

(N)-terminal globular domain, a central α-helical rod comprising four coiled-coil domains separated

by linker regions L1, L12 and L2, and a globular carboxy (C)-terminal tail domain. Like the

components of other intermediate filaments, the lamin alpha-helical domain is used by two monomers to

coil around each other, indeed forming a dimer structure called “coiled coil”. Their assembly starts

with the formation of coiled coil dimers which is associated with head to tail overlap. Two of these

dimer structures then join side by side, in an antiparallel arrangement, to form a tetramer called

“protofilament”. Eight of these protofilaments are laterally combined and twisted to form the

characteristic 10 nm intermediate filament structure. These filaments can be assembled or

disassembled in a dynamic manner. Although A- and B-type lamins interact each other in vitro

(Sasse et al., 1998), little is known about their composition and structure in the cells within the

lamina.

4

Schematic structure of lamin proteins. Main characteristics are four central rod domains (1A, B, 2A, B), flanked by a globular head and a globular tail domain.

In the globular tail domain, a nuclear localization signal (NLS) can be identified, as well as a CaaX motif, which is

absent in lamin C but present in lamin A and in B-type lamins. Broers et al., Physiol Re, 2006.

The globular COOH-terminal domain of lamins shows an Ig-like structure. Between the

COOH-terminal part of the rod domain and the Ig-like domain, lamins contain a nuclear

localization signal sequence, not present in other IF proteins (Frangioni et al., 1993). Lamins, with

the exceptions of lamins C and C2, are expressed as a pre-form and end in a C-terminal CAAX

cassette which undergoes a highly structured sequence of posttranslational modifications before

mature lamins are incorporated into the nuclear lamina. The CAAX cassette consists of a cysteine,

two aliphatic amino acids and any COOH-terminal amino acid (Davies et al., 2009). The maturation

process starts with farnesylation at the terminal cysteine site and is followed by cleavage of the last

three amino acid residues of the CAAX motif and methylation of the carboxy-terminal cysteine.

While the maturation of B-type lamins is terminated at this step, resulting in permanent

farnesylation and carboxymethylation, an additional 15 amino acids are removed from the carboxyl

terminus of farnesylated/carboxymethylated prelamin A. The last cleavage probably takes place

during or after incorporation of this molecule into the nuclear lamina.

Besides farnesylation and carboxymethylation, during mitosis lamins are also

posttranslationally modified by phosphorylation (Ottaviano and Gerace, 1985), sumoylation (Zhang

and Sarge, 2008), ADP-ribosylation (Adolph et al., 1987), and possibly by glycosylation (Ferraro et

al., 1989). In fact, during interphase the lamins are localised in the nuclear envelope resulting in a

rim at the nuclear periphery and become dephosphorylated and polymerised at the nuclear periphery

during telophase (Burke and Gerace, 1986; Foisner and Gerace, 1993).

5

Post-translational processing of the carboxyl terminus of prelamin A.

Processing of prelamin A to mature lamin A involves several steps, including farnesylation at the terminal cysteine site,

followed by cleavage of the last three COOH-terminal amino acid residues of the CAAX motif, in this case SIM,

probably by Zmpste24; methylation of the cysteine that is COOH terminal after cleavage, followed by a second

cleavage of the last 15 amino acids, including the newly added isoprene group. The last cleavage probably takes place

during or after incorporation of this molecule into the nuclear lamina. Lamin C is not processed, whereas B-type lamins

are farnesylated but not further processed. Broers et al., Physiol Re, 2006.

Functions of Lamins in Nuclear and cellular architecture

While the most obvious localization of lamins during interphase is at the nuclear periphery, a

growing number of studies suggest that in interphase cells lamins can be found in nucleoplasmic

areas as well. Three levels of lamin organization can be distinguished:

1) lamins associated with the nuclear membrane,

2) lamins organized into intranuclear tubules and aggregates,

3) lamins visible as dispersed (veil-like) structures in the nucleoplasm.

The roles of lamins are mediated by interactions with numerous lamin binding proteins both at

the nuclear periphery and/or in the nucleoplasm. The lamins and associated NE proteins are

scaffolds for proteins that regulate DNA synthesis, gene transcription, responses to DNA damage,

cell cycle progression, cell differentiation, and cell migration (Broers et al., 2006; Verstraeten et al.,

2007; Razafsky et al., 2014). There are many INM proteins binding to lamins either directly or

indirectly. For example, INM proteins such as emerin, MAN1, LBR, LAP1, LAP2β, nesprin, otefin,

and SUN1 have been demonstrated to bind lamins (Foisner, 2003). Lamins can also bind non

6

integral proteins including chromatin, histones (H2A/H2B; Höger et al., 1991), transcription factors

such as E2F, RNA polymerase II transcription machinery (Mattout-Drubezki and Gruenbaum,

2003), pRb (Dorner et al., 2007), BAF (Barrier to Autointegration Factor; Furukawa, 1998),

LAP2α, extracellular signal-regulated kinase (Erk), nuclear actin, and proteins of the nuclear pore

complex such as nucleoporins (e.g. Nup153) (Vlcek et al., 2001; Mattout-Drubezki and

Gruenbaum, 2003; Dechat et al., 2008; Olins et al., 2010). The actual in vivo interactions between

lamins, DNA, chromatin and the INM remain unclear. However, interaction must be specific and

reversible to allow nuclear growth and disassembly during mitosis. After mitosis and during

interphase, the reorganization of nuclear lamina and its assembly at the nuclear periphery is elicited

by the IMPs. Most of these proteins can bind directly to lamin A, lamin B or both (Wilson and

Foisner, 2010).

Model of the location of nuclear lamins and their interaction with nearby localized proteins.

Lamins bind directly to lamina-associated proteins (LBR, LAP2, emerin, MAN1, nesprins-1 and -2), but also to BAF,

Rb, SREBP1, histone proteins, and DNA, and thereby mediate association with a scale of interacting structural proteins,

including SUN1, actin, and possibly tubulin and intermediate filament proteins. Broers et al., Physiol Re, 2006.

7

Lamins/NET complexes have at least three clearly defined or emerging functions in

maintaining cellular architecture. Lamin/NET complexes are important for organizing peripheral

chromatin. The interaction between the lamins and chromatin involve their non-α-helical C-terminal

tail domain and the N- and C-terminal tail domains of core histones (Mattout et al., 2007; Goldberg

et al., 1999). Several proteins have been also described as lamin-binding proteins, which directly

link both A- and B-types lamins to DNA (Schirmer and Foisner, 2007). Among these proteins are a

Lamin B Receptor (LBR; Ye and Worman, 1994), the LAP2α protein, that binds specifically to

Lamin A/C, the LAP2β protein, that interacts exclusively with B-type lamins (Dechat et al., 2000;

Furukawa and Kondo, 1998), and BAF, which has been reported to bind to dsDNA and to histones

(Margalit et al., 2007).

The lamins also have important functions in positioning NPCs within the NE, and have a

crucial role in organizing the cytoskeleton. Specifically, the connection between the cytoplasm and

nucleoplasm might be mediated by the interaction between SUN proteins (SUN1 and SUN2) and

nesprins (nesprin-1, nesprin-2, and nesprin-3) in the luminal space (Padmakumar et al., 2005;

Ketema et al., 2007). In the nucleoplasm Sun proteins interact with Lamin A (Haque et al., 2006),

while in the cytoplasm, nesprins are thought to bind to actin (Warren et al., 2005) and possibly

microtubules (Wiche, 1998). This assembly is referred to as the LINC complex (LInker of

Nucleoskeleton and Cytoskeleton) and establishes a physical connection between the

nucleoskeleton and the cytoskeleton (Crisp et al., 2006).

A model for the LInker of Nucleoskeleton and Cytoskeleton (LINC) complex.

Nuclear components, including lamins, bind to the inner nuclear membrane SUN domain proteins, which in turn bind to

the KASH domain of the actin-associated giant nesprins on the outer nuclear membrane. The LINC complex establishes

a physical connection between the nucleoskeleton and the cytoskeleton. Meinke et al., Biochem Soc Trans., 2011.

8

Lamins during development and differentiation processes

Different expression between nuclear Atype lamins and B-type lamins support the idea of their

alternative functions during development and differentiation. The absence of lamin A/C in

undifferentiated cells is responsible for the deformation of their nuclei. For example, lamin A is

present in late embryos but not expressed in blastocysts whereas lamin A/C is expressed in oocytes

(Prather et al., 1989; Bridger et al., 1993). Foster et al., in 2007, have shown that A-type lamins and

B-type lamins are present at the nuclear envelope in early porcine embryos and that lamin A is also

found in large intranuclear aggregates in two-cell to eight-cell embryos but is lacking in later

embryonic stages (Foster et al., 2007). The regulated expression of A- and B-type lamins is also

evident during differentiation of stem cells in culture. In fact, during the in vitro differentiation

processes, human ES cells appear to express Lamin A/C before a complete down-regulation of the

pluripotency marker Oct-4, suggesting that Lamin A/C expression is an early indicator of ES cell

differentiation (Constantinescu et al., 2006). Differential expression of A- and B-type lamins has

also been shown during neurogenesis in the adult rat brain (Takamori et al., 2007).

The developmental regulation of Lamin A/C expression has led various laboratories to

hypothesize that these proteins play a role in differentiation. This has been recognized in muscle

and adipocyte differentiation processes (Favreau et al., 2004, Frock et al., 2006, Lloyd et al., 2002;

Hubner et al., 2006).

Lamins and diseases

Many aspects of nuclear as well as cytoplasmic activity are affected by modifications of the NE

and the nuclear lamina. Processes as fundamental as DNA replication, transcription, and cell

survival are altered in response to disruption of nuclear lamina, overexpression of mutant or

truncated lamins, and loss-of-function mutations of the LMNA gene. Given the diversity of

functions affected by these alterations, it is not surprising that complex patterns of tissue-specific

pathologies are associated with lamin defects in humans. At present, no mutations in the Lamin B

genes have been linked with human diseases, thus presuming that mutations in B-type lamins could

be embryonic lethal. Conversely, A-type lamins have been in the limelight since the discovery that

LMNA mutations or defective post-translational processing of pre–lamin A causes the majority of

human diseases termed laminopathies, which include systemic disorders and tissue-restricted

diseases (Capell and Collins, 2006; Verstraeten et al., 2007).

9

Classification and clinical phenotype of laminopathies

To date, over 200 mutations from more than 1000 individuals have been identified in the

LMNA gene, and a database on the nuclear envelopathies can be found at http://www.umd.be.

LAMINOPATHIES CLINICAL MANIFESTATIONS

Systemic

HGPS Premature aging, hair loss, loss of subcutaneous fat, premature

atherosclerosis, myocardial infarction, stroke

Atypical Werner's

syndrome

Premature aging, cataracts, scleroderma-like skin changes, premature

atherosclerosis, hair graying

Restrictive

dermopathy

Intrauterine growth retardation, skin alterations, multiple joint

contractures, skull defects

MAD Skull/face abnormalities, clavicular hypoplasia, joint

contractures/lipodystrophy, alopecia, insulin resistance

Tissue restricted

EDMD

Early contractures of the neck/elbows/Achilles tendons, muscle

contractures, wasting of skeletal muscle, cardiomyopathy with

conduction disturbance

DCM Ventricular dilatation, systolic dysfunction, arrhythmias, conduction

defects

Limb-girdle

muscular dystrophy

1B

Slowly progressive shoulder and pelvic muscle

weakness/wasting,contractures, cardiac defects

Charcot-Marie-

Tooth neuropathy

type 2B1

Axonal degeneration, lower-limb motor deficits, walking difficulty,

secondary foot deformities, reduced/absent tendon reflexes starting in

the second decade of life

Dunningan-type

FPLD

Dramatic absence of adipose tissue in the limbs/trunk and

accumulation in the neck/face, hypertriglyceridemia, increased

susceptibility to atherosclerosis/diabetes

10

Different mutations in LMNA gene are associated with different diseases. Most of the mutations resulting in the diseases affecting striated muscles are distributed throughout the gene. The

majority of the mutations that result in Mandibuloacral disease, Dunnigan-type familial partial dystrophy, and

Hutchinson Gilford Progeria syndrome cluster in the region of the LMNA gene encoding the C-terminal globular

domain.

Lamins and cancer

Alterations in the nuclear lamina proteins are thought to be involved in malignant

transformations and cancer processes because of their role as guardian of the genome, their role in

regulating basic nuclear activities that are implicated in tumorigenesis, their interactions with cancer

gene pathways and their role in chromosomal reorganization. Thus, lamin expression in cancer cells

may serve as a biomarker for diagnosis, prognosis and tumor surveillance. The expression of the A-

type lamins is often reduced or absent in various types of cancer and varies widely depending on the

type of cancer, its aggressiveness, proliferative capacity and degree of differentiation. Changes in

A-type lamins have been well documented in the current literature concerning various tumor types

such as leukemia, lymphomas, some skin cancers, including basal cell and squamous cell

carcinoma, adenocarcinoma of the stomach and colon, squamous and adenocarcinoma of the

esophagus, small cell lung and prostate cancers, and testicular germ cell tumors (Stadelmann et al.,

11

1990; Broers et al., 1993; Moss et al., 1999; Venables et al., 2001; Oguchi et al., 2002; Coradeghini

et al., 2006). In ovarian cancer cells, VEGF promotes the invasion, partially via the down-regulation

of Ezrin and Lamin A/C caused by increased expression of miR-205 (Li et al., 2014). We have

previously demonstrated that knockdown of Lamin A/C in human neuroblastoma cells inhibits

retinoic acid-mediated differentiation and results in a more aggressive phenotype (Maresca et al.,

2012).

In general, the expression of A-type lamins has been correlated with a non-proliferating,

differentiated state of cells and tissues (Tilli et al. 2003). Given that tumor progression is often

associated with regression from a more differentiated to a less differentiated state, loss of Lamins

A/C expression may not be surprising. Even though the altered lamins expression are currently

emerging as an additional event involved in malignant transformation and tumor progression, the

role of A-type lamins in the tumorigenesis is not yet characterized and the molecular defects

underlying the loss of A-type lamins in human cancer remain unknown.

Agrelo et al. (2005) has shown that CpG Island promoter hypermethylation of the LMNA gene

is a significant predictor of poor outcome in some lymphomas (Agrelo et al., 2005). Cancer may

also be considered an epigenetic disease and patterns of aberrant DNA methylation are now

recognized to be a common hallmark of human tumors. Since A-type lamins present an important

dual role as protector of chromatin from damage and as multifunctional regulators of gene

transcription, the epigenetic silencing of LMNA gene in hematologic malignancies could aid

understanding how lamin dysregulation could contribute to cellular transformation.

1.2 NEUROBLASTOMA

Neuroblastoma (NB) is an extra-cranial heterogeneous tumor of the sympathetic nervous

system (Esiashvili et al., 2009). The first description of pediatric tumors under the term

“neuroblastoma” was made by Dr. James Homer Wright of the Massachusetts General Hospital as

early as 1910 (Modak et al., 2010). Today approximately 120 new cases are diagnosed in Italy each

year, rendering this tumor the most common extra-cranial pediatric cancer. In 95% of cases, NB is

diagnosed before the age of 5 years where it leads to 15% of all cancer-related fatalities in infancy

and childhood (Mueller et al., 2009). Despite a century of extensive clinical and basic research

efforts, the biology and clinical progression of the disease continues to present a multi-faceted

clinical enigma in pediatric oncology. The most common site for primary NB tumors is the adrenal

medulla; however, tumors can arise anywhere along the sympathetic branch of the autonomic

12

nervous system (Alam et al., 2009). At presentation, the disease can be limited to a single organ,

locally or regionally invasive, or widely disseminated; more than 50% of cases are metastatic at

presentation (Alam et al., 2009). The most common metastatic sites are lymph nodes, bone marrow,

bone, and liver (Alam et al., 2009).

The clinical behavior of NB is highly variable, ranging from highly aggressive phenotypes to

benign tumors with a high propensity for spontaneous regression (Brodeur, 2003). Intriguingly, NB

is both disproportionally lethal despite very aggressive multimodal therapy and associated with a

highest rate of spontaneous and complete regression in a subset of cases (Alam et al., 2009; Brodeur

et al., 2003; Mueller et al., 2009).

Three broad risk categories (low, intermediate, and high risk) have been proposed on the basis

of analysis of age at diagnosis, histology category, grade of tumor differentiation, DNA ploidy, and

copy-number status at the MYCN oncogene locus at chromosome 11q. In particular the MYCN

oncogene is target of high-level amplifications at chromosome band 2p24 observed in about 20% of

NB and since such amplification has been found to profoundly affect the patients’ clinical outcome,

it is routinely used as prognostic biomarker and for treatment stratification (Seeger et al. 1111-16).

MYCN belongs to a family of oncogenes called Myc oncogene-family members, whose most

studied member is the MYC oncogene and include also MYCL oncogene. They are transcription

factors, which activate, together with their dimerization partner Max, gene expression of a number

of genes in an E-box dependent manner. MYCN and MYC probably have very similar molecular

functions (Bonnet et al., 1997). The Myc oncogene-family members are involved in cell growth

through protein synthesis, transcriptional regulation of ribosomal RNA processing, cell adhesion

and tumor invasion.

Neuroblastoma as a sympathetic nervous system-derived tumor

The human nervous system consists of the Central Nervous System (CNS), comprising the

brain and the spinal cord, and the Peripheral Nervous System (PNS), which links the CNS with the

body’s sense receptors, muscles, and glands. The PNS is divided in two components: the somatic or

skeletal nervous system, which controls voluntary movement, and the autonomic nervous system,

which regulates inner organ function via the sympathetic, parasympathetic or enteric ganglia.

The nervous system originates from the neural plate, an embryonic structure evolving from the

ectodermal germ layer during the third week of gestation. During the process of neurulation, the

neural plate invaginates ventrally and closes in order to form the neural tube, which will give rise to

13

the CNS. During this closure, neural crest cells originate at the interface between the closing neural

tube and the dorsal ectoderm (LaBonne and Bronner-Fraser, 1999).

Nervous system development.

Invagination of the dorsal ectoderm, closure of the neural tube, neural crest formation at the interface of the closing

neural folds and dorsal ectoderm, and migration of the pluripotent crest cells. Wislet-Gendebien et al., J Biomed

Biotechnol., 2012.

The neural tube is initially composed of a single layer of cells. However, as development

proceeds and extensive cell division occurs, the neural tube becomes multilayered, with precursor

cells dividing in the medial portion of the neural tube adjacent to the central cavity, which will give

rise to ventricles. The portion of the neural tube adjacent to the ventricles becomes the Ventricular

Zone (VZ) and contains neural stem cells and dividing progenitors (Greene and Copp, 2009). These

stem cell populations are capable of self-renewing through symmetric cell divisions or can

differentiate through asymmetric cell divisions. The neural tube expands in the head of the embryo

to form the brain and in the trunk to form the spinal cord. The early mammalian neural tube is a

straight structure. However, even before the posterior portion of the tube has formed, the most

anterior portion of the tube is undergoing drastic changes. In this region, the neural tube balloons

into three primary vesicles: forebrain (prosencephalon), midbrain (mesencephalon), and hindbrain

(rhombencephalon). By the time the posterior end of the neural tube closes, secondary bulges—the

optic vesicles—have extended laterally from each side of the developing forebrain. The

prosencephalon becomes subdivided into the anterior telencephalon and the more caudal

diencephalon. The telencephalon will eventually form the cerebral hemispheres, and the

14

diencephalon will form the thalamic and hypothalamic brain regions that receive neural input from

the retina. Indeed, the retina itself is a derivative of the diencephalon. The mesencephalon does not

become subdivided, and its lumen eventually becomes the cerebral aqueduct. The rhombencephalon

becomes subdivided into a posterior myelencephalon and a more anterior metencephalon. The

myelencephalon eventually becomes the medulla oblongata, whose neurons generate the nerves that

regulate respiratory, gastrointestinal, and cardiovascular movements. The metencephalon gives rise

to the cerebellum, the part of the brain responsible for coordinating movements, posture, and

balance (Gilbert, 2000).

Early human brain development. The three primary brain vesicles are subdivided as development continues. On the right is a list of the adult derivatives

formed by the walls and cavities of the brain. Gilbert, 2000.

The cerebellum is one of the best studied parts of the brain. The cerebellar cortex is composed

of four main types of neurons: granule cells (GCs, the most numerous neurons of the entire central

nervous system), Purkinje cells (PCs) and two types of inhibitory interneurons, the Golgi cells and

the stellate/basket cells. The cerebellum develops over a long period, extending from the early

embryonic period until the first postnatal years. The main cell types of the cerebellum arise at

different times of development and at different locations. The PCs and the deep cerebellar nuclei

arise from the ventricular zone of the metencephalic alar plate, whereas the GCs are added from the

rostral part of the rhombic lip, known as the upper rhombic lip. The rhombic lip, is the dorsolateral

part of the alar plate, and it forms a proliferative zone along the length of the hindbrain. Cells from

its rostral part reach the superficial part of the cerebellum, and form the external germinal or

granular layer (EGL) at the end of the embryonic period. Granule cells are formed in the EGL. The

15

granule cells form axons, the parallel fibres, and migrate along the processes of Bergmann glia cells

(BGCs) to their deeper, definitive site, the internal granular layer (IGL). In the fetal period, the IGL

is formed by further proliferation and migration of the external germinal cells. This layer, situated

below the layer of Purkinje cells, is the definitive granular layer of the cerebellar cortex. A transient

layer, the lamina dissecans, separates the IGL from the Purkinje cells. Ultimately, it is filled by

migrating granule cells and disappears (Rakic and Sidman, 1970). During the inward migration of

the postmitotic granule cells (16–25 weeks), the Purkinje cells enlarge and develop dendritic trees

(Milosevic and Zecevic, 1998; Miyata et al., 1999). The EGL appears at the end of the embryonic

period and persists for several months to 1–2 years after birth (Lemire et al., 1975).

Differentiation of cerebellar cortical neurons.

GCs (light red) arise (1) from granule cell precursor cells (GCPs) in the external granular layer (EGL), migrate in

several steps (2–7) along the dendrites of Bergmann glia cells (BGCs) to the internal granular layer (IGL).The

development of PCs (red) also involves several steps (a–e). Hatten et al., Curr Opin Neurobiol., 1997.

Neural crest cells delaminate from the neural tube and migrate extensively throughout the

embryo to generate, differentiate, and populate numerous organs. During this migration, neural

crest cells undergo differentiation and form Schwann or glial cells, melanocytes, and

sympathoadrenal progenitor cells. From these sympathoadrenal progenitor cells is derived the

sympathetic nervous system (SNS). SNS’s special feature relates to the organism’s “fight or flight”

response. There are three types of cells present in the SNS: chromaffin cells (adrenal medullary

cells), small intensely fluorescent cells, and sympathetic neurons (known as neuroblasts during

embryogenesis). The migrating neural crest cells are influenced by the molecular guidance given by

various external factors and ligands acting on the receptors present on the surface of the neural crest

cells. The morphology, differentiation, and derivatives of the neural crest cells are also mediated by

16

local tissue interactions. Genetically regulated cell-autonomous factors or exposure to

environmental factors result in disturbances of differentiation, which then give rise to uncontrolled

cell cycle or ectopic tissue formation. Disturbances in neural crest cell regulation are involved in

different serious diseases such as neuroblastoma (Takahashi et al., 2013; Etchevers et al., 2006).

1.3 CANCER STEM CELLS AND NB-TUMOR

INITIATING CELLS

The cancer stem cell theory

To explain the initiation and development of tumors two alternative models have been

proposed: the stochastic model and the hierarchical model. The stochastic model posits that the

tumors are composed of heterogeneous cells and all the cells have the potential to be a tumor-

founding cell. In contrast, the hierarchical model proposes that malignancies are formed of a

hierarchy of cells and are driven by rare subpopulation of cells referred to as cancer stem cells (CSC)

or tumor initiating cells (TIC). Only this subset of cells in the tumor has the potential to form

tumors (Vescovi et al., 2006).

Comparison between the stochastic model and the CSC model for tumor growth.

a) In the stochastic model, oncogenic events (represented by lightning bolts) in one or multiple clones give these cells a

growth advantage. b) In the CSC model only a distinct subset of cells have the potential to proliferate extensively and

form new tumors. Most of the cells lack this ability. Reya et al., Nature; 2001.

17

CSCs are defined as a subset of tumorigenic cells that are endowed with enormous

proliferative, clonogenic, self-renewal, and multi-lineage differentiation potentials in vitro and

tumor-initiating ability in immune-deficient animals such as NOD/SCID mice (Clarke et al., 2006;

Tang et al., 2007; Visvader et al., 2008; Rosen et al., 2009).

CSCs, like their normal counterparts, possess two important and fundamental properties, which

are self-renewal and differentiation. Self-renewal is the ability for CSCs to undergo symmetric

division and replenish the cancer stem cell pool. During differentiation, CSCs may undergo

asymmetric or symmetric division, therefore giving rise to the multi-lineage of differentiated cells

that comprise the heterogeneous populations of cancer cells.

The experimental premise of the cancer stem cell theory is based on the ability to purify CSCs

on their physical and/or functional characteristics, such as cell surface marker expression (CD133,

CD34) or dye exclusion ability (Fábián et al., 2009; Patrawala et al., 2005). A second imperative

requirement to study CSC biology is the development of a reliable assay to quantify CSC

tumorgenicity and proliferation. Current standard in vivo assays employ immunocompromised

rodents such as non-obese diabetic/severe combined immunodeficiency (NOD/SCID) or

NOD/SCID interleukin-2 receptor gamma chain null (Il2rg-/-) mice for xenografts of human cancer

cells (Quintana et al., 2008; Dick et al., 1991).

Using the aforementioned techniques, the first cancer type upon which the CSC theory has

been established is acute myeloid leukemia (AML) (Bonnet et al., 1997). Since 2003, putative CSCs

have been reported for many human solid tumors including brain tumor, breast, colon, pancreatic

and prostate cancers (Singh et al., 2004; Schatton et al., 2008; Al-Hajj et al., 2003; O'Brien et al.,

2007; Dalerba et al., 2007; Li et al., 2007; Hermann et al., 2007).

The cancer stem cell theory predicts that unless the cancer stem cell pool is eradicated by a

given set of therapeutic approaches, the cancer will recur. It is believed that CSCs are inherently

more resistant to standard therapies. This feature can in part be attributed to their functional

similarities with normal stem cells (Pallini et al., 2008). Conversely, therapeutic targeting of these

CSCs will give promising results with reduction in tumor mass and/or incidence of tumor

recurrence (Piccirillo et al., 2006).

18

Cancer stem cell theory.

Conventional therapies usually target cells with limited proliferative potential which results in shrinkage of tumor. As

the putative cancer stem cells escape these therapies, ultimately the tumor is re-established. In contrast, therapies

targeting the CSCs result in loss of tumors ability to regenerate and grow. Reya et al., Nature; 2001.

Isolation and characterization of neuroblastoma tumor initiating cells

Extensive metastases and frequent relapse in NB patients following aggressive treatments gave

rise to early hypotheses that NB contains a set of cells that were inherently more resistant to

therapeutic regiments and had the self-renewal, proliferation and differentiation properties of cancer

stem cells. In 2007, Hansford et al isolated a highly tumorigenic population of sphere-forming cells

from bone marrow aspirates of low and high-risk NB patients with metastatic disease (Hansford et

al., 2007). This population, termed NB tumor-initiating cells (NB-TICs), were expanded under

serum-free neurosphere growth conditions containing basic fibroblast growth factor, epidermal

growth factor and B27, a multi-factor neuronal growth supplement. Similar to brain, breast and

colon CSCs, NB-TICs proliferate as suspension spheres in vitro. Furthermore, NB-TICs express

neuroblastoma markers NB84 and tyrosine hydroxylase as well as the neural crest marker nestin

and have genetic alterations commonly seen in neuroblastoma, further establishing this population

as neuroblastoma-lineage cells (Hansford et al., 2007). Introducing genetically engineered oncolytic

virus is the next generation anticancer therapy. Mahller et al (2009) used nestin-targeted oncolytic

19

herpes simplex virus (HSV), which killed TICs in neuroblastoma and also prevented the formation

of the tumors in athymic nude mice (Mahller et al., 2009).

The identity of TICs in NB in vivo is not yet fully recognized because of their cellular

heterogeneity, which is a significant feature of neuroblastoma. Seventeen cell lines have been

studied and among them the existence of three different cell types was observed, which has been

named N-type (neuroblastic), I-type (intermediate type), and S-type (substrate-adherent) cells

(Rettig et al., 1987). N-type cells have neuritic processes, scant cytoplasm, neurofilaments, granin,

pseudoganglia, and expression of neurotransmitter enzymes. S-type cells have extensive cytoplasm,

vimentin, and CD44 expression. I-type cells express features of both N-type cells and S-type cells.

I-type cells are significantly more malignant than N- or S-type cells, with four- to five-fold greater

plating efficiencies in soft agar and six-fold higher tumorigenicity in athymic mice (Walton et al.,

2004).

These striking characteristics have led to the suggestion that I-type cells represent neural crest

cancer stem cells and, therefore, embody the truly tumourigenic component of neuroblastoma (Ross

et al., 1995).

The presence of highly malignant CSCs could significantly diminish patient prognosis and long

term survival. Indeed, it has been demonstrated that tumours identified as high–risk or exhibiting

progressive disease contain a higher fraction of I-type cells than low-risk tumors . Cell-cell

interaction between the different phenotypic cell variants can influence tumor viability,

tumourigenicity and even response to therapy (Ross et al., 2003).

1.4 microRNAs

MicroRNAs (miRNAs) are evolutionally conserved, small non-coding RNAs that are about 19-

22 nucleotides (nt) long. miRNAs modulate gene expression by repressing their targets’ translation

or inducing mRNA degradation through binding to the complementary sequence in target

messenger RNA. miRNAs are annotated and catalogued in the public-accessible web-based

database miRBase (www.mirbase.org), which was founded at the Sanger Institute in England and is

now managed by the University of Manchester. So far, 1881 mature miRNAs have been reported in

humans (miRbase, Kozomara and Griffiths-Jones, 2014). The miRNA nomenclature is managed by

miRBase and has been slightly changed with upcoming releases of the database. In general, miRNA

names start with a 3-4-letter prefix to designate the species (e.g. hsa- for homo sapiens miRNAs).

They are further assigned by a three-letter prefix, such as miR- or let-, followed by a sequential

number (e.g., miR-1). By definition, the mature miRNA is labeled “miR” (Griffiths-Jones et al.,

20

2006) while the precursor is labeled “mir”; however, this discrimination is not stringently used in

the literature, and it has been recommended to use “mature” or “precursor” when a clear distinction

is necessary. Identical miRNAs transcribed from different genes are given a numeric suffix, e.g.

miR-1–1 and miR-1–2. Very similar miRNAs (paralogous miRNAs), often sharing the same seed

sequence, are designated as a “miRNA family” (e.g. mir-29 family) and discriminated by numeric

and letter suffixes (e.g. mir-29a, mir-29b, mir-29c; Ambros et al., 2003). In some cases, two mature

miRNAs are processed from the same stem-loop precursor, one from each arm, and are accordingly

designated by an additional suffix “-5p” (for that released from the 5’-arm) and “-3p” (for that

released from the 3’-arm); e.g., miR-199a-5p and miR-199a-3p. The star-forms (miR*), previously

used for minor forms, have been “retired” according to the latest nomenclature convention

(Kozomara et al., 2011).

miRNA biogenesis

The biogenesis of miRNAs is a complex multi-step process that starts in the nucleus and ends

in the cytoplasm of cells. Most miRNAs are transcribed as long monocistronic or polycistronic

primary transcription units (primary miRNA or pri-miRNA) by RNA polymerase II. Typically, a

pri-miRNA is characterized by a hairpin structure, containing a double-stranded (ds) RNA stem of

∼33 base pairs (bp), a terminal loop, and single-stranded (ss) RNA flanking regions. The stem-loop

structure contains the miRNA in the 5’ or 3’ half of the stem. The pri-miRNA is cleaved in the

nucleus by a protein complex (the “microprocessor complex”) consisting of several proteins

including the RNase III enzyme, Drosha and its co-factor DGCR8. DGCR8 functions as a

molecular anchor and defines the binding site for the microprocessor, while Drosha cleaves the

RNA approximately 11 bp from the ss-dsRNA junction, producing the shorter, ∼ 65-70-nucleotide

long hairpin pre-miRNA.

Following completion of this nuclear processing step, the pre-miRNA is exported from the

nucleus to the cytoplasm by the Exportin-5. Here, the pre-miRNA is cleaved by another RNAse III

enzyme called Dicer. Dicer cleaves ∼22 nt from the pre-existing end of the pre-miRNA, producing

∼22 nt double-stranded RNA molecules. One of the two strands (the guide strand or mature

miRNA) is, selected upon thermodynamic properties, loaded on an Argonaute (Ago) protein, the

main constituent of the RNA-Induced Silencing Complex (RISC). The other strand (passenger

strand) is degraded. The mature miRNA sequence guides the RISC complex to recognize and target

partial complementary mRNA sequences, primarily within the 3’-untranslated region (3’UTR)

(Kim et al., 2009; Siomi et al., 2009; Guarnieri et al., 2008).

21

miRNA biogenesis pathways and function in gene regulation.

Winter et al., Nature Cell Biology; 2009.

The mechanisms of miRNA-mediated post-transcriptional regulation on target mRNAs include

blocking the translation and/or inducing the degradation of mRNAs by deadenylation and

decapping processes (“mRNA-destabilization scenario”). No matter which mechanism

predominates, the overall output is the reduction of amount of protein encoded by the target

messenger (Bartel, 2009).

As miRNAs tend to target many different mRNAs, and each mRNA may contain several to

hundreds of different miRNA binding sites, it is obvious that the miRNA-mRNA regulatory

network is extremely complex. It has been estimated that 30-60 % of all human genes are regulated

by miRNAs (Lewis et al., 2005; Friedman et al., 2009). miRNA regulation is involved in almost all

physiological processes, including stem cell self-renewal, differentiation, proliferation, metabolism,

survival and death pathways (Guarnieri et al., 2008; Huang et al., 2011). As a consequence of this

broad function, miRNA biogenesis has to be tightly controlled. Good functionality of the nuclear

membrane and in particular nuclear lamins could play a crucial role in biological functions such as

22

miRNA processing. Deregulated miRNA expression has been associated with a variety of diseases,

including cancer. Changes in the composition of the nuclear membrane occur during the

progression of several types of cancers that could be associated to miRNA deregulation (Park et al.,

2009; Weber et al., 2010). Furthermore, miRNA transcription is regulated by several transcription

factors, including oncogenes like MYCN.

miRNAs may function as oncogenes or tumor suppressor genes in NB

Chen and Stallings demonstrated that miRNAs play a role in NB pathobiology (Chen et

Stallings, 2007). The aberrant expression of miRNAs in NB suggests that these miRNAs may

function as either oncogenes or tumor suppressor genes. For example, Fontana et al demonstrated

that the five miRNAs mapping within the miR-17--92 polycistronic cluster (miR-17-5p, -18a, -19a,

-20a and -92) were expressed at high levels in NB cell lines (Fontana et al., 2008). High expression

of miR-17-92 cluster promotes several aspects of oncogenic transformation, including inhibition of

apoptosis and oncogene-induced senescence (Hong et al., 2010), by targeting p21 WAF1, pRB and

E2F1 (Cloonan et al., 2008; Hong et al., 2010). Moreover, recently it was shown that miR-20a,

miR-9 and miR-92a, which are critical for cell differentiation and are modulated by MYCN

oncogene, are able to modulate the apoptotic program at the early stage of NB differentiation by

regulating the expression of various apoptosis-related genes (Guglielmi et al., 2014).

On the other hand, many miRNAs that are under-expressed in NB might exert tumor

suppressor functions. For example, miR-34a functions as a potential tumor suppressor by inducing

apoptosis in NB cells. miR-34a directly targets the mRNA encoding E2F3 and significantly reduces

the levels of E2F3 protein, a potent transcriptional inducer of cell-cycle progression (Christoffersen

et al., 2010). Other important tumor suppressive miRNAs include mR-101, which targets the proto-

oncogene MYCN and inhibits cell proliferation in MYCN-amplified NB (Buechner et al., 2011).

miRNA regulation of CSC

Increasing evidences have suggested that miRNAs might be involved in regulating CSC

properties, including self-renewal and differentiation, tumorigenesis, metastatic potential and

chemoresistance. First, miRNA signature specific for CSC populations has been reported in several

cancers. In breast cancer, Yu et al. reported that let-7 as well as a number of other miRNAs

including miR-16, miR-107, miR-128 and miR-20b were significantly reduced in breast CSCs

(BCSC) enriched by consecutively passaging breast cancer cell line SKBR3 in mice treated with

23

chemotherapy (Yu et al., 2007). Clarke’s group used the cell surface CD44 and CD24 marker

expression to enrich BCSC, and identified a set of 37 miRNAs to be differentially expressed in

CD44+/CD24

-/lo BCSC population, in which three clusters, miR-200c-141, miR-200b-200a-429,

and miR-183-96-182 were significantly downregulated (Shimono et a., 2009). miRNA deregulation

has also been reported in glioblastoma and other brain CSCs (Gal et al., 2008, Godlewski et al.,

2009; Garzia et al., 2009). For example, by comparing miRNA expression in CD133+ glioblastoma

stem cells with the CD133- population, Gal et al. showed that miR-451 as well as miR-486, miR-

425, miR-16, miR-107 and miR-185 level were increased in the CD133- population (Gal et al.,

2008). In hepatic CSCs identified by EpCAM+AFP

+ profile, researchers also discovered a unique

miRNA signature in which miR-181 family and several miR-17-92 cluster members were up-

regulated in the CSC population (Ji et al., 2009).

Several studies have reported that miR-155 is involved in one most critical step in the

metastatic cascade, epithelial-mesenchymal transition (EMT). EMT is a remarkable example of

cellular plasticity that involves the dissolution of epithelial tight junctions, the intonation of

adherens junctions, the remodeling of the cytoskeleton, and the loss of apical-basal polarity. In cells

undergoing EMT, the loss of epithelial cell adhesion and cytoskeletal components is coordinated

with a gain of mesenchymal components and the initiation of a migratory phenotype (Wang et al.,

2003; Zavadil et al., 2007). Kong et al. reported that miR-155 plays an important role in TGF-beta-

induced EMT, cell migration and invasion by targeting RhoA, disrupting tight junction formation

(Kong et al., 2010).

24

2 AIM

Based on our previous data showing that Lamin A/C is necessary for the differentiation of

neuroblastoma cells and its loss is associated to increased cell aggressiveness, and considering that

Lamin A/C is expressed uniquely in differentiated tissues, I intended to identify a role of Lamin

A/C in the maturation of cells of neuronal origin.

I hypothesize that the lack of Lamin A/C could predispose cells toward a stem-like phenotype,

thus influencing the development of tumor-initiating cells (TICs) with self-renewal features in

neuroblastoma. In a tumor-mass, TICs constitute a rare tumorigenic cell population responsible for

sustaining tumor growth, metastases and relapse. Moreover, the amplification of the MYCN gene,

encoding for a known transcription factor, is one of the most important molecular features in

neuroblastoma, correlating with rapid disease progression and poor prognosis. Hence, considering a

possible opposite role of the LMNA and the MYCN genes I intended to investigate whether an

inverse relationship between LMNA and MYCN gene expression could exist in neuroblastoma. In

particular, I hypothesized a possible reciprocal regulation between the two genes mediated by

microRNAs.

To address this hypothesis I used as experimental model the SH-SY5Y and LAN-5 human

neuroblastoma cell lines expressing LMNA or MYCN alternatively. We also employed the SH-

SY5Y model in which we have previously silenced LMNA gene.

25

3 MATERIALS AND METHODS

Human NB biopsy RNA extraction and real‐time RT‐PCR

Total RNA was extracted from twenty-three frozen biopsies of human newly diagnosed NBs

obtained from Department of Pediatrics and Infantile Neuropsychiatry of Sapienza University,

Rome using TRIzol reagent (Life Technologies) according to the manufacturer’s instructions. RNA

was reverse-transcribed, and real-time PCR performed as described above. Institutional written

informed consent was obtained from the patient’s parents or legal guardians according to the local

institutional guidelines.

Cell line maintenance and sphere formation

The SH-SY5Y NB cell line was purchased from ATCC. In this study, we also used two SH-

SY5Y-derived clones, LMNA-KD and control (CTR) cells that were grown as previously described

(Maresca et al., 2012). The LAN-5 NB cell line (a gift from Dr. Doriana Fruci) was grown in

RPMI-1640 medium (Gibco) supplemented with 10% FBS (Hyclone), 2 mML-glutamine and 1%

penicillin/streptomycin in a fully humidified incubator containing 5% CO2 at 37°C. To obtain

spheres, cells were plated in a serum-free media in 60-mm, low-attachment culture dishes at a

density of 9.5x105 cells/cm

2 and cultured in Neurobasal Medium (Gibco) supplemented with 20

ng/ml Epidermal Growth Factor (EGF, Sigma), 40 ng/ml basic Fibroblast Growth Factor (bFGF,

Sigma), 1% neuronal supplement N2 (Gibco) and B27 (Gibco), and 2 µg/ml heparin. Three days

after seeding, the cells formed floating neurosphere-like structures that grew rapidly until day 7.

Before these structures became necrotic, we harvested and suspended them in Accutase enzymatic

solution (Gibco) for 5 min at 37°C and then mechanically dissociated into a single-cell suspension.

The cells were re-seeded in the same conditions as above, and the secondary spheres were allowed

to form. As positive and negative controls, we used NB LAN-5 and SH-SY5Y cell lines,

respectively. TICs were derived by harvesting the secondary spheres, treating them with Accutase

enzymatic solution (Gibco) for 5 min at 37°C and then mechanically dissociating them into a

single-cell suspension. These cells were seeded in adherent conditions in the presence of 1:1

mixture of Eagle's Minimum Essential Medium and F12 medium (Gibco) supplemented with 10%

FBS (Hyclone), 2 mM L-glutamine, 0.5% non-essential amino acids, 0.5% sodium pyruvate and

1% penicillin and streptomycin.

26

Primary cell coltures of Granule Cells

Cultures enriched in granule neurons were obtained from dissociated cerebella of 8-day-old

Wistar rats (CGC; Charles River, Calco, Italy) according to the procedure described by Levi et al.

(1984). Cells were seeded (3 x 106 cells/dish) on poly-L-lysine-coated 35-mm plastic dishes

(NUNC, VWR International PBI s.r.l., Milano, Italy) in basal medium Eagle (BME; Life

Technologies, Gaithersburg, MD, USA) supplemented with 10% heat-inactivated fetal calf serum, 2

mM glutamine and 25 mM KCl and 100 µg/ml gentamycin (Life Technologies, Gaithersburg, MD,

USA). Ara-C (10 mM) was added to the culture medium 24 h after plating to prevent proliferation

of nonneuronal cells.

Generation of Lentiviral Infection of Granule Cells

The cells were seeded into 35-mm plastic dishes previously coated with poly-L-lysine at a

concentration 3,5 x 105 cells/dish. After four hours, the cells were infected for 18 hours with the

virus-containing supernatant from pLenti6/V5-GW/EmGFP-miR-LMNA or pLenti6/V5-

GW/EmGFP-miRNeg (Maresca et al. 2012), and then fresh medium was added. The miRNA

expression was monitored by checking the simultaneous coexpression of the EmGFP reporter gene

by fluorescence microscopy.

Glutamate toxicity and neuronal survival

After 2, 5 and 8 days in culture, cells were washed once in Locke solution (in mM: 154 NaCI,

5.6 KCI, 3.6 NaHC03, 2.3 CaC12, 1.0 MgC12, 5.6 glucose, 10 HEPES, pH 7.4) and exposed at

room temperature to a 100 µM glutamate pulse in Mg2+

-free Locke solution for 30 min. Cells were

subsequently washed in Mg2+

-free Locke solution, replenished with their original medium and

returned to the incubator. After 18 h, viable cells were assessed by counting the numbers of intact

nuclei as described by Soto and Sonnenchein (1985), modified for counting cerebellar granule cells

by the procedure of Volontè et al. (1994). This method has been shown to be reproducible and

accurate and to correlate well with other methods of assessing cell survival-death (Stefanis et al.

1997; Stefanis et al. 1999). Cell counts were performed in triplicate and are reported as means ±

SEM. The data are expressed as the percentage of intact nuclei in the control cultures at each time

point.

27

Colony-forming assay

The LMNA-KD and sphere-derived adherent cell line were seeded at decreasing clonal

densities (range: 15–1,000 cells/dish) in 60-mm Petri dishes. Fifteen days after seeding, the cells

were fixed for 10 min in ice-cold methanol. A solution of 0.5% crystal violet in 25% methanol was

added to the monolayer for 30 min. The dishes were then washed with ddH2O, and the colonies (at

least 50 cells) were counted. The results were expressed as plating efficiency (percentage of

colonies formed from the number cells seeded).

Tumor sphere CD133 immunofluorescence

Spheres were cultured as previously described, harvested and then allowed to spontaneously

settle in a 50-mL polypropylene conical tube. Excess supernatant was removed. Spheres were

dispensed in an 8-well µ-Slide (Ibidi) and allowed to settle, and Matrigel from a 5X Matrigel BME

Coating Solution (Trevigen) was added to 0.1X. The cells were fixed in ice-cold methanol for 20

min and permeabilized in 0.5% Triton X-100 containing 0.3% serum for 10 min. Blocking was

carried out in Tris-buffered saline (TBS) solution with serum (1:5) for 10 min. The primary

antibody anti-CD133 (clone 293C3; Miltenyi Biotec) was diluted in the blocking solution with

0.5% Tween-20, and the spheres were incubated overnight. The cells were washed three times in

TBS and incubated with goat anti-mouse Alexa 594 F(ab)2 (in TBS plus 0.5% Tween-20). After

three washes in TBS, the nuclei were stained with Hoechst 33342. Images were acquired using a

confocal laser scanning microscope (Leica Confocal Microsystem TCS SP5). The images were

processed using Leica Application Suite 6000, the brightness and contrast of the acquired images

were adjusted, and the figures were generated using Adobe Photoshop 7.0.

Immunoistochemistry

Cerebella of E10, P10 (i.e., 10 d and 18 d of age) and P18 rats (for EGL or lesion analysis)

were dissected out and fixed by immersion overnight in 4% PFA in PBS–DEPC. Fixed cerebella

were cryoprotected before sectioning in 30% sucrose in PBS–DEPC overnight at 4°C and frozen at

−80°C until use. Cerebella were then embedded in Tissue-Tek OCT (Sakura Finetek), and

midsagittal sections of 20 μm were cut on a rotary microtome. Primary antibodies used were a

mouse monoclonal antibody raised against NeuN (Millipore Bioscience Research Reagents;

MAB377; 1:100), a mouse monoclonal antibody against Lamin A/C (clone JOL2; Chemicon

International; 1:10). Secondary antibodies used to visualize the antigen was donkey anti-mouse

28

Cy2-conjugated and Alexa 647-conjugated (Invitrogen). Nuclei were stained with Hoechst 33342.

Images of the immunostained sections were obtained by laser-scanning confocal microscopy using

a TCS SP5 microscope (Leica Microsystems) and were analyzed by the I.A.S. software (Delta

Sistemi).

Western blot analysis

GCs monolayers were washed twice with 1X PBS and then incubated for 1 min in urea buffer

(8M urea, 100mM NaH2PO4 and 10mM Tris pH 8), harvested and briefly sonicated. The proteins

were run on a pre-cast polyacrylamide NuPAGE 10% Bis-Tris gel (Life Technologies). The

resolved proteins were blotted overnight onto nitrocellulose membranes, then blocked in 1X PBS

containing 5% non-fat milk for at least 1 h. The blots were incubated with the following primary

anti-human antibodies: monoclonal anti-Lamin A/C (clone JOL2; Chemicon International);

monoclonal anti-GAPDH (6C5; Millipore). After washing, the membranes were then incubated for

45 min with the secondary donkey anti-mouse or anti-rabbit antibody IRdye800 (LI-COR). After

further washing, membranes were then analysed with a Licor Odyssey Infrared Image System in the

800 nm channel. Blot scan resolution was 150 d.p.i.

N-Myc FACS analysis

SH-SY5Y CTR, LMNA-KD cells and TICs were analyzed by indirect immunofluorescence.

The cells were harvested, washed in cold 1X PBS and fixed (1x106 cells/ml) in a solution

containing cold acetone/methanol (1:4 v/v) in 50% 1X PBS. For each sample, 1x106 cells were

incubated with the human monoclonal antibody anti-N-Myc (Santa Cruz) in medium containing

10% FBS and 0.5% Tween 20 for 1 h at room temperature. After washing in PBS, the cells were

incubated with FITC-conjugated goat anti-mouse IgG (BD, Pharmingen) in PBS for 50 min. After

an additional wash in PBS, the samples were measured using a FACSCalibur cytofluorimeter

(Becton Dickinson). Samples incubated with IgG isotype control antibody were used as negative

controls, and NB LAN-5 cells were used as a positive control. The analysis was performed using

the CellQuest software package. To determine the N-Myc immunofluorescence positivity we used

the method of 2% of background.

29

Side population

To analyze the side population phenotype, LMNA-KD cells were stained according to the

protocol of Goodell et al. 35

. Briefly, 5.0x106 cells/ml were suspended in pre-warmed DMEM.

Hoechst 33342 (Sigma) was added at a final concentration of 5 µg/ml in the presence or absence of

50 µM verapamil (Sigma), and the cell samples were incubated for 90 min at 37°C with intermittent

shaking. After incubation, the cells were washed with ice-cold PBS, resuspended in ice-cold PBS,

and analyzed for Hoechst33342 efflux with a FACS Aria II (Becton Dickinson). The Hoechst

33342 dye was excited at 375 nm, which is near-ultraviolet, and the resultant fluorescence was

measured at two wavelengths, using 450/40 BP and 670 LP filters for the detection of Hoechst blue

and red, respectively. All data were analyzed using the Diva 6.1 Software (Becton Dickinson).

In vivo experiments

Six- to eight-week-old CD-1 male nude (nu/nu) mice weighing 22–24 g were purchased from

Charles River Laboratories (Calco, Italy). The procedures involving mouse care were in compliance

with the Regina Elena National Cancer Institute animal care guidelines and with international

directives (directive 2010/63/EU of the European parliament and council; Guide for the Care and

Use of Laboratory Animals, United States National Research Council, 2011). To evaluate the

tumorigenic ability of LMNA-KD cells or sphere-derived adherent cells, the mice were injected

subcutaneously into the left flank with various concentrations of cells (from 5x104 to 1x10

7

cells/mouse) in 200 µl of Matrigel (BD Biosciences-Discovery Labware). Each group included five

mice. Tumor sizes were measured three times a week in two dimensions using a caliper, and tumor

weight was calculated using the following formula: a×b2/2, where a and b are the long and short

diameters of the tumor, respectively.

Histopathological analysis

The engrafted tumors were fixed with 4% phosphate-buffered formalin, and paraffin-embedded

sections were stained using hematoxylin and eosin (H&E). The sections were then subjected to

morphological analysis.

30

Total RNA preparation

Total RNA was isolated using a Total RNA purification kit (Norgen Biotek). RNA quantity

was determined by measuring absorbance at 260 nm using a NanoDrop UV-VIS spectrophotometer.

The quality and integrity of each sample was confirmed using a BioAnalyzer 2100 (Agilent RNA

6000 Nanokit); samples with an RNA Integrity Number (RIN) index lower than 8.0 were discarded.

PCR Array

RNA was reverse transcribed using TaqMan MicroRNA Reverse Transcription kit (Applied

Biosystems). cDNA was preamplified using TaqMan PreAmp Master Mix (Applied Biosystems).

qRT-PCR was performed with an Applied Biosystem 7900HT thermal cycler using TaqMan human

microRNA array (TaqMan Human microRNA Array A #4398977 and B v3.0 #442812; Applied

Biosystems) according to manufacturer’s instructions. The downstream analysis filtered out

miRNAs not detected in both cell lines (293), whereas those specifically expressed either in LAN-5

or in SH-SY5Y were considered and reported as cell line-specific. Data were then normalized

calculating the ∆Ct value for single miRNA against the average of the specific controls for each

card according to manufacturer's instructions. Differential expression analysis was performed

according to ∆∆Ct method and only RQ ≥ 2 fold-change were considered for further analysis.

miRNAs clusters were generated through the DIANA web tool mirPath v2.0 using miRBase

MIMAT IDs (Release 21) remapped to the newest human genome assembly (GRCh38) to avoid

duplicate entries present in the previous release. Uniquely targets reported in TarBase database v7.0

were included in the clustering, predicted targets were not taken into account. False Discovery Rate

(FDR) correction was applied to the original p-value and only clusters with corrected p-values <

0.05 were shown.

miRNA Assays

Equal amounts of RNA were reverse transcribed with the TaqMan® MicroRNA Reverse

Transcription Kit (Applied Biosystems) according to the manufacturer’s instructions, with a custom

1X RT primer pool (hsa-miR-101-3p ID 002253; has-miR-34a ID 000426; U6 snRNA ID 001973).

Real time PCR analysis was performed with an Applied Biosystems 7900HT thermal cycler using

20X Individual TaqMan® MicroRNA Assays.

31

Hsa-miR-101 inhibitor and mimic

SH-SY5Y control and LMNA-KD cells were seeded at a density of 5x104 cells/cm

2. After 24 h,

the cells were transfected overnight in the presence of 10% FBS with mirVana miRNA inhibitor,

miRNA mimic or the respective negative controls. Lipofectamine RNAiMAX Reagent (Life

Technologies) was used as the transfection reagent, according to the manufacturer’s instructions.

We transfected the has-miR-101 inhibitor (MH11414, Ambion) and the mimic (MC11414,

Ambion) at a final concentration of approximately 50 nM. The mirVana miRNA inhibitor and

mimic negative control were used at the same final concentration of 50 nM. Samples were

harvested at 72 h to perform mRNA expression analysis.

Real‐time RT‐PCR analysis

RNA (500 ng) was retro-transcribed with High-Capacity cDNA Reverse Transcription Kit

(Applied Biosystem) according to the manufacturer‟s instructions. Equal amount of cDNA was

then subjected to real time PCR analysis with an Applied Biosystems 7900HT thermal cycler, using

the SensiMix SYBR Kit (Bioline) and the following specific primers at a concentration of 200 nM:

Primer Unigene Sequence

ABCG2 Hs. 480218 F: TGGCTTAGACTCAAGCACAGC

R: TCGTCCCTGCTTAGACATCC

BMI1 Hs.380403 F: TTCTTTGACCAGAACAGATTGG

R: GCATCACAGTCATTGCTGCT

CD34 Hs. 374990 F: GCGCTTTGCTTGCTGAGT

R: GGGTAGCAGTACCGTTGTTGT

CD44 Hs. 502328 F: GACACCATGGACAAGTTTTGG

R: CGGCAGGTTATATTCAAATCG

EDN1 Hs. 511899 F: TGAGAGGAAGAAAAATCAGAAGAAG

R: TTTCTCATGGTCTCCGACCT

ENPP2 Hs. 190977 F: GCACATCGAATTAAGAGAGCAG

R: GGGGGAGTCTGATAGCACTG

GAPDH Hs.544577 F: AGCCACATCGCTCAGACA

R: GCCCAATACGACCAAATCC

MYCN Hs.25960 F: CCACAAGGCCCTCAGTACC

R: TCCTCTTCATCATCTTCATCATCT

NANOG Hs.635882 F: AGATGCCTCACACGGAGACT

R: TTTGCGACACTCTTCTCTGC

NES Hs. 527971 F: TGCGGGCTACTGAAAAGTTC

R: TGTAGGCCCTGTTTCTCCTG

32

Each experiment was performed in triplicate. The expression data were normalized using the Ct

values of GAPDH and TBP.

Statistical analysis

Student’s t test (unpaired, two-tailed) was used for statistical comparison of different tumor

weights and between two groups. If there were more than two groups, we used the one-way

ANOVA test.

POU5f Hs.249184 F: CTTTGAGGCTCTGCAGCTTAG

R: GGTTTCTGCTTTGCATATCTCC

PROM-1 Hs.614734 F: TCCACAGAAATTTACCTACATTGG

R: CAGCAGAGAGCAGATGACCA

SOX2 Hs.518438 F: TGCTGCCTCTTTAAGACTAGGAC

R: CCTGGGGCTCAAACTTCTCT

TBP Hs.590872 F: GAACATCATGGATCAGAACAACA

R: ATAGGGATTCCGGGAGTCAT

VIM Hs.455493 F: GTTTCCCCTAAACCGCTAGG

R: AGCGAGAGTGGCAGAGGA

Gabra6 Rn.29890 F: AATGTCAGTCGGATTCTTGACA

R: TGTTTTGACCTCTGTTACAGCAC

Lmna Rn.44161 F: GAGCAAAGTGCGTGAGGAGT

R: TCCCCCTCCTTCTTGGTATT

Prom1 Rn.144589 F: GCATTCTCAGACCTGGACAGT

R: TGGGTTTTAGTTGGCCCTTT

Nes Rn.9701 F: CCCTTAGTCTGGAGGTGGCTA

R: GGTGTCTGCAACCGAGAGTT

Tbp Rn.22712 F: CCCACCAGCAGTTCAGTAGC

R: CAATTCTGGGTTTGATCATTCTG

Tubb3 Rn.43958 F: CAGAGCCATTCTGGTGGAC

R: GCCAGCACCACTCTGACC

Zic2 Rn.64359 F: TCAACACACCAACCCATAGC

R: AAAAATACATTCACAAGCGTTGG

33

4 RESULTS

Abundance of LMNA in NB tumors is inversely correlated with that of MYCN

gene

We analyzed the expression levels of the LMNA and MYCN genes in 23 NB biopsies obtained

from the Department of Pediatrics and Infantile Neuropsychiatry of Sapienza University. The

tumors were classified according to the International Neuroblastoma Pathology Classification

(INPC) and staged as stages 1 to 4. Nine of 23 cases showed amplification of MYCN DNA. The

expression levels of the two genes significantly inversely correlated (p=0.01), independently of the

DNA amplification of MYCN, in 21 out of the 23 cases analyzed; i.e., as LMNA increased, MYCN

gene expression decreased (Fig. 1).

Figure 1. The expression of LMNA and MYCN are inversely correlated in NB human biopsies.

qRT-PCR analysis of the LMNA (white) and MYCN (black) genes in 23 NB human biopsies. Data (means+SD [n=3])

are reported as the deltaCt values normalized against the endogenous control. The deltaCt values are inversely

correlated with the amount of the gene present in the sample. Statistical significance: **p≤0.01.

34

We decided to study this inverse relationship between LMNA and MYCN gene in an in vitro

experimental model of NB. We choose the SH-SY5Y and LAN-5 cell lines, which express only

LMNA or MYCN gene encoding proteins, respectively (data not shown). In particular, since Lamin

A/C has been demonstrated to play an epigenetic role in regulating gene expression and miRNAs

can be targeted by MYCN, we hypothesized a possible reciprocal regulation between the two genes

mediated by miRNAs.

We performed a miRNA expression profiling of LAN5 and SH-SY5Y cells using TaqMan

Human MicroRNA Arrays. A total of 768 miRNAs, present in the array, were analyzed in each cell

line. The distribution of the expressed miRNAs is shown in a Venn diagram where a total of 417

(66 specific and 351 common) and of 395 (44 specific and 351 common) miRNAs were found

expressed in LAN-5 and SH-SY5Y cells, respectively (Fig. 2A). We found 359 and 337 miRNAs

not expressed in SH-SY5Y and LAN-5 cells, respectively (293 not expressed at all in both cell

lines). We identified a set of 202 out of the 351 common miRNAs differentially expressed at least

2-fold change between the two cell lines (99 in the LAN-5 and 103 in the SH-SY5Y cells); whereas

149 miRNAs were filtered out by the threshold applied. A scatter plot analysis shows the

correlation between miRNA expression values (Ct) in LAN-5 and SH-SY5Y cell lines (Fig. 2B).

Grey dots distributed along the bisector line represent miRNAs similarly expressed in the two lines

(n=149). While, red or green dots correspond to miRNAs with high expression in the LAN-5

(n=165) and SH-SY5Y (n=147), respectively.

Figure 2. Functional analysis of miRNA target genes in LAN-5 and SH-SY5Y cell lines.

(A) Venn diagram of expressed miRNAs in SH-SY5Y and LAN-5 cells. The number in parenthesis represents the total

miRNAs expressed in each line. (B) Scatter plot of the miRNA Ct values normalized against endogenous controls in

SH-SY5Y and LAN-cells. Grey dots represent unchanged miRNAs between the two cell lines; green dots are the SH-

SY5Y miRNAs; red dots represent LAN-5 miRNAs.

35

Considering the specifically and the differentially expressed miRNAs we performed a

functional analysis using the DIANA-mirPath 2.0 tool, and in particular the software TarBase

which uniquely clusters those miRNAs whose targets are experimentally validated (Vlachos et al.,

2014). We filtered the clusters obtained based on their significance (FDR corrected p < 0.05). As to

be expected, target genes resulted grouped into functional categories associated with cancer

phenotype. The most modulated miRNAs in both cell lines belong to pathways involved in the

regulation of cell proliferation, apoptosis, and response to treatment: “p53 signaling pathway”, “cell

cycle”, “pathways in cancer”, “PI3K-Akt signaling pathway”, “transcriptional misregulation in

cancer”. These pathways are consistent with the inherent phenotypic characteristics of the two cell

lines and correlate to their different capacity to proliferate, to undergo apoptosis, to migrate and

invade (Appendix). Since a single miRNA can inhibit several target mRNAs and multiple miRNAs

can target a single mRNA in a combinatorial fashion, to identify more accurately the differences

between the miRNome profiles of these two NB cell lines, we intersected the target genes derived

from the two cell lines in order to identify the identical genes which were then removed from the

analysis. In Table 1 are reported target genes, and relative miRNAs, identified only in SH-SY5Y or

LAN-5 cells after removing the identical genes.

36

Table 1. Target genes and relative miRNAs specifically expressed only in LAN-5 cells (red) or SH-SY5Y (green)

KEGGterm Count PValue Genes Count miRNA|TarBase

hsa04110:Cell cycle 6 4.05E-32 BUB1B ORC6 PKMYT1 SMAD3 SMAD2

2 miR-155-5p miR-193b-3p PRKDC

hsa05200:Pathways in cancer 21 1.12E-08

RAC2 RAD51 TCF7L1 NFKB2 SMAD2

5

miR-155-5p miR-378a-5p

CDH1 FN1 SUFU RHOA RAC2 miR-193b-3p miR-200c-3p

HSP90AB1 CASP9 MAX NKX3-1 FGF7 miR-504

CTNNA1 JUP SMAD3 FGF2 CDK2

BAX

hsa04115:p53 signaling

pathway 2 1.35E-05 BAX RCHY1

2 miR-504 miR-19a-3p

hsa04110:PI3K-Akt signaling

pathway 15 8.07E-03

EIF4E2 FGF2 FGF7 FLT1 GNB4

2 miR-155-5p miR-19a-3p ITGB4 ITGB5 RHEB PKN2 PRKCZ

THBS1 YWHAZ NFKB1 PCK2 PDK1

hsa05202:Transcriptional

misregulation in cancer 2 4.32E-02 CD40 BCL2L1

2 miR-486-5p miR-491-5p

37

KEGGterm Count PValue Genes Count miRNA|TarBase

hsa04115:p53 signaling

pathway 22 1.08E-29

APAF1 CASP8 SESN1 MDM4 CDKN2A TP73

18

miR-101-3p miR-26b-5p miR-21-5p

ATM CCND3 SFN PIDD1 DDB2 ZMAT3 miR-424-5p miR-93-5p miR-193a-5p

BID CCNE1 THBS1 RFWD2 EI24 GADD45A miR-34a-5p miR-24-3p miR-374a-5p

CASP3 CCNG2 TP53I3 SERPINB5

hsa05200:Pathways in

cancer 51 5.47E-24

APPL1 CCNE1 FGF1 ITGA6 MMP2 TP53

36

miR-214-3p let-7c miR-222-3p

AR CHUK FGFR1 JUN MMP9 BMP2 let-7d-5p miR-21-5p miR-25-3p

AXIN2 CRKL FZD4 LAMC2 NFKBIA ERBB2 miR-424-5p miR-363-3p miR-24-3p

BID DAPK1 HDAC1 MAP2K1 NRAS IKBKB miR-146b-3p miR-93-5p miR-503

PLD1 STAT1 VHL RALA TCF4 MMP1 miR-449a miR-34a-5p miR-26a-5p

PTK2 STAT5A WNT1 RALB TFG PIK3R1 let-7f-5p miR-223-3p miR-28-5p

RB1 TGFB2 RUNX1 TGFBR1 SKP2 PDGFB miR-27a-3p miR-29b-3p miR-374a-5p

BIRC3 DVL2 HSP90AA1 MAPK1 PDGFA MAPK9 miR-769-5p miR-28-5p miR-361-5p

BIRC5 E2F3 IGF1R miR-221-3p miR-199b-5p miR-361-5p

hsa04110:Cell cycle 17 6.56E-21

ANAPC13 ATM CCND3 CCNE1 CDC14A GADD45A

14

miR-424-5p miR-34a-5p let7d-5p

MDM2 ORC4 SFN SKP2 TP53 HDAC1 miR-374a-5p let-7c miR-25-3p

CDC23 CDC25C E2F3 E2F5 EP300 mirR-503 mir-769-5p

hsa04110:PI3K-Akt

signaling pathway 32 1.02E-07

PDGFA MAP2K2 IGF1R FGFR1 COL3A1 CASP9

26

let-7c miR-449a miR-100-5p

PDGFB MDM2 IKBKB FGFR3 COL4A1 CCNE1 let-7f-5p miR-503 miR-424-5p

PDGFC MYB INSR GNG5 COL5A3 CDC37 miR-7-5p miR-146b-3p miR-181c-5p

PIK3CB NRAS IRS1 HSP90AA1 EIF4E CHUK miR-222-3p let-7d-5p miR-29b-3p

PPP2R1B PAK1 MAP2K1 IFNB1 FGF1 COL1A1 miR-26a-5p miR-34b-5p

PRKAA1 RAF1

hsa05202:Transcriptional

misregulation in cancer 39 3.14E-03

TGFBR2 PDGFB MEIS1 Il6 HIST2H3C HIST1H3H

19

miR-34a-5p miR-223-3p miR-363-3p

TP53 RUNX1 MYC KLF3 HIST3H3 HIST1H3I miR-146b-3p miR-93-5p miR-25-3p

ZEB1 SMAD1 MYCN LMO2 HOXA9 HIST1H3J miR-27a-3p miR-26a-5p miR-101-3p

SP1 PAX3 MEF2C IGF1R HIST2H3A HIST1H3E miR-28-5p

HIST1H3C H3F3B CEBPB BIRC3 CDKN2C BAIAP3

HDAC1 FOXO1 CCND2 ATM HIST1H3B H3F3A

HIST1H3A GOLPH3 CDKN1B

38

The gene ontology performed using the DAVID tool on this subset of target genes revealed

that the most relevant enriched functional categories identified in SH-SY5Y cells were associated to

cell migration, locomotion and cell proliferation (Fig. 2C and Table 2). This indicates that SH-

SY5Y cells, which express LMNA gene, have a reduced ability to migrate, to proliferate and hence

to be aggressive. Whereas, the LAN-5 cells, which instead express MYCN gene, showed an

enrichment in functional categories associated with regulation of differentiation and cell

proliferation suggesting that these cells are less prone to differentiate and might show a stem-like

phenotype with respect to SH-SY5Y cells (Fig. 2C and Table 2). On the basis of these results, we

hypothesize that the mutual expression of MYCN and LMNA genes could address NB cells to a

stem-like or a differentiating phenotype, respectively.

Figure 3. Gene ontology by DAVID.

In the histogram are reported the number of target genes belonging to the indicated functional categories. Red bar,

LAN-5 cells; green bar, SH-SY5y cells. Statistical significance: *p≤0.05, **p≤0.01, ***p≤0.001.

39

Table 2. Gene Ontology analysis on the target genes specifically expressed only in LAN-5 (red)

or SH-SY5Y (green)

GOTERM Pvalue Count Target Genes

GO:0051726~regulation

of cell cycle 4,84E-16 25

STAT5A SFN CCNG2 CDC37 TGFB2

CASP3 CDKN2A CDKN2C INSR MYC

BMP2 TP53 SKP2 CDC23 BIRC5

RB1 CDC25C ATM CDKN1B HDAC1

CCND3 CCND2 JUN MDM2 GADD45A

GO:0030335~positive

regulation of cell

migration

1,21E-11 13

IL6 PLD1 PDGFB MAP2K1 PDGFA

MMP9 IRS1 TGFB2 IGF1R MAPK1

THBS1 INSR PIK3R1

GO:0007049~cell cycle 5,21E-11 29

E2F3 CDC14A ANAPC13 SESN1 CCNG2

TGFB2 CCNE1 CDKN2A CDKN2C THBS1

MYC, MAP2K1 TP53 SKP2 CDC23

BIRC5 RB1, CDC25C APPL1 ATM

TP73 MAPK1 CDKN1B EP300 CCND3

CCND2 MDM2 MDM4 GADD45A

GO:0001952~regulation

of cell-matrix adhesion 0,002 4 CDKN2A PIK3CB THBS1 PIK3R1

GO:0007626~locomotory

behavior 0,003 9

MAPK1 PLD1 IL6 MAP2K1 PDGFB

PDGFA PIK3CB RALA TGFB2

GOTERM Pvalue Count Genes

GO:0051094~positive

regulation of

developmental process

9,707E-05 7

BAX RHOA SMAD3 NFKB1 SMAD2

THBS1 FGF2

GO:0001952~regulation

of cell-matrix adhesion 0,002 3 PRKCZ SMAD3 THBS1

GO:0008285~negative

regulation of cell

proliferation

0,003 6

BAX NKX3-1 SMAD3 SMAD2 THBS1

FGF2

GO:0045597~positive

regulation of cell

differentiation

0,004 5 RHOA SMAD3 NFKB1 SMAD2 FGF2

40

LMNA gene knock-down induces a stem-like phenotype in SH-SY5Y cells

We used as experimental model the SH-SY5Y cells in which we previously inhibited

differentiation by LMNA knock-down (LMNA-KD; Maresca et al., 2012). First, we analyzed the

expression of some stemness-related markers such as NANOG, SOX2, POU5f, PROM-1, CD34

and ABCG2, by qPCR (Fig. 4A). All of these genes were overexpressed in LMNA-KD cells,

indicating that lack of the LMNA gene could be associated with a more immature cell phenotype.

The activity of ABCG2, which is a member of the ATP-binding cassette (ABC) membrane

transporters and is active in many types of stem cells, was also verified evaluating by FACS

analysis the exclusion of the fluorescent supravital dye Hoechst 33342 out of the cells. The cells

able to pump outside the dye is concentrated in a tailing population exhibiting dim fluorescence

relative to the majority of cells with bright fluorescence and they represent the so called “side

population”, known to correlate with a stem-like phenotype. Indeed, LMNA-KD cells show the

presence of a side population identified by a Hoechst 33342 low-staining fraction (approximately

5%; Fig. 4B). As control to confirm dye efflux and the probable presence of stem-like cells we

inhibited the ABCG2 pump by verapamil. Consistently, verapamil treatment led to depletion of this

side population in LMNA-KD cells. By contrast, control cells presented the same cytofluorimetric

profile in both the presence and absence of verapamil.

We then investigated the ability to form spheres by LMNA-KD cells in the appropriate

culture conditions. As a positive control, we used human NB LAN-5 cells, known to form spheres 3.

Similarly to LAN-5 cells, LMNA-KD cells formed secondary spheres in serum-free medium (Fig.

4C). By contrast, control cells did not show any significant capacity to form secondary spheres. We

carried out immunofluorescence experiments on the spheres to detect the expression of a well-

known stemness marker, CD133. LMNA-KD secondary spheres were positive for the CD133

marker, detected on the membrane surface (Fig. 4D).

41

Figure 4. SH-SY5Y LMNA-KD cells acquire stemness characteristics.

(A) qRT-PCR analysis of the indicated genes in control (CTR; white) and LMNA-KD (black) cells. The data are

reported as the level of mRNA relative to the number of control cells and are the means+SD (n=5). Statistical

significance: *p≤0.05, **p≤0.01. (B) flow cytometric analysis of side population after staining with Hoechst 33342 in

the absence or presence of verapamil to inhibit the functionality of the membrane ABCG2 efflux pump. (C) tumor

sphere assay of LMNA-KD cells compared to control and LAN-5 cells; phase contrast micrographs of the secondary

spheres, magnification 200X. (D) representative confocal images of the secondary tumor spheres. CD133

immunostaining (red) and nuclear staining (blue). Scale bar: 50 µm.

42

LMNA-KD sphere-derived adherent cells maintain stemness characteristics and

acquire a more aggressive phenotype

Spheres formed from LMNA-KD cells were cultured in adherent conditions for several

passages. Sphere-derived adherent cells grew as discrete groups of differently sized cells whereas

the LMNA-KD cell monolayer showed a dispersed pattern, with growing cells being mainly

isolated (Fig. 5)

Figure 5. Phase contrast micrograph of LMNA-KD and sphere-derived adherent cells. Scale bar: 10µ.

We verified the expression of MYCN mRNA levels which significantly increased in

LMNA-KD cells and in sphere-derived adherent cells (approximately 2-fold) compared with CTR

cells thus confirming our hypothesis (Fig. 6A, left panel). The increased MYCN expression was

associated with the down-regulation of the NDRG1 and NDRG2 genes in LMNA-KD cells and in

sphere-derived adherent cells (Fig. 6A, right panel). An increase in the N-Myc protein accompanied

the increase in MYCN gene expression in LMNA-KD cells and sphere-derived adherent cells, as

evaluated by FACS analysis (approximately 40 and 65%, respectively; Fig. 6B). We characterized

the LMNA–KD sphere-derived adherent cells to evaluate the mRNA expression levels of self-

renewal genes compared to those in the LMNA-KD cell line. The stemness marker genes

maintained their expression or were further up-regulated in LMNA-KD sphere-derived adherent

cells (Fig. 6C). In particular, we observed a strong up-regulation of the stemness network of the

transcription factor genes NANOG, POU5f and SOX2 and of the drug resistance-related gene

ABCG2. In addition, sphere-derived adherent cells maintained their self-renewal ability, as they

were still able to form cell spheres in non-adherent culture conditions.

Sphere-derived adherent cells appeared to acquire a more aggressive phenotype than

LMNA-KD cells (Fig. 6D). The ENPP2 metastasis-associated gene showed a 4-fold increase with

respect to LMNA-KD cells. In addition, the EDN1 and CD44 genes, known to be involved in cell

adhesion functions, significantly decreased in the sphere-derived adherent cell line.

43

Mainly, these data strongly suggest that LMNA–KD sphere-derived adherent cells possess

self-renewal and tumor progression characteristics that are peculiar of a putative population of

tumor-initiating cells (TIC-like cells).

Figure 6. LMNA–KD sphere-derived adherent cells possess self-renewal and tumor progression characteristics. (A) RT-qPCR analysis of MYCN mRNA levels (right panel) and of NDRG1 and NDRG2 mRNA levels (left panel) in

CTR cells (white), LMNA-KD cells (grey) and LMNA–KD sphere-derived adherent cells (black). The data are reported

as the level of mRNA relative to CTR cells and are the means+SD (n=5). Statistical significance: * p≤0.05 ** p≤0.01,

*** p≤0.001. (B) FACS analysis of N-Myc expression in control and LMNA-KD cells. LAN-5 cells were used as a

positive control. The number reported in each histogram represents the percent positivity. (C) RT-qPCR analysis of the

indicated genes in LMNA-KD cells and the sphere-derived adherent cell line. The data are reported as the level of

mRNA relative to LMNA-KD cells and are the means+SD (n=5). Statistical significance: *p≤0.05, **p≤0.01,

***p≤0.001. (D) relative expression of tumor aggressiveness-related genes in the sphere-derived adherent line vs

LMNA-KD. The data are reported as the level of mRNA relative to LMNA-KD cells and are the means+SD (n=5).

Statistical significance: **p≤0.01, ***p≤0.001.

44

The LMNA-KD sphere-derived adherent cell line is able to initiate tumors in

vivo

We performed a limiting dilution assay in LMNA-KD sphere-derived adherent cells (namely

TIC-like cells in this paper) to determine the minimum cell dilution capable of forming colonies in

vitro. While TIC-like cells maintained colony forming ability at very low dilution (down to 16 cells),

LMNA-KD cells did not form colonies at such dilution (Fig. 7A).

On this basis, we compared the in vivo growth of the two cell lines using an in vivo limiting

dilution assay. Immunosuppressed mice were injected subcutaneously with different number of

LMNA-KD and TIC-like cells (from 5x104 to 1x10

7). No differences in terms of tumor appearance

and tumor growth were evident injecting from 2.5x105 to 1x10

7 TIC-like and LMNA-KD cells (data

not shown). While, at lower number, TIC-like cells exhibited a higher growth rate than LMNA-KD

cells (Fig. 7B); this was evident when mice were injected with 105 cells (left panel), but a more

marked difference between TIC-like and LMNA-KD cells was found in terms of tumor mass when

5x104 cells were injected per mouse (right panel). In fact, a significant increase in the weight of the

TIC-like-derived tumors compared to the LMNA-KD-derived tumors (an almost doubling) was

observed as the maximum effect (on day 14 after tumor cell injection) (P=0.003).

The histopathological pattern of these tumors, analyzed on day 27 of tumor growth, showed

small cells with round to oval shapes, deeply stained nuclei and poorly defined cytoplasmic outlines.

Unlike LMNA-KD-derived tumors, TIC-derived tumors were mainly microscopically characterized

by a nodular pattern of growth. Small aggregates with mostly hyperchromatic nuclei were defined

by the presence of fibrous septa. We also observed hypercellularity and overlapping nuclei

occasionally exhibiting small nucleoli in TIC-derived tumors. These findings further demonstrate

the more malignant phenotype of TIC tumors (Fig. 7C).

45

Figure 7. The LMNA-KD sphere-derived adherent cell line is able to initiate tumor growth in vivo.

(A) in vitro plating efficiency (%PE) in LMNA-KD (white) and sphere-derived adherent (black) cells at different cell

dilutions. (B) LMNA-KD () or sphere-derived adherent (○) cells were injected subcutaneously into the flanks of

immunosuppressed mice at 105 (left panel) or 5x10

4 (right panel) cells/mouse in 200 µl of Matrigel. When a tumor mass

was evident, the tumor sizes were measured, and the tumor weight was calculated using the following formula: a×b2/2,

where a and b are the long and short diameters of the tumor, respectively. The meanSD tumor weights are reported. (C)

histopathological examination of tumor biopsies from LMNA-KD cells and TICs after 27 days of tumor growth. Images

shown are at 20X (left panels) and 40X (right panels) magnification.

46

LMNA-KD sphere-derived adherent cells maintain stemness characteristics and

acquire a more aggressive phenotype.

From a more accurately analysis of the table 1 we found that MYCN gene appeared as one of

the miRNA target in the SH-SY5Y cells, whereas LMNA did not emerge as a miRNA-regulated

gene in the LAN-5 cells, thus indicating that the absence of MYCN expression in SH-SY5Y cell

line might be the results of miRNA regulation. Since miR-101is a specific miRNA known to target

MYCN gene, we inhibited miR-101 in SH-SY5Y control cells to modulate MYCN expression. As

control, we overexpressed miR-101 in LMNA-KD cells in order to verify the effect on MYCN gene

expression. As expected, the analysis of the intrinsic expression of miR-101 in both cell lines,

revealed miR-101 less expressed in LMNA-KD cells by 50% compared to SH-SY5Y control cells

(Fig. 8A).

Transfection of SH-SY5Y control cells with the miR-101 inhibitor decreased the expression

levels of miR-101 by approximately 50% (Fig. 8B, left panel). Transfection of LMNA-KD cells

with the miR-101 mimic resulted in approximately 90-fold increased expression of miR-101 (Fig.

8B, right panel)The analysis of the MYCN transcripts resulted significantly decreased or increased

after transduction of miR-101 inhibitor or mimic, respectively (Fig. 8C). We then analyzed the

mRNA levels of genes involved in some of the MYCN-regulated pathways such as stemness and

aggressiveness. The expression of the same genes up-regulated in SH-SY5Y control cells after the

inhibition of miR-101, decreased in LMNA-KD cells after the overexpression of miR-101.

Consistently, after inhibiting miR-101, SH-SY5Y control cells showed down-regulation of the

tumor suppressor EDN1 and CD44 genes, and increased expression of the tumor progression

ENPP2 gene with respect to LMNA-KD cells transfected with the miR-101 mimic (Fig. 8C).

47

Figure 8. Modulation of hsa-miR-101 modifies the expression of MYCN gene and in turn of stemness and cancer-

related genes. (A) TaqMan MicroRNA Assay with hsa-miR-101 in CTR cells (white) and LMNA-KD cells (black). The data are

reported as the level of mature miRNA relative to CTR cells and are the means+SD (n=5). Statistical significance: ***

p≤0.001. (B) TaqMan MicroRNA Assay, with the hsa-miR-101 levels in CTR cells transfected with the inhibitor (white,

left panel) or in LMNA-KD cells transfected with the mimic (black, right panel). The data are reported as the level of

mature miRNA compared to each relative negative control and are the means+SD (n=5). Statistical significance: ***

p≤0.001 (C) qRT-PCR analysis of the indicated genes in hsa-miR-101 mimic-transfected LMNA-KD cells (black) and

hsa-miR-101 inhibitor-transfected CTR cells (white). The data are reported as the level of mRNA compared to each

relative negative control and are the means+SD (n=5). Statistical significance: *p≤0.05, **p≤0.01, ***p≤0.001

48

Lamin C increased during GCs maturation processes both in vivo and in vitro

Since Lamin A/C has been proposed to be essential during neuron differentiation, we analyzed

its expression during cerebellum granule cell (GC) development; an excellent experimental model

for molecular and cell biological studies of neuronal development.

Recent studies have uncovered a peculiar pattern of nuclear lamin expression in the brain.

Lamin C transcripts are present at high levels in the brain, but Lamin A expression levels are very

low due to regulation by miR-9 of their transcripts of the prelamin A level (Young et al., 2014).

Our first observation was the up-regulation of Lamin C expression in GCs in vivo. Figure 1A

show representative immunofluorescent images of rat cerebellum tissue in which Lamin C

increased during GCs development from embryonic stage (E10) to postnatal stage (P18). Lamin C

increment was also accompanied by the up-regulation of the well known neuronal marker NeuN

(Fig. 9A).

Once GCs were dissociated from rat cerebellum tissue, we confirmed the increase of Lamin C

also in primary cell cultures: in Fig. 1B we reported the up-regulation of this protein during GCs

maturation at 2, 5 and 8 day in vitro (DIV) (Fig. 9B) with the consistent increase of correspondent

mRNA (Fig. 9C).

GCs maturation and differentiation in vitro were confirmed by the increment of the

differentiation-related genes such as Tubb3, expressed during neurite outgrowth, Zic2, member of

the zinc finger proteins and specifically expressed in the cerebellum during differentiation, and

Gabra6, GABAA receptor alpha6 subunit gene expression, which marks cerebellar granule cell

maturation, and the subsequent decrement of the stemness-related genes, Prom-1 and Nes.

49

Figure 9. Lamin C increases during GCs maturation.

(A) Representative confocal images of rat cerebellar slices of embryonic (E10) and post-natal (P10, P18) days. Lamin C

immunostaining (red), Neuronal Nuclei (NeuN) immunostaining (green) and nuclei staining (blue). Scale bar: 40

microns. (B) Representative blots of the Lamin C in GCs during 2 DIV, 5 DIV and 8 DIV. GAPDH was used to

normalized protein loading. The experiments was repeated three times showing similar results. (C) RT-qPCR analysis

of LMNA gene in GCs. The data are reported as the level of mRNA relative to 2 DIV GCs and are the mean+SD (n=5).

Statistical significance: ***p≤0.001. (D) Levels of the indicated mRNA in GCs during 2 DIV, 5 DIV and 8 DIV. The

data are reported as the level of mRNA relative to 2 DIV and are the mean + SD (n = 3). Statistical significance,

*p≤0.05; **p≤0.01; ***p≤0.001.

50

Lamin C silencing prevents the complete maturation of GCs

To investigate the role of Lamin C in GCs maturation, we silenced LMNA gene in this model

using a vector expressing an artificial miRNA that directly targets LMNA mRNA (Maresca et al.,

2012). The LMNA silenced GCs show a reduction in Lamin C expression of about 50% compared

to control (CTR) cells infected with a control vector.

We evaluated the expression of neuronal and stemness markers in LMNA-KD GCs and

observed the up-regulation of Prom-1 and Nes genes and the down-regulation of Tubb3, Zic and

Gabra6 genes (Fig. 10A). All these data taken together suggest that Lamin C may have a role in GC

maturation processes.

The primary cultures of GCs have a short life, in fact as their maturation progresses they

become gradually more and more vulnerable to the effect of glutamate, and after eight days of

culture they reach their full maturity and die by necrosis. For that reason, we analyzed cell survival

in LMNA-KD GCs compared to CTR GCs- after glutamate stimulation. Fig. 10B show how

LMNA-KD GCs presented a higher percentage of surviving cells after glutamate treatment than

CTR GCs-. Thus, Lamin C knock down seems to prevent glutamate-mediated spontaneous neuronal

death and, as consequence, the complete maturation of GCs.

51

Figure 10. Lamin C knock down.

(A) Levels of the indicated mRNA in LMNA-KD GCs (white). The data are reported as the level of mRNA relative to

the respective GCs-CTR (black) and are the mean+SD (n = 5). Statistical significance, *p≤0.05; **p≤0.01.

(B) Effect of silencing of LMNA gene on glutamate sensitivity. At 2, 5 and 8 DIV Mock (black) and LMNA-KD GCs

(white) were treated with 10 mM glutamate in Locke solution for 30 min and then reincubated in their fresh medium

serum free for 18 h. Data represent the means + standard deviation (s.d.; n = 5) of viable cells calculated as the ratio (%)

between intact nuclei counted after the glutamate pulse and those counted in a sister control culture. Statistical

significance: ***p< 0.001.

52

5 DISCUSSION

In this thesis work I demonstrate that the down regulation of Lamin A/C expression in the SH-

SY5Y NB cells allows the development of a tumor-initiating cell (TIC) population with self-

renewal features and the ability to initiate tumors in vivo.

TICs have been identified in many tumor types as a small tumorigenic population of cells that

are responsible for sustaining tumor growth and metastatic spread, thus representing the cause of

cancer recurrence (Dalerba et al., 2007; Ward et al., 2007; Frank et al., 2010). Their presence has

been demonstrated in the bone marrow of patients with relapsed NB (Hansford et al., 2007), and

they have many stem cell characteristics, such as sphere-forming ability and self-renewal. However,

sphere-forming ability is not a general characteristic of NB tumor-derived cell lines, as reported by

Mahller and colleagues, who studied the capacity to give rise to spheres in eight NB cell lines,

including SH-SY5Y (Mahller et al., 2009). In accordance with these authors, we also found that NB

SH-SY5Y cells were not able to form spheres. However, when we silenced the LMNA gene in

these cells, they gave rise to spheres in serum-free culture conditions that were optimized for neural

stem cell growth. The capacity to form spheres clearly demonstrates that this selected population

possesses the self-renewal characteristics of a stem cell phenotype. Pluripotency is a unique state in

which cells can self-renew indefinitely while maintaining the ability to differentiate. The

mechanism that controls the transcription of core pluripotency factors has been extensively studied

(Kashyap et al., 2009; Loh et al., 2006). In normal embryonic stem cells, the gene regulatory

networks of the core transcription factors Oct4, Nanog and Sox2 are involved in pluripotency

maintenance (Loh et al., 2006). Consistently, we found that the three main genes belonging to the

stem cell regulatory network (POU5f, which encodes Oct4, NANOG and SOX2) were all

significantly overexpressed in LMNA-KD-derived tumor spheres and even more so when the

sphere cell population was cultured as adherent cells.

In addition, the fact that these spheres are highly positive for the CD133 marker further

supports the stem-like phenotype of LMNA-KD cells.

We also found in LMNA-KD-derived tumor spheres a marked increase in the expression of the

ABC membrane transporter gene ABCG2. Increased expression of this gene is considered a major

characteristic of the cancer stem cell population that is associated with different tumor types (Ding

et al., 2010). The increased expression of this drug resistance-related gene often correlates with the

presence of a side population (Zeng et al., 2009). Indeed, we found the unambiguous presence of a

53

side population completely abolished by the exposure to verapamil, a known inhibitor of the

membrane drug efflux-pump, in LMNA-KD cells.

To corroborate further that this cell population with self-renewal characteristics was a TIC

population, we studied the capacity of these cells to give rise to tumors. The analysis of tumor

growth in vivo clearly demonstrated that the putative TICs were more markedly aggressive, as

evidenced by their higher growth rate at low cell concentrations than the LMNA-KD whole cell

population and by the more malignant phenotype of the tumor tissues. The aggressiveness of the

TIC population was also evidenced by increase of ENPP2 and decrease of EDN1 and CD44 gene

expression. We can therefore conclude that the LMNA-KD sphere-derived cells represent a TIC

population.

The inverse relationship between LMNA and MYCN found in the TICs indicate that these two

genes can mutually regulate differentiation and stemness in NB. Indeed, TICs which express more

MYCN than SH-SY5Y control cells and are silenced for LMNA gene, also show a significant

increase of the NANOG, POU5f and SOX2 gene expression. This is supported by the data obtained

from biopsies of human NB. Indeed, we found, for the first time in this paper, a defined inverse

relationship between LMNA and MYCN gene expression in 23 human NB biopsies.

On the other hand, the miRNome analysis in two NB cellular model expressing LMNA or

MYCN alternatively, evidenced changes of members of miRNA signatures which control cell

proliferation and differentiation. In fact, in the SH-SY5Y LMNA expressing cells DAVID pathway

analysis revealed that the miRNA target genes identified by DIANA bioinformatic tool belonged

mainly to pathways related to cell cycle regulation indicating that the expression of Lamin A/C is

associated with a more mature phenotype. This confirm data of a previous paper from our

laboratory where we demonstrated that LMNA knock-down inhibit differentiation processes. By the

contrary, in the LAN-5 MYCN expressing cells the miRNA target genes identified belonged to

pathways related to the inhibition of the developmental processes. In particular, some of these genes

(SMAD2, SMAD3, FGF2) appear to be involved in stem cell differentiation processes (Eom et al.,

2014). The very different number of miRNAs identified in each cluster comparing the two cell lines

support our hypothesis. It is likely that miRNAs and their target genes in LAN-5 cells tend to

display a low number of clusters as a consequence of reduced number of pathways to be regulated

to maintain their stem-like phenotype. By contrast, SH-SY5Y cells need to control a higher number

of pathways than LAN-5 cells, due to their more mature phenotype. On the other hand, it is

important to highlight that the analysis has been performed considering uniquely validated target.

54

Indeed, by up-regulating MYCN, through miR-101 modulation, in SH-SY5Y control cells, they

acquired a stem-like phenotype; while down-regulating MYCN in LMNA-KD cells, we were able

to restore a more mature phenotype. On the other hand, overexpression of the MYCN gene

correlates with increased stemness characteristics (Kelly et al., 2000; Knoepfler et al., 2008;

Ramalho-Santos, 2002). In addition, the role of the MYCN gene in promoting tumor invasion,

particularly in NB cells, is well known (Tanaka et al., 2008; Hasan et al., 2013; Megison et al., 2013)

Our data provide new mechanistic insight into the development of a stem-like NB TIC

population. In a tumor-mass, TICs constitute a rare tumorigenic cell population responsible for

sustaining tumor growth, metastases and relapse. Our data may provide opportunities to develop

new personalized therapeutic strategies based on the molecular profile of the tumor.

These data are further supported by the results obtained in the granule normal cells. In fact, I

demonstrate that Lamin A/C may have a role in GCs maturation processes. The maturation and

differentiation of GCs is promoted by excitatory amino acids receptors activation, such as glutamate.

The primary cultures of GCs have a short life, in fact as their maturation progresses become

gradually more and more vulnerable to the effect of glutamate, and after eight days of culture they

reach their full maturity and die by necrosis (Ankarcrona et al., 1995). Lamin A/C knock down

prevents glutamate-mediated neuronal death and, as consequence, the complete maturation of GCs.

The contribute of A-type lamins to the capacity for postsynaptic plasticity inherent to excitatory

synapses is mediated by interaction with Nesprins. Nesprin-1 isoform (called also CPG2, syne-1,

myne-1, and Enaptin) is a critical component of the postsynaptic endocytic pathway that mediates

both constitutive and activity-regulated glutamate receptor internalization (Cottrell et al., 2004).

LMNA knock down seems to disrupt the constitutive internalization of glutamate receptors.

We therefore assume that Lamin A/C is a key component of neuronal plasticity.

55

6 BIBLIOGRAFY

Adolph K. W., (1987) ADPribosylation of nuclear proteins labeled with [3H]adenosine:

changes during the HeLa cycle. Biochim Biophys Acta 909(3): 222-230.

Aebi U., et al., (1986). The nuclear lamina is a meshwork of intermediate-type filaments.

Nature 323: 560-564.

Agrelo R., et al., (2005) Inactivation of the lamin A/C gene by CpG island promoter

hypermethylation in hematologic malignancies, and its association with poor survival in nodal

diffuse large B-cell lymphoma. Clin Oncol 23(17): 3940-3947.

Al-Hajj M., et al., (2003) Prospective identification of tumorigenic breast cancer cells. Proc Natl

Acad Sci USA 100(7): 3983-3988.

Alsheimer M. and Benavente R., (1996) Change of Karyoskeleton during Mammalian

Spermatogenesis: Expression Pattern of Nuclear Lamin C2 and its Regulation. Exp Cell Res

228(2): 181-188.

Ambros V., et al., (2003) A uniform system for microRNA annotation. RNA 9(3): 277-279.

Ankarcrona M., et al., (1995) Glutamate-induced neuronal death: a succession of necrosis or

apoptosis depending on mitochondrial function. Neuron 15(4): 961-973.

Arora P., et al., (2004) Cell-type-specific interactions at regulatory motifs in the first intron of

the lamin A gene. FEBS Lett 568(1-3): 122-128.

Bao S., et al., (2006) Glioma stem cells promote radioresistance by preferential activation of

the DNA damage response. Nature 444(7120): 756-760.

Bartel D. P., (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2):

281-297.

Bartel D. P., (2009) MicroRNAs: target recognition and regulatory functions. Cell 136(2): 215-

233.

Bonnet D. and Dick J.E., (1997) Human acute myeloid leukemia is organized as a hierarchy

that originates from a primitive hematopoietic cell. Nat Med 3(7): 730-737.

Bridger J. M., et al., (1993) Internal Lamin Structures within G1 Nuclei of Human Dermal

Fibroblasts. J Cell Sci 104: 297-306.

Brodeur G. M., (2003) Neuroblastoma: biological insights into a clinical enigma. Nat Rev

Cancer 3(3): 203-216.

Broers J. L., et al., (1993) Nuclear A-type lamins are differentially expressed in human lung

cancer subtypes. Am J Pathol 143(1): 211-220.

56

Broers J. L., et al., (1999) Dynamics of the Nuclear Lamina as Monitored by GFP-Tagged A-

Type Lamins J Cell Sci 112(20): 3463-3475.

Broers J. L., et al., (2006) Nuclear lamins: laminopathies and their role in premature ageing.

Physiol Rev 86(3): 967-1008.

Bruce W. R, Van der Gaag H., (1963) A quantitative assay for the number of murine lymphoma

cells capable of proliferation in vivo. Nature 199: 79-80.

Buechner J., et al., (2011) Tumour-suppressor microRNAs let-7 and mir-101 target the proto-

oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br J

Cancer 105(2): 296-303.

Burke B. and Gerce L., (1986) A Cell Free System to Study Reassembly of the Nuclear

Envelope at the End of Mitosis. Cell 44(4): 639-652.

Buzzeo M. P., et al., (2007) The hunt for cancer-initiating cells: a history stemming from

leukemia. Leukemia 21(8): 1619-1627.

Calin G. A. and Croce. C. M., (2006) MicroRNA signatures in human cancers. Nat Rev Cancer

6(11): 857-866.

Capell B. C. and Collins F. S., (2006) Human laminopathies: nuclei gone genetically awry. Nat

Rev Genet 7(12): 940-952.

Chen X., et al., (2008) Characterization of microRNAs in serum: a novel class of biomarkers

for diagnosis of cancer and other diseases. Cell Res 18(10): 997-1006.

Chen Y. and Stallings R. L., (2007) Differential patterns of microRNA expression in

neuroblastoma are correlated with prognosis, differentiation, and apoptosis. Cancer Res 67(3):

976-983.

Christoffersen N. R., et al., (2010) p53-independent upregulation of miR-34a during oncogene-

induced senescence represses MYC. Cell Death Differ 17(2): 236-245.

Clarke M. F., et al., (2006) Cancer stem cells-perspectives on current status and future

directions: AACR Workshop on cancer stem cells. Cancer Res 66(19): 9339-9344.

Cloonan N., et al., (2008) The miR-17-5p microRNA is a key regulator of the G1/S phase cell

cycle transition. Genome Biol 9(8): R127.

Constantinescu D., et al., (2006) Lamin A/C expression is a marker of mouse and human

embryonic stem cell differentiation. Stem Cells 24(1): 177-185.

Coradeghini R., et al., (2006) Differential expression of nuclear lamins in normal and cancerous

prostate tissues. Oncol Rep 15(3): 609-613.

Cottrell J. R, et al., (2004) CPG2: a brainand synapse-specific protein that regulates the

endocytosis of glutamate receptors. Neuron 44(4): 677-690.

57

Crisp M., et al., (2006) Coupling of the nucleus and cytoplasm: role of the LINC complex. J

Cell Biol 172(1): 41-53.

Dalerba P., Cho R. W. and Clarke M. F., (2007) Cancer stem cells: models and concepts. Annu

Rev Med 58: 267-284.

Dalerba P., et al., (2007) Phenotypic characterization of human colorectal cancer stem cells.

Proc Natl Acad Sci USA 104(24): 10158-10163.

Davies B.S., et al., (2009) The posttranslational processing of prelamin A and disease. Annu

Rev Genomics Hum Genet 10: 153-174.

Dechat T., et al., (2000) Lamina-associated polypeptide 2alpha binds intranuclear A-type

lamins. J Cell Sci 113(19): 3473-3484.

Dechat T., et al., (2008) Nuclear Lamins: Major Factors in the Structural Organisation and

Function of the Nucleus and Chromatin. Genes Dev 22(7): 832-853.

Dick J. E., (1991) Immune-deficient mice as models for human hematopoietic disease. Cancer

Cells 3(2): 39-48.

Diehn M. and Clarke M. F., (2006) Cancer stem cells and radiotherapy: new insights into tumor

radioresistance. J Natl Cancer Inst 98(24): 1755-1757.

Ding X. W., et al., (2010) ABCG2: a potential marker of stem cells and novel target in stem cell

and cancer therapy. Life Sci 86(17-18): 631-637.

Dorner D., Gotzmann J. and Foisner R., (2007) Nucleoplasmic Lamins and their Interaction

Partners, LAP2alpha, Rb, and BAF, in Transcriptional Regulation. FEBS J 274(6): 1362-1373.

Eiring A. M., et al., (2010) miR-328 functions as an RNA decoy to modulate hnRNP E2

regulation of mRNA translation in leukemic blasts. Cell 140(5): 652-665.

Eom Y. W., et al., (2014) The role of growth factors in maintenance of stemness in bone

marrow-derived mesenchymal stem cells. Biochem Biophys Res Commun 445(1): 16-22.

Esiashvili N., et al., (2009) Neuroblastoma. Curr Probl Cancer 33(6): 333-360.

Esquela-Kerscher A., et al., (2008) The let-7 microRNA reduces tumor growth in mouse models

of lung cancer. Cell Cycle 7(6): 759-764.

Etchevers H. C., Amiel J., Lyonnet S., (2006) Molecular bases of human neurocrestopathies.

Adv Exp Med Biol 589: 213-234.

Fábián A., et al., (2009) Die hard: are cancer stem cells the Bruce Willises of tumor biology?

Cytometry A 75(1): 67-74.

Favreau C., et al., (2004) Expression of a mutant lamin A that causes Emery-Dreifuss muscular

dystrophy inhibits in vitro differentiation of C2C12 myoblasts. Mol Cell Biol 24(4): 1481-1492.

58

Ferraro A., et al., (1989) Glycosylated forms of nuclear lamins. FEBS Lett 257(2): 241-246.

Foisner R. and Gerace L., (1993) Integral Membrane Proteins of the Nuclear Envelope Interact

with Lamins and Chromosomes, and Binding is Modulated by Mitotic Phosphorylation. Cell

73 (7): 1267-1279.

Foisner R., (2002) Dynamic Connections of Nuclear Envelope Proteins to Chromatin and the

Nuclear Matrix. in Collas P. “Nuclear Envelope Dynamics in Embryos and Somatic Cells”,

chapter 4: 43-59.

Fontana L., et al., (2008) Antagomir-17-5p abolishes the growth of therapy-resistant

neuroblastoma through p21 and BIM. PLoS One 3(5): e2236.

Foster H. A., and Bridger J. M., (2005) The Genome and the Nucleus: A Marriage Made by

Evolution. Genome Organisation and Nuclear Architecture. Chromosoma 114(4): 212-229.

Foster HA et al., (2007) Lamins A and C are Present in the Nuclei of Early Porcine Embryos,

with Lamin A being Distributed in Large Intranuclear Foci. Chromosome Res 15(2): 163-174.

Frangioni J. V., et al., (1993) Use of a general purpose mammalian expression vector for

studying intracellular protein targeting: identification of critical residues in the nuclear lamin

A/C nuclear localization signal. J Cell Sci 105: 481-488.

Frank N. Y., Schatton T. and Frank M. H., (2010) The therapeutic promise of the cancer stem

cell concept. J Clin Invest 120: 41-50.

Friedman R. C., et al., (2009) Most mammalian mRNAs are conserved targets of microRNAs.

Genome Res 19(1): 92-105.

Frock R. L., et al., (2006) Lamin A/C and emerin are critical for skeletal muscle satellite cell

differentiation. Genes Dev. 20(4): 486-500.

Furukawa K. and Kondo T., (1998), Identification of the Lamina-Associated-Polypeptide-2-

Binding Domain of B-type Lamin, Eur J Biochem 251(3): 729-733.

Gal H. G., et al., (2008) MIR-451 and Imatinib mesylate inhibit tumor growth of Glioblastoma

stem cells. Biochem Biophys Res Commun 376(1): 86-90.

Garzia L., et al., (2009) MicroRNA-199b-5p impairs cancer stem cells through negative

regulation of HES1 in medulloblastoma. PLoS One 4(3): e4998.

Gerace L. and Blobel G., (1980) The nuclear envelope lamina is reversibly depolymerized

during mitosis. Cell 19(1): 277-287.

Gerace L. and Burke B., (1998) Functional organization of the nuclear envelope. Annu Rev Cell

Biol 4: 335-374.

Gil J., et al., (2008) Cancer stem cells: the theory and perspectives in cancer therapy. J Appl

Genet 49(2): 193-199.

59

Godlewski J., et al., (2008) Targeting of the Bmi-1 oncogene/stem cell renewal factor by

microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res 68(22): 9125-9130.

Goldberg M. W., et al., (2008) Filaments made from A and B-type lamins differ in structure

and organization. J Cell Sci 121(2): 215-225.

Goldberg M., et al., (1999) The tail domain of lamin Dm0 binds histones H2A and H2B. Proc

Natl Acad Sci USA 96(6): 2852-2857.

Greene N. D. and Copp A. J., (2009) Development of the vertebrate central nervous system:

formation of the neural tube. Prenat Diagn 29(4): 303-311.

Gregory P. A., et al., (2008) The miR-200 family and miR-205 regulate epithelial to

mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol 10(5): 593-601.

Griffiths-Jones S., et al., (2006) miRBase: microRNA sequences, targets and gene nomenclature.

Nucleic Acids Res 34: D140-D144.

Guarnieri D. J. and DiLeone R. J., (2008) MicroRNAs: a new class of gene regulators. Ann Med

40(3): 197-208.

Guglielmi L., et al., (2014) MYCN gene expression is required for the onset of the

differentiation programme in neuroblastoma cells. Cell Death Dis. 5(2): e1081.

Hansford L.M., et al., (2007) Neuroblastoma cells isolated from bone marrow metastases

contain a naturally enriched tumor-initiating cell. Cancer Res 67(23): 11234-11243.

Haque F., et al., (2006) SUN1 interacts with nuclear lamin A and cytoplasmic nesprins to

provide a physical connection between the nuclear lamina and the cytoskeleton. Mol Cell Biol

26(10): 3738-3751.

Hasan M. K., et al., (2013) ALK is a MYCN target gene and regulates cell migration and

invasion in neuroblastoma. Sci Rep 3: 3450.

He L., et al., (2005) A microRNA polycistron as a potential human oncogene. Nature 435: 828-

833.

Hermann P. C., et al., (2007) Distinct populations of cancer stem cells determine tumor growth

and metastatic activity in human pancreatic cancer. Cell Stem Cell 1(3): 313-323.

Hoehner J. C., et al., (1998) Developmental gene expression of sympathetic nervous system

tumors reflects their histogenesis. Lab Invest 78(1): 29-45.

Höger T. H., Krohne G. and Kleinschmidt J. A., (1991), Interaction of Xenopus Lamins A and

LII with chromatin in vitro Mediated by a Sequence Element in the Carboxyterminal Domain,

Exp Cell Res 197(2): 280-289.

Hong L., et al., (2010) The miR-17-92 cluster of microRNAs confers tumorigenicity by

inhibiting oncogene-induced senescence. Cancer Res 70(21): 8547-8557.

60

Huang Y., et al., (2011) Biological functions of microRNAs: a review. J Physiol Biochem 67(1):

129-139.

Hubner S., et al., (2006) Laminopathy-inducing lamin A mutants can induce redistribution of

lamin binding proteins into nuclear aggregates. Exp Cell Res 312(2): 171-183.

Hutchison C. J., (2002) Lamins: Building Blocks or Regulators of Gene Expression? Nat Rev

Mol Cell Biol 3(11): 848-858.

Janaki Ramaiah M. and Parnaik V. K., (2006) An essential GT motif in the lamin A promoter

mediates activation by CREB-binding protein. Biochem Biophys Res Commun 348(3): 1132-

1137.

Ji J., et al., (2009) Identification of microRNA-181 by genome-wide screening as a critical

player in EpCAM-positive hepatic cancer stem cells. Hepatology 50: 472-480.

Ji Q., et al., (2008) Restoration of tumor suppressor miR-34 inhibits human p53-mutant

gastric cancer tumorspheres. BMC Cancer 8: 266.

Ji Q., et al., (2009) MicroRNA miR-34 inhibits human pancreatic cancer tumor-initiating cells.

PLoS One 4(8): e6816.

Jones R. J., Matsui W. H. and Smith B. D., (2004) Cancer stem cells: are we missing the target?

J Natl Cancer Inst 96(8): 583-585.

Kashyap V., et al., (2009) Regulation of stem cell pluripotency and differentiation involves a

mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription

factors with polycomb repressive complexes and stem cell microRNAs. Stem Cells Dev 18(7):

1093-1108.

Kasinski A. L. and Slack. F. J., (2011) Epigenetics and genetics. MicroRNAs en route to the

clinic: progress in validating and targeting microRNAs for cancer therapy. Nat Rev Cancer

11(12): 849-864.

Kelly D. L. and Rizzino A., (2000) DNA microarray analyses of genes regulated during the

differentiation of embryonic stem cells. Mol Reprod Dev 56(2): 113-123.

Ketema M., et al., (2007) Requirements for the localization of nesprin-3 at the nuclear envelope

and its interaction with plectin. J Cell Sci 120(19): 3384-3394.

Kim V. N., Han J. and Siomi M. C., (2009) Biogenesis of small RNAs in animals. Nat Rev Mol

Cell Biol 10(2): 126-139.

Knoepfler P. S., (2008) Why myc? An unexpected ingredient in the stem cell cocktail. Cell Stem

Cell 2(1): 18-21.

Kong W., et al., (2008) MicroRNA-155 is regulated by the transforming growth factor

beta/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol Cell

Biol 28(22): 6773-6784.

61

Kozomara A. and Griffiths-Jones S., (2011) miRBase: integrating microRNA annotation and

deepsequencing data. Nucleic Acids Res 39: D152-D157.

LaBonne C. and Bronner-Fraser M., (1999) Molecular mechanisms of neural crest formation.

Annu Rev Cell Dev Biol 15: 81-112.

Laszlo J., (1965) Cancer chemotherapy for practicing physicians. J Chronic Diseases 18(7):

681-687.

Lewis B. P., Burge C. B. and Bartel D. P., (2005) Conserved seed pairing, often flanked by

adenosines, indicates that thousands of human genes are microRNA targets. Cell 120(1): 15-20.

Li C., et al., (2007) Identification of pancreatic cancer stem cells. Cancer Res 67(3): 1030-1037.

Li J., et al., (2015) The role of miR-205 in the VEGF-mediated promotion of human ovarian

cancer cell invasion. Gynecol Oncol 137(1): 125-133.

Lin F. and Worman H. J., (1993) Structural Organization of the Human Gene Encoding

Nuclear Lamin A and Nuclear Lamin C. J Biol Chem 268(22): 16321-16326.

Lin F. and Worman H. J., (1995) Structural Organization of the Human Gene (LMNB1)

Encoding Nuclear Lamin B1. Genomics 27(2): 230-236.

Lin F. and Worman H. J., (1997) Expression of Nuclear Lamins in Human Tissues and Cancer

Cell Lines and Transcription from the Promoters of The Lamin A/C and B1 Genes. Exp Cell

Res 236(2): 378-384.

Lloyd D. J., Trembath R. C. and Shackleton S., (2002) A novel interaction between lamin A and

SREBP1: implications for partial lipodystrophy and other laminopathies. Hum Mol Genet

11(7): 769-777.

Loh Y. H., et al., (2006) The Oct4 and Nanog transcription network regulates pluripotency in

mouse embryonic stem cells. Nat Genet 38(4): 431-440.

Lu J., et al., (2005) MicroRNA expression profiles classify human cancers. Nature 435(7043):

834-838.

Ma L., et al., (2010) Therapeutic silencing of miR-10b inhibits metastasis in a mouse

mammary tumor model. Nat Biotechnol 28(4): 341-347

Machiels B. M., et al., (1997) Nuclear lamin expression in normal testis and testicular germ cell

tumours of adolescents and adults. J Pathol 182(2): 197-204.

Macingová Z. and Filip S., (2008) Cancer stem cells--new approach to cancerogenensis and

treatment. Acta Medica (Hradec Kralove) 51(3): 139-144.

Mahller Y. Y., et al., (2009) Neuroblastoma cell lines contain pluripotent tumor initiating cells

that are susceptible to a targeted oncolytic virus. PLoS One 4(1): e4235.

62

Margalit A., et al., (2007) Barrier to autointegration factor blocks premature cell fusion and

maintains adult muscle integrity in C. elegans. J.Cell Biol 178(4): 661-673.

Maris J. M., (2010) Recent advances in neuroblastoma. N Engl J Med 362(23): 2202-2211.

Martin C., et al., (2009) Lamin B1 Maintains the Functional Plasticity of Nucleoli. J Cell Sci

122(10): 1551-1562.

Mattout, A., et al., (2007) Specific and conserved sequences in D. melanogaster and C. elegans

lamins and histone H2A mediate the attachment of lamins to chromosomes. J Cell Sci 120(1):

77-85.

Mattout-Drubezki A. and Gruenbaum Y., (2003) Dynamic Interactions of Nuclear Lamina

Proteins with Chromatin and Transcriptional Machinery. Cell Mol Life Sci 60(10): 2053-2063.

Megison M. L., et al., (2013) FAK inhibition decreases cell invasion, migration and metastasis

in MYCN amplified neuroblastoma. Clin Exp Metastasis 30(5): 555-568.

Mendell J. T., (2008) miRiad roles for the miR-17-92 cluster in development and disease. Cell

133(2): 217-222.

Mitchell P. S., et al., (2008) Circulating microRNAs as stable bloodbased markers for cancer

detection. Proc Natl Acad Sci USA 105: 10513-10518.

Modak S., Cheung N. V., (2010) Neuroblastoma: Therapeutic strategies for a clinical enigma.

Cancer Treat Rev 36(4): 307-317.

Moss S. F., et al., (1999) Decreased and aberrant nuclear lamin expression in gastrointestinal

tract neoplasms. Gut 45(5): 723-729.

Mueller S. and Matthay K. K., (2009) Neuroblastoma: biology and staging. Curr Oncol Rep 11(6):

431-438.

O'Brien C. A., et al., (2007) A human colon cancer cell capable of initiating tumour growth in

immunodeficient mice. Nature 445(7123): 106-110.

Oguchi M., et al., (2002) Expression of lamins depends on epidermal differentiation and

transformation. Br J Dermato 147(5): 853-858.

Okumura K., et al., (2000) Identification of a novel retinoic acid-responsive element within the

lamin A/C promoter. Biochem Biophys Res Commun 269(1): 197-202.

Okumura K., Hosoe Y. and Nakajima N., (2004) c-Jun and Sp1 family are critical for retinoic

acid induction of the lamin A/C retinoic acid-responsive element. Biochem Biophys Res

Commun 320(2): 487-492.

Ottaviano Y. and Gerace L., (1985) Phosphorylation of the nuclear lamins during interphase

and mitosis. J Biol Chem 260(1): 624-632.

63

Padmakumar V. C., et al., (2005) The inner nuclear membrane protein Sun1 mediates the

anchorage of Nesprin-2 to the nuclear envelope. J Cell Sci 118(15): 3419-3430.

Pallini R., et al., (2008) Cancer stem cell analysis and clinical outcome in patients with

glioblastoma multiforme. Clin Cancer Res 14(24): 8205-8212.

Park N. J., et al., (2009) microRNA: discovery, characterization, and clinical utility for oral

cancer detection. Clin Cancer Res 15(17): 5473-5477.

Park S. M., et al., (2008) The miR-200 family determines the epithelial phenotype of cancer

cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev 22(7): 894-907.

Patrawala L., et al., (2005) Side population is enriched in tumorigenic, stem-like cancer cells,

whereas ABCG2+ and ABCG2- cancer cells are similarly tumorigenic. Cancer Res 65(14):

6207-6219.

Piccirillo S. G., et al., (2006) Bone morphogenetic proteins inhibit the tumorigenic potential of

human brain tumour-initiating cells. Nature 444(7120): 761-765.

Poliseno L., et al., (2010) A coding-independent function of gene and pseudogene mRNAs

regulates tumour biology. Nature 465(7301): 1033-1038.

Prather R. S., et al., (1989) Nuclear Lamin Antigens are Developmentally Regulated during

Porcine and Bovine Embryogenesis. Biol Reprod 41(1): 123-132.

Quintana E., et al., (2008) Efficient tumour formation by single human melanoma cells. Nature

456(7222): 593-598.

Ramalho-Santos M., et al., (2002) "Stemness": transcriptional profiling of embryonic and adult

stem cells. Science 298(5593): 597-600.

Razafsky D., et al., (2014) Nuclear envelope in nuclear positioning and cell migration. Adv Exp

Med Biol 773: 471-490.

Rettig W. J., et al., (1987) Coordinate changes in neuronal phenotype and surface antigen

expression in human neuroblastoma cell variants. Cancer Res 47(5): 1383-1389.

Rhodes G., et al., (2010) Lamin B Receptor: Multi-Tasking at the Nuclear Envelope, Nucleus

1(1): 53-70.

Rosen J. M. and Jordan C. T., (2009) The increasing complexity of the cancer stem cell

paradigm. Science 324(5935): 1670-1673.

Ross R. A. and Spengler B. A., (2007) Human neuroblastoma stem cells. Semin Cancer Biol

17(3): 241-247.

Ross R. A., Biedler J. L. and Spengler B. A., (2003) A role for distinct cell types in determining

malignancy in human neuroblastoma cell lines and tumors. Cancer Lett 197(1-2): 35-39.

64

Ross R. A., et al., (1995) Human neuroblastoma I-type cells are malignant neural crest stem

cells. Cell Growth Differ 6(4): 449-456.

Salmena L., et al., (2011) A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language?

Cell 146(3): 353-358.

Sasse B., Aebi U. and Stuurman N., (1998) A tailless Drosophila lamin Dm0 fragment reveals

lateral associations of dimers. J Struct Biol 123(1): 56-66.

Schatton T., et al., (2008) Identification of cells initiating human melanomas. Nature 451(7176):

345-349.

Schirmer E. C. and Foisner R., (2007) Proteins that associate with lamins: many faces, many

functions. Exp Cell Res 313(10): 2167-2179.

Seeger R. C., et al., (1985) Association of multiple copies of the N-myc oncogene with rapid

progression of neuroblastomas. N Engl J Med 313(18): 1111-1116.

Shackleton M., et al., (2009) Heterogeneity in cancer: cancer stem cells versus clonal evolution.

Cell 138(5): 822-829.

Shimono Y., et al., (2009) Downregulation of miRNA-200c links breast cancer stem cells with

normal stem cells. Cell 138(3): 592-603.

Singh S. K., et al., (2004) Identification of human brain tumour initiating cells. Nature

432(7015): 396-401.

Siomi H. and Siomi M. C., (2009) On the road to reading the RNA-interference code. Nature

457(7228): 396-404.

Stadelmann B., et al., (1990) Repression of nuclear lamin A and C gene expression in human

acute lymphoblastic leukemia and non-Hodgkin's lymphoma cells. Leuk Res 14(9): 815-821.

Takahashi Y., et al., (2013) Orexin neurons are indispensable for prostaglandin E2-induced

fever and defence against environmental cooling in mice. J Physiol 591(22): 5623-5643.

Takamori Y., et al., (2007) Differential expression of nuclear lamin, the major component of

nuclear lamina, during neurogenesis in two germinal regions of adult rat brain. Eur J Neurosci

25(6): 1653-1662.

Tanaka N. and Fukuzawa M., (2008) MYCN downregulates integrin alpha1 to promote invasion

of human neuroblastoma cells. Int J Oncol 33(4): 815-821.

Tang D. G., et al., (2007) Prostate cancer stem/progenitor cells: identification, characterization,

and implications. Mol Carcinog 46(1): 1-14.

Tay Y., et al., (2008) MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic

stem cell differentiation. Nature 455(7216): 1124-1128.

65

Tilli C. M., et al., (2003) Lamin expression in normal human skin, actinic keratosis, squamous

cell carcinoma and basal cell arcinoma. Br J Dermatol 148(1): 102-109.

Vasudevan S., Tong Y. and Steitz J. A., (2007) Switching from repression to activation:

microRNAs can up-regulate translation. Science 318(5858): 1931-1934.

Venables R. S., et al., (2001) Expression of individual lamins in basal cell carcinomas of the

skin. Br J Cancer 84(4): 512-519.

Verstraeten V. L., et al., (2007) The nuclear envelope, a key structure in cellular integrity and

gene expression. Curr Med Chem 14(11): 1231-1248.

Vescovi A. L., (2006) Brain tumour stem cells. Nat Rev Cancer 6(6): 425-436.

Visvader, J. E. and Lindeman G. J., (2008) Cancer stem cells in solid tumours: accumulating

evidence and unresolved questions. Nat Rev Cancer 8(10): 755-768.

Vlachos S., et al., (2014) DIANA-TarBase v7.0: indexing more than half a million

experimentally supported miRNA:mRNA interactions. Nucleic Acids Res 43: D153-D159.

Vlcek S., Dechat T. and Foisner R., (2001) Nuclear Envelope and Nuclear Matrix: Interactions

and Dynamics. Cell Mol Life Sci 58(12-13): 1758-1765.

Walton J. D., Kattan R. D. and Ross R. A., (2004) Characteristics of Stem Cells from human

neuroblastoma cell lines and in tumors. Neoplasia 6(6): 838-845.

Wang H. R., et al., (2003) Regulation of cell polarity and protrusion formation by targeting

RhoA for degradation. Science 302(5651): 1775-1779.

Ward R. J. and Dirks P. B., (2007) Cancer stem cells: at the headwaters of tumor development.

Annu Rev Pathol 2: 175-189.

Warren D. T., et al., (2005) Nesprins: intracellular scaffolds that maintain cell architecture and

coordinate cell function? Expert Rev Mol Med 7(11): 1-15.

Weber J. A., et al., (2010) The microRNA spectrum in 12 body fluids. Clin Chem 56(11): 1733-

1741.

Wiche G., (1998) Role of plectin in cytoskeleton organization and dynamics. J Cell Sci 111(17):

2477-2486.

Wilson K. L. and Foisner R., (2010), Lamin-binding Proteins, Cold Spring Harb Perspect Biol

2(4): a000554.

Wydner K. L., et al., (1996) Chromosomal assignment of human nuclear envelope protein

genes LMNA, LMNB1, and LBR by fluorescence in situ hybridization. Genomics 32(3): 474-

478.

66

Ye Q. and Worman H. J., (1994) Primary structure analysis and lamin B and DNA binding of

human LBR, an integral protein of the nuclear envelope inner membrane. J Biol Chem

269(15): 11306-11311.

Young S. G., et al., (2014) Nuclear lamins and neurobiology. Mol Cell Biol 34(15): 2776-2785.

Yu F., et al., (2007) let-7 regulates self renewal and tumorigenicity of breast cancer cells. Cell

131(6): 1109-1123.

Yu F., et al., (2010) Mir-30 reduction maintains self-renewal and inhibits apoptosis in breast

tumor-initiating cells. Oncogene 29(29): 4194-4204.

Zavadil J., et al., (2007) Transforming growth factor-β and microRNA:mRNA regulatory

networks in epithelial plasticity. Cells Tissues Organs 185(1-3): 157-161.

Zeng H., et al., (2009) Lack of ABCG2 expression and side population properties in human

pluripotent stem cells. Stem Cells 27(10): 2435-2445.

Zhang Y. Q. and Sarge K. D., (2008) Sumoylation regulates lamin A function and is lost in

lamin A mutants associated with familial cardiomyopathies. J Cell Biol 182(1): 35-39.

67

APPENDIX

68

Functional analysis of differentially and specifically expressed miRNAs performed by DIANA tool showing statistically over-represented

groups in and LAN-5 (red) SH-SY5Y(green) cells.

Increased in LAN-5*

Term

(KEGG_Pathway) Count miRNA|TarBase Count PValue Target Genes

hsa04110:Cell cycle 7

miR-376a-3p miR-372 miR-193b-3p miR-572

29 4.05E-32

ESPL1 CDC6 PCNA E2F1 CCNB1 E2F2 CCNA2 MCM6

miR-302d-3p miR-942 miR-19a-3p CDK1 CDK6 MCM7 CHEK1 CCND1 SMAD4 CCNE2 PKMYT1

CDK2 CCND2 MCM4 MCM5 WEE1 ORC6 MCM3 CDC25A

TTK YWHAZ CDC20 BUB1B CDKN1A

hsa05200:Pathways in

cancer 11

miR-182-5p miR-378a-5p miR-383 miR-942

31 1.12E-08

E2F1 RAC2 E2F2 RAD51 TCF7L1 ETS1 BCL2 KRAS

miR-193b-3p miR-572 miR-19a-3p miR-491-5p MSH6 CCNE2 MAPK8 NFKB2 HSP90AB1 CASP9 MAX EP300

miR-372 miR-200c-3p miR-302d-3p CDK6 MITF CDH1 CCND1 SMAD4 BCL2L1 LEF1 FN1

VEGFA PTEN FOXO1 TGFBR2 CDKN1A SUFU

hsa04115:p53 signaling

pathway 8

miR-494 miR-130b-5p miR-372 miR-19a-3p 15 1.35E-05

CCNB1 CDK2 CCND2 CDK1 CDK6 CHEK1 CCND1 CCNE2

miR-193b-3p miR-572 miR-942 miR-302d-3p RCHY1 CASP9 SESN2 CDKN1A RRM2 PTEN PPM1D

hsa04110:PI3K-Akt

signaling pathway 7

miR-494 miR-182-5p miR-383

13 8.07E-03

CDK2 CCND2 BCL2 CCND1 CCNE2 BCL2L1 FOXO3 CDKN1A

miR-372 miR-19a-3p miR-302d-3p VEGFA PTEN SGK3 PRKCZ BCL2L11

miR-491-5p

hsa05202:Transcriptional

misregulation in cancer 6

miR-370 miR-372 miR-572 miR-486-5p 4 4.32E-02

HMGA2 CD40 BCL2L1 CDKN1A

miR-491-5p miR-942

69

Increased in SH-SY5Y*

Term

(KEGG_Pathway) Count miRNA|TarBase Count PValue Target Genes

hsa04115:p53 signaling

pathway 19

miR-214-3p miR-449a miR-24-3p miR-34a-5p

44 1.08E-29

CCNG1 ZMAT3 CCNB1 SFN CDK4 BID MDM2 RFWD2

miR-222-3p miR-21-5p miR-374a-5p miR-503 THBS1 CDK2 CCND2 DDB2 CDK1 GADD45A CCND3 CDKN2A

miR-424-15p miR-193a-5p

miR-30d-5p miR-101-3p CDK6 CHEK1 TP53 APAF1 ATM PMAIP1 PIDD1 CASP3

miR-26b-5p miR-26a-5p miR-93-5p miR-363-3p CCND1 CCNE2 TP73 EI24 SESN1 CASP9 PPM1D SESN2

miR-28-5p miR-28-5p miR-10a-5p

MDM4 FAS BBC3 CASP8 SERPINB5 TP53I3 CCNG2 CCNE1

CDKN1A RRM2 SESN3 PTEN

hsa05200:Pathways in

cancer 25

miR-214-3p let-7c miR-21-5p miR-449°

86 5.47E-24

FOS GSK3B STAT3 E2F1 TGFBR1 ERBB2 COL4A1 CDK4

miR-34a-5p miR-222-3p let-7f-5p let-7d-5p STAT5A E2F2 NRAS CRKL BID TCF4 PDGFA APC

miR-503 miR-424-5p miR-223-3p miR-27a-3p RUNX1 WNT1 HDAC1 WNT5A HSP90AA1 RALA MDM2 CHUK

miR-29b-3p miR-363-3p miR-146b-3p miR-93-5p BCL2 CDKN1B BIRC5 PLD1 IGF1R EGFR TFG CDKN2A

miR-26a-5p miR-361-5p miR-25-3p miR-361-5p APPL1 KRAS CDK6 VHL TP53 IKBKB TGFBR2 PTK2

miR-28-5p miR-28-5p miR-24-3p miR-769-5p FZD4 MMP2 MAPK9 AR JUN CCND1 FGF1 SMAD4

miR-374a-5p

CTNNB1 MSH6 CCNE2 AXIN2 MMP1 SKP2 MAPK1 COL4A2

E2F3 MAPK8 MYC MMP9 MSH2 DAPK1 FOXO1 PDGFB

NFKBIA KIT PIK3R1 RB1 RAC1 BMP2 FGFR1 FAS

TGFB2 EP300 BCL2L1 CCNE1 LEF1 CDKN1A PTEN MAP2K1

Il6 BIRC3 RALB STAT1 ITGA6 VEGFA

hsa04110:Cell cycle 19

let-7c miR-449° miR-24-3p miR-100-5p

51 6.56E-21

ESPL1 CDC6 GSK3B CDKN2C PCNA E2F1 CCND3 CCNB1

miR-34a-5p miR-222-3p miR-28-5p let-7d-5p SFN CDK4 E2F2 CDC14A CCNA2 CDC25C CDC25A HDAC1

let-7f-5p miR-503 miR-28-5p miR-424-5p MCM6 CCND2 MCM4 ORC4 CDKN1B MCM5 MDM2 STAG2

miR-363-3p miR-27a-3p miR-374a-5p miR-26a-5p WEE1 CDK1 GADD45A CDKN2A CDK6 MCM7 MCM3 CHEK1

miR-93-5p miR-25-3p miR-769-5p

TP53 ATM CDKN1C CCND1 SMAD4 CCNE2 ANAPC13 E2F5

SKP2 E2F3 MYC RB1 CDC20 CDC23 PLK1 EP300

CCNE1 CDC27 CDKN1A

70

(Increased in SH-SY5Y*)

*differentially expressed at least 2-fold comparing the two cell lines.

hsa04110:PI3K-Akt

signaling pathway 19

let-7c miR-449a miR-181c-5p miR-100-5p

60 1.02E-07

GSK3B CDK4 NRAS FGFR3 MAP2K2 PIK3CB BCL2L11 PPP2CA

miR-222-3p let-7d-5p let-7f-5p miR-503 CDC37 MCL1 CCND2 HSP90AA1 IFNB1 RAF1 CCND3 CHUK

miR-424-5p miR-29b-3p miR-26a-5p miR-7-5p BCL2 CDKN1B IGF1R EGFR GNB1 PPP2R5C COL4A1 KRAS

miR-146b-3p

CDK6 COL3A1 PAK1 IKBKB DDIT4 CCND1 PDGFA EIF4E

CCNE2 COL4A2 PPP2R2A MYC PDGFB COL1A1 MDM2 KIT

HSP90B1 IRS1 RAC1 INSR PRKAA1 CASP9 GNG5 BCL2L1

PDGFC CCNE1 FOXO3 CDKN1A MAP2K1 LAMC2 PPP2R1B COL5A3

VEGFA PTEN FGFR1 FGF1

hsa05202:Transcriptional

misregulation in cancer 11

miR-34a-5p miR-223-3p miR-28-5p miR-363-3p

41 3.14E-03

HIST1H3B CDKN2C HIST1H3A BAIAP3 LMO2 HIST3H3 PAX3 RUNX1

miR-27a-3p miR-26a-5p miR-101-3p miR-146b-3p HMGA2 HDAC1 CCND2 HOXA9 CDKN1B HIST2H3C MEIS1 IGF1R

miR-93-5p miR-25-3p

HIST1H3E ZEB1 TP53 ATM CEBPB HIST1H3I TGFBR2 MYC

KLF3 HIST1H3C PDGFB H3F3A HIST1H3H SP1 GOLPH3 H3F3B

MYCN CDKN1A Il6 BIRC3 MEF2C FOXO1 HIST2H3A SMAD1

HIST1H3J

71

Specific in LAN-5

Term

(KEGG_Pathway) Count miRNA|TarBase Count PValue Target Genes

hsa05200:Pathways in

cancer 6

miR-96-5p miR-155-5p miR-504 miR-654-3p

40 2,58E-07

GSK3B STAT3 NFKB1 SPI1 CDK4 SMAD2 E2F2 Spi1

miR-630 miR-639

APC WNT5A CDK2 BAX Csf1r ETS1 SMAD3 BCL2

EGFR RHOA CDKN2A KRAS Hif1a MLH1 MITF SMAD4

CTNNB1 MSH6 CTNNA1 COL4A2 MSH2 RAC1 FGF2 FAS

NKX3-1 CDKN1A VEGFA FOXO1 CSF1R FGF7 JUP MDM2

hsa04115:p53

signaling pathway 4 miR-96-5p miR-504

miR-654-

3p miR-639 4 7,77E-04 CCNB1 BAX FAS CDKN1A MDM2

hsa04110:PI3K-Akt

signaling pathway 3

miR-221-3p miR-302b-3p miR-449b-

5p miR-34b-5p

30 7,38E-03

GSK3B NFKB1 CDK4 THBS1 PPP2CA CDK2 PCK2 Csf1r

miR-126-5p miR-34b-3p miR-483-3p

miR-1285-3p ITGB4 BCL2 EGFR KRAS RHEB ITGB5 COL4A2 PPP2R2A

FLT1 PDK1 YWHAZ RAC1 FGF2 EIF4E2 FOXO3 PKN2

CDKN1A SGK3 CSF1R FGF7 GNB4 BCL2L11

hsa04110:Cell cycle 4

miR-155-5p miR-654-3p miR-639 miR-376a-5p

15 2,16E-02

GSK3B CDK4 SMAD2 E2F2 CDK2 SMAD3 STAG2 WEE1

CDKN2A SMAD4 TTK YWHAZ CDKN1A PRKDC PLK1

72

Specific in SH-SY5Y

Term

(KEGG_Pathway) Count miRNA|TarBase Count PValue Target Genes

hsa04110:Cell cycle 7

miR-221-3p miR-302b-3p miR-449b-5p miR-34b-5p

11 9,08E-10

CDK4 CCND2 CDKN1B CDK6 CDKN1C SMAD4 CCNE2 MYC

miR-675-5p miR-34b-3p miR-483-3p

RB1 CDC27 CDC25A

hsa05200:Pathways in

cancer 5

miR-199b-5p miR-221-3p miR-449b-5p miR-34b-5p

12 5,24E-12

FOS CDK4 BCL2 CDKN1B CDK6 CCNE2 MYC KIT

miR-34b-3p

LAMC2 VEGFA PTEN DVL2

hsa04115:p53

signaling pathway 8

miR-221-3p miR-302b-3p miR-449b-5p miR-34b-5p

11 3,54E-11

CCNG1 CDK4 CCND2 CDK6 TP53 PMAIP1 CCNE2 SESN2

miR-126-5p miR-34b-3p miR-483-3p miR-1285-3p BBC3 SESN3 PTEN

hsa04110:PI3K-Akt

signaling pathway 8

miR-181c-5p miR-199b-5p miR-221-3p miR-302b-3p

20 1,52E-10

MYB CDK4 PPP2CA MCL1 CCND2 BCL2 CDKN1B GNB1

miR-449b-5p miR-582-5p miR-34b-5p miR-34b-3p PPP2R5C KRAS CDK6 DDIT4 CCNE2 MYC KIT HSP90B1

FOXO3 LAMC2 VEGFA PTEN