1
Light-induced modulation of DNA recognition by the Rad4/XPC damage sensor protein
Amirrasoul Tavakoli1, Debamita Paul1, Hong Mu2,
Jagannath Kuchlyan1‡, Saroj Baral3, Anjum Ansari3, Suse Broyde2, Jung-Hyun Min1†
1Department of Chemistry & Biochemistry, Baylor University, Waco, TX 76706, USA
2Department of Biology, New York University, New York, NY 10003, USA
3Department of Physics, University of Illinois at Chicago, Chicago, IL 60612, USA
† To whom correspondence may be addressed
‡ Current address: Department of Chemistry, University of Oxford, Oxford, OX1 3TA, UK
Tel: (254)710-2095
E-mail: [email protected]
Keywords: Photolabile DNA; photo-switch; photocage; optochemical control; photo-regulation;
light control; photo-cleavable; light-controlled protein-DNA interaction; photo-induced reaction;
fluorescence lifetime; bulky adduct; DNA damage recognition; DNA damage repair; nucleotide
excision repair; conformational dynamics; xeroderma pigmentosum; XPC; Rad4;
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
2
ABSTRACT
Biomolecular structural changes upon binding/unbinding are key to their functions. However,
characterization of such dynamical processes with high spatial and temporal resolutions is
difficult as it requires ways to rapidly trigger the assembly/disassembly as well as ways to
monitor the structural changes over time. Recently, various chemical strategies have been
developed to use light to trigger changes in oligonucleotide structures, thereby their activities.
Here we report that photoswitchable DNA can be used to modulate the DNA binding of the
Rad4/XPC DNA repair complex using light. Rad4/XPC specifically binds to diverse helix-
destabilizing/distorting lesions including bulky organic adducts and functions as a key initiator
for the eukaryotic nucleotide excision repair (NER) pathway. We show that the 6-
nitropiperonyloxymethyl (NPOM)-modified DNA is recognized by the Rad4 protein as a
specific substrate and that the specific binding can be abolished by light-induced cleavage of the
NPOM group from DNA in a dose-dependent manner. Fluorescence lifetime-based analyses of
the DNA conformations suggest that free NPOM-DNA retains B-DNA-like conformations
despite its bulky NPOM adduct, but Rad4-binding renders it to be heterogeneously distorted.
Subsequent extensive conformational searches and molecular dynamics simulations demonstrate
that NPOM in DNA can be housed in the major groove of the DNA, with stacking interactions
among the nucleotide pairs remaining largely unperturbed and thus retaining overall B-DNA
conformation. Our work suggests that photoactivable DNA can be used as a DNA lesion
Graphical Summary This work shows that a photolabile 6-nitropiperonyloxymethyl
(NPOM)-modified DNA is specifically recognized by the Rad4/XPC damage sensor protein complex that initiates the nucleotide excision repair pathway; light-induced cleavage of
NPOM abolishes the specific binding to Rad4/XPC.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
3
surrogate to study DNA repair mechanisms such as nucleotide excision repair.
INTRODUCTION
Biological processes entail dynamic yet coordinated assembly and disassembly of multiple
molecules in solution. A key challenge in studying these processes in high structural and
temporal resolution lies in the difficulties in controlled triggering of these events. Methods of
triggers often involve either perturbing the equilibrium state using temperature-, salt- or pH-
jumps or initiating the binding/unbinding through rapid mixing. Another method of triggering
involves photo-induced chemical changes, as showcased by pioneering studies on dynamics of
allosteric transitions in hemoglobin 1-2. Photoswitchable groups undergo structural changes upon
irradiation by light, usually of a specific wavelength, in a reversible or irreversible manner 3-4.
Such light-induced chemical/structural conversions have emerged as useful tools to control the
properties and hence probe the functions of biomolecules harboring the photoswitchable groups,
as light can be easily applied to biological systems in vitro or in vivo to trigger specific events 5-
9. Photoswitchable modifications in small molecules 10-12, oligonucleotides 13, peptides 14-15, and
proteins (mostly enzymes) 16-19 have also been used to control and monitor a wide variety of
biological outcomes including gene expression, enzyme activity, oligomerization states, cellular
localization and immune responses.
One of the photoswitchable groups, the 6-nitropiperonyloxymethyl (NPOM) has been
introduced by the Deiters group as an improvement over previous o-nitrobenzyl derivatives for
modifying biomolecules including oligonucleotides 20-22 (Figure 1). Irradiating an NPOM-
modified nucleoside/ DNA/RNA with light (λ = 365 nm) cleaves the NPOM from the substrate
without damaging the parent compound and restores the unmodified structures with concomitant
release of 1-(6-nitroso-1,3-benzodioxol-5-yl)ethenone (hereafter nitrosoacetophenone) (Figure
1) 23-26. Compared with the previous O-nitrobenzyl derivatives such as 6-nitroveratryl (NV) and
6-nitroveratryloxycarbonyl (NVOC) groups, NPOM features a higher quantum yield (Φ = 0.094
versus Φ = 0.0013 for NVOC), is highly stable in an aqueous environment at various pHs 21, 23, 27
and penetrates cell membranes without altering growth rate or phenotype of the cells/organisms 28. The NPOM modification has been applied to various in vitro and in vivo biological studies.
For instance, photocleavage of NPOM-modified DNA/RNA has been used to control the
activities of DNAzymes 29, antisense DNA/RNA 13, 30, restriction endonucleases 31, DNA-
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
4
binding transcription factors 32, polymerase chain reaction (PCR) rates 33, as well as CRISPR-
Cas gene editing 9, 18, 34-35. In these cases, NPOM-modifications prevent the DNA or RNA from
hybridizing to the complementary strands, which could be reversed upon NPOM cleavage with
light, converting the unhybridized ‘inactive’ molecules to hybridized ‘active’ molecules.
Here, we took advantage of the fact that DNA modifications such as NPOM are quite
bulky and thus perhaps could be seen as a lesion on DNA by cellular DNA repair machineries,
particularly those involved in the nucleotide excision repair (NER) pathway. NER repairs a wide
spectrum of bulky adduct lesions in the DNA including sunlight-induced intra-strand crosslinks,
bulky DNA adducts induced by various metabolites, reactive oxygen species, environmental
pollutants and carcinogens (reviewed in 36-38). Genetic impairment in NER causes high sun
sensitivity xeroderma pigmentosum (XP) cancer predisposition syndrome in humans 37, 39. In
eukaryotic NER, the repair of these lesions scattered around the global genome is primarily
initiated when the XPC–RAD23B complex (Rad4–Rad23 in yeast; hereafter referred to as XPC
and Rad4) first specifically localizes to the lesion. The lesion binding by Rad4/XPC
subsequently leads to the recruitment to the lesion of the transcription factor IIH complex
(TFIIH) containing XPD and XPB helicases, which verifies the presence of a bulky lesion and
recruits other NER factors. Eventually, a 24–32 nucleotide (nt) lesion-containing portion of the
DNA strand is excised by the XPF-ERCC1 and XPG endonucleases and the gap in the DNA is
restored by repair synthesis and nick sealing.
Previous studies from our group have shown that Rad4 recognizes DNA lesions in an
indirect manner: crystal structures of Rad4 bound to UV-lesions showed that the Rad4 flips two
damage-containing nucleotide pairs out of the duplex (the so-called ‘open’ conformation) with
the damaged nucleotides flipped away from the protein, such that only the undamaged
nucleotides on the complementary strand make direct contacts with the protein 40-41. This and
other studies pose a puzzle as to the mechanism of this indirect readout by Rad4 and the nature
of the structural intermediates along the recognition trajectory. These missing key steps led us to
ponder whether photoswitchable adducts could serve as model DNA lesions and if their
photoswitchable characteristics could be used to trigger the binding/unbinding events in a
precisely controlled manner for structural and functional studies. So far, photoswitchable
DNA/RNA has been mostly used for cellular and genetic studies but not as much for probing the
biochemical and structural mechanisms, let alone for investigating NER 9, 42.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
5
Here, using fluorescence lifetime-based fluorescence resonance energy transfer (FRET)
measurements with cytosine analog FRET pair, tCo and tCnitro, that are uniquely sensitive to
changes in B-DNA conformation 43-46, together with UV-Vis spectroscopy and competitive
electrophoretic mobility shift assays (EMSA), we show that (1) the NPOM modification on DNA
is recognized specifically by Rad4 and (2) that this specific binding is completely abolished by
photocleavage of the NPOM moiety from the DNA. Extensive conformational searches and
molecular dynamics simulations of the DNA also corroborate with the fluorescence-based
conformational analyses; the results demonstrate that NPOM in DNA can be housed in the major
groove of the DNA, with stacking interactions among the nucleotide pairs remaining largely
unperturbed and thus retaining overall B-DNA conformation. These findings pave the way for
the use of photoswitchable DNA as a novel probe to examine the damage recognition mechanism
in the NER pathway and is a significant addition to the toolbox to study the structure and
dynamics of molecules.
MATERIALS AND METHODS
Preparation of Rad4–Rad23 complexes. The Rad4-Rad23 complex (or simply referred to as
“Rad4”) was prepared as previously described 40-41, 47. The Rad4 construct spans residues 101–
632 and contains all four domains involved in DNA binding. This Rad4-Rad23 construct has
previously been shown to exhibit the same DNA-binding characteristics as the full-length
complex 41. While Rad23 does not participate in DNA binding directly, it is required for
stabilizing Rad4.
Hi5 insect cells co-expressing Rad4 and Rad23 proteins were harvested 2 days after
infection. After lysis, the protein complex was purified by affinity chromatography (Ni-NTA
Agarose, MCLAB), anion-exchange (Source Q, GE healthcare) and cation exchange (Source S,
GE healthcare) chromatography followed by gel filtration (Superdex200, GE healthcare). The
chromatogram and SDS -PAGE analyses of the gel filtration step show that peak fractions
contain a homogeneous 1:1 complex of Rad4 and Rad23 proteins. These peak fractions were
pooled and further concentrated by ultrafiltration (Amicon Ultra-15, Millipore) to ~13‒14 mg/ml
(135‒150 µM) in 5 mM bis-tris propane–HCl (BTP-HCl), 800 mM sodium chloride (NaCl) and
5 mM dithiothreitol (DTT), pH 6.8. The complex was prepared without thrombin digestion, thus
retaining the UBL domain of Rad23 and a histidine-tag on Rad4.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
6
Preparation of double-stranded DNA substrates. Unmodified DNA oligonucleotides were
purchased from Biosynthesis or Integrated DNA Technologies (IDT). DNA oligomers
synthesized with tCo and tCnitro were from Biosynthesis. All oligonucleotides were purchased as
HPLC-purified. Oligonucleotides appeared as a single band on denaturing polyacrylamide gels,
indicating high length-purity (>90%) of the oligonucleotides. The concentrations of each single-
stranded DNA were determined by UV absorbance at 260 nm (NanoDrop OneC, ThermoFisher)
using the A260 extinction coefficients calculated by the nearest neighbor method (Biosynthesis).
To prepare DNA duplexes, two complementary oligonucleotides were mixed at 1:1 molar ratio at
100 µM in TE buffer (10 mM Tris-HCl pH 7.50, 1 mM EDTA) in a microcentrifuge tube and
annealed by slow-cooling: the tube was immersed in a 1.2 L hot water bath (~100 °C) placed on
a hot plate; after 5 minutes, the hot plate was turned off and the samples were cooled to room
temperature over 5 to 6 hours.
Photo-irradiation experiments and cleavage studies with NPOM DNA and NPOM-dT
(NPOM-modified deoxythymidine). NPOM-dT was purchased from Berry & Associates (Cat
No. PY 7795). 50 µl of 10-50 µM of DNA samples or NPOM-dT were irradiated in a chamber
encasing four UV-A lamps, at 6.4 mW/cm2 (measured by General Tools Digital UVA/UVB
Meter, 280-400 nm; #UV513AB). At specified time intervals, 1.5 µl of the sample was taken out
and its absorbance spectrum was measured with NanoDrop One UV-Vis Spectrophotometer. The
experiments were done with lights off in the lab. Exposing the NPOM-dT 10-400 µM in TE
buffer with 0.01-0.4% DMSO or NPOM-DNA 10-50 µM in TE buffer under ambient light in the
lab for 24 hours did not change the absorbance spectra of the samples, indicating little
photocleavage by ambient light.
Melting temperature measurements of DNA duplexes. The overall thermal stabilities of all
DNA duplexes were measured as follows. The absorbance at 260 nm of each DNA duplex (1.5
µM) was measured in a sample cuvette of path length 1 cm, using Cary 300 Bio UV-Visible
spectrophotometer equipped with a Varian temperature controller. The absorbance measurements
were done from 10 to 85 °C at every 1.0 °C interval. Derivative method 48 of Carry300 (Thermal
software) was used to calculate the melting temperature (Tm) at which 50% of the DNA strands
have separated. The derivatives were obtained numerically from the absorbance data using a
Savitzky Golay technique where the difference between adjacent points was first computed
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
7
followed by a smoothing procedure where 5 points surrounding an individual point were
averaged to produce a new, smoothed point 49.
Competition electrophoretic mobility shift assays (EMSA). To determine the relative
affinities of Rad4 binding to different DNA substrates, competition EMSA (or gel-shift assays)
were employed essentially as previously described 40-41, 43, 47, 50. The benefit of using this
competition assay over the conventional single-substrate EMSA is that one can directly observe
any preferential binding over the nonspecific binding, including factors such as potential DNA
end-binding while avoiding multiple proteins aggregating on a single DNA, as is the case when
protein is in excess of total DNA 50. Various concentrations of the Rad4-Rad23 complexes were
mixed with 5 nM 32P-labelled DNA of interest (mismatched/damaged or matched/undamaged) in
the presence of 1000 nM cold (unlabeled), matched DNA, CH7_NX in an EMSA buffer (5 mM
BTP-HCl, 75 mM NaCl, 5 mM DTT, 5% glycerol, 0.74 mM 3-[(3-
cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 500 µg ml-1 bovine serum
albumin, pH 6.8). Mixed samples were incubated at room temperature for 20 min and separated
on 4.8% non-denaturing polyacrylamide gels in 1x TBE buffer (89 mM Tris-HCl, 89 mM Boric
acid, 2 mM EDTA, pH 8.0), run at constant 150 V for 15 min at 4 °C. The gels were quantitated
by autoradiography using Typhoon FLA9000 and Imagelab 6.0.1 software from Biorad. The
averages of the Rad4-bound DNA fractions quantified from three independent EMSA gels were
used for subsequent calculations of the apparent dissociation constants (Kd,app).
To obtain apparent dissociation constants (Kd,app) for different DNA substrates, we first used the
matched CH7_NX DNA as both the ‘hot’ probe and the cold competitor DNA, and obtained the
Kd,app for CH7_NX (Kns) by fitting the fraction of labelled DNA bound (f) to the equation
0[P])K[P]]([Df][Df tnsttnstns2 =+++⋅−⋅
where [P]t is the total protein concentration and [Dns]t is the total CH7_NX concentration (1005
nM). The Kd,app’s of other DNA substrates (Ks) were subsequently obtained by using the DNA of
interest as the 32P-labelled DNA probe and fitting the fraction of labelled DNA bound (f) to the
equation:
0K[P]}K[P]2K)K[P]]{([Df}K[P]K)K[P]]([D{Kf nstnstsnsttnsnstsnsttns2s
2 =⋅−⋅⋅+⋅+−⋅+⋅−⋅+−−⋅
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
8
where [P]t is the total protein concentration, [Dns]t is the concentration of the undamaged
competitor CH7_NX (1000 nM), and Kns is the Kd,app for CH7_NX binding, as obtained above.
The equation for Ks was obtained using the approximation that the concentration of Rad4-bound
labelled DNA is negligible compared to the total concentrations of Rad4 and of the
matched/undamaged DNA competitor. Curve fittings for Kns and Ks were both done by the
nonlinear regression method using Origin software (OriginLab). The errors reported for Kd,app
indicate the errors of the nonlinear regression fit 40-41.
Fluorescence lifetime measurements. DNA duplexes labeled with both tCo and tCnitro
(DNA_DA) or tCo alone (DNA_D) were prepared as described above. The DNA and Rad4-
Rad23-DNA 1:1 complexes were prepared at 5 µM in phosphate-buffered saline (10 mM
Na2HPO4, 2 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl pH 7.4) with 1 mM DTT. Under this
condition, native gel electrophoresis and dynamic light scattering experiments showed that the
Rad4-Rad23–DNA samples form uniformly sized 1:1 protein:DNA complexes 50. Sample
volume for each fluorescence lifetime (FLT) measurement was 12 µl. Time-resolved
fluorescence decays were measured on a time-correlated single-photon counting (TCSPC)
system (DeltaFlex, HORIBA). In our experimental setup, the excitation pulse was pulse-picked
second harmonic of a mode-locked Ti-sapphire laser (Mai Tai HP, Spectra-Physics) with a
tunable range from 690 to 1040 nm. We used ∼100 fs pulses centered at 730 nm with a
repetition rate of 80 MHz and average power 1.8 W (~23 nJ/pulse). The fundamental beam (730
nm) was passed through a half-wave plate and then to a pulse picker for reducing the repetition
rate of the beam from 80 MHz to 4 MHz. For the second harmonic generation, the fundamental
730 nm beam coming from the pulse picker was focused onto a thin β-barium borate (BBO)
crystal in second-harmonic generator TPH Tripler (Minioptics, Inc., Arcadia, CA), which
generates a frequency-doubled beam centered at 365 nm. The remaining fundamental beam and
frequency-doubled 365 nm beam were separated through a dichroic mirror. The fundamental
pulse was given a time delay through an optical delay cable connected with a delay box, and was
allowed to pass through a photodiode for triggering the start signal in DeltaFlex collection
system. For excitation of tCo, the frequency-doubled laser pulses were passed through a
monochromator set at 365 nm (band pass 10 nm) attached to the DeltaFlex set up. We used
neutral density filter (FSQ-ND20, broadband UV-grade fused silica metallic filter, Newport
corporation) to reduce power of excitation light suitable for TCSPC measurements. The intensity
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
9
of the laser delivered to the samples was 0.21 mW/cm2 as measured by a General Tools Digital
UVA/UVB Meter, 280-400 nm (#UV513AB).
The fluorescence from the samples passed through a long pass filter cut at 375 nm and
the signal was collected at magic angle with the emission polarizer oriented 54.7 ° from the
vertical. The transmitted signal was passed through the entrance slit of emission monochromator
set at 470 nm (band pass 10 nm) and collected by a Picosecond Photon Detection module (PPD-
850, Horiba) connected to a photon counter. The instrument response function (IRF) of the
system was measured using a dilute aqueous solution (3% w/w) of LUDOX AM colloidal silica
(Sigma-Aldrich). The full-width half maxima (FWHM) of the instrument response function
(IRF) was ~425 ps. Fluorescence decay curves were recorded on a 100 ns timescale, resolved
into 4,096 channels, to a total of 10,000 counts in the peak channel. For temperature scanning,
the temperature of the sample chamber was regulated by Quantum Northwest Peltier-Controlled
TC 1, between 4–40 °C.
Analysis of the fluorescence decay traces using discrete exponential (DE) fits. The discrete
exponential (DE) analysis was carried out using EzTime software (version 3.2.9.9) provided by
Horiba that uses a standard iterative reconvolution method, assuming a multiexponential decay
function, I 𝑡 = 𝛼!exp −𝑡/𝜏!!!!! , where 𝛼! is the amplitude and 𝜏! is the fluorescence lifetime
of the i-th decay component (Table S1). The maximum number of exponentials allowed by this
software is five. For all measured decay traces, no more than four exponentials were needed to
reasonably fit the data. The number of exponentials required for each trace was determined by
the quality of the fit, evaluated based on the reduced chi-square 𝜒! and the randomness of
residuals (Figure S4). Each exponential component for the donor-acceptor labeled samples
(DNA_DA) was characterized in terms of a lifetime denoted as 𝜏!",!, and a corresponding
normalized amplitude or relative population 𝐴! =!!!!!
. The FRET efficiency for the population
in that component was computed from 𝐸! = 1− !!",!!!
, where 𝜏! indicates the intrinsic lifetime of
the donor probe. The average FRET efficiency for each sample was computed as < 𝐸 >=
𝐴!𝐸!! = 1− !!!"!!!
, where < 𝜏!" >= 𝐴!𝜏!",!! . For cases where the intrinsic lifetime of the
donor-only samples could not be described by a single exponential, 𝜏!was taken as the intrinsic
lifetime of the donor probe obtained from unmodified DNA (AT10_D).
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
10
Analysis of the decay traces using maximum entropy method (MEM) and Gaussian fitting.
Though the DE fitting has been traditionally used for fluorescence lifetime decay analyses, MEM
has distinct advantages 43, 51. In our previous studies, we have also shown that the results from
the DE and MEM analyses corroborate with each another 43. The MEM analyses were carried out
using MemExp software 52-53, as done previously 43. The reproducibility of the distributions
obtained from the MEM analyses from three independent lifetime measurements on each sample
are illustrated in (Figure S6). The data presented in (Figure 4) are for one representative from
this set. To further characterize the lifetime distributions from the MEM analyses, we fitted the
measured distributions to a sum of Gaussians (Figure S5). Each Gaussian component was used
to calculate the average FRET representing that component, and the area under the Gaussian
curve was taken as a measure of the fractional population of that component. The results are
summarized in Table S2. Errors are indicated with standard deviations (s.d.) from three
independent sets of measurements.
Conformational searches and molecular dynamics simulations of NPOM-dT-containing
DNA duplex structures. In order to explore the structures of the NPOM-dT-containing DNA
duplex, we first modeled NPOM-dT at the center of a 13-mer B-DNA duplex with the same
sequence as in the AT2 NPOM-DNA (Table 1) employed in the experimental study. We carried
out extensive conformational searches beginning with an NPOM-dT nucleoside to generate
initial models for MD simulations of NPOM-dT in a B-DNA duplex, utilizing a sequence of
protocols involving molecular modeling (Discovery Studio 2.5, Accelrys Software Inc.) and
quantum mechanical geometry optimization (Gaussian 09 54) to define sterically feasible NPOM-
dT rotamer combinations for initiating the MD simulations (Figures S11-S12). These protocols
and obtained structures are summarized in Scheme 1. We used the AMBER18 suite of programs 55 for MD simulations and analyses. Full details of NPOM-dT force field parameterization, MD
simulation methods and analyses are given in the SI Methods. Newly developed force field
parameters for the NPOM-dT are given in Table S3.
RESULTS
Dose-dependent photocleavage of NPOM from DNA as monitored by UV-Vis absorption
spectroscopy. Photoconversion reactions often induce changes in the absorption spectra of the
chemical groups of interest, which in turn can be used to track the reaction progress. To monitor
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
11
the NPOM’s photocleavage reaction, we obtained the UV-Vis absorption spectra of the NPOM-
modified DNA duplex (NPOM-DNA or AT2; see Table 1 for the DNA sequences used in the
study) and dT nucleoside (NPOM-dT) after they were irradiated with varying doses of
photocleavage-inducing light (λ=365 nm, 6.4 mW/cm2, irradiated for 0 to 210 sec). The overall
absorbance in the 300-500 nm range increased with increased irradiation time, with the
absorption maximum (𝜆!"#) shifting from 365 nm to 395 nm (red-shift) for both samples
(Figures 2 and S1). NPOM-DNA and NPOM-dT also showed similar reaction kinetics with
similar half-times (t1/2) of the absorption change at 395 nm (57 ± 7 sec for NPOM-DNA and 54
± 5 sec for NPOM-dT) and a common ~3-fold increase in the absorbance upon saturation
(Figure 2A, B). Unmodified DNA duplex did not show absorption in this wavelength range
with or without irradiation (Figure 2B). The strong absorbance at 395 nm after photo-irradiation
comes from the photocleavage reaction product, nitrosoacetophenone (Figure 1) 56. When the
nitroso-acetophenone was removed from DNA using a size-exclusion purification (G25, MWCO
~5 kDa), the absorption spectrum of the sample largely returned to that of the unmodified DNA
(Figure S1D). Altogether, the results confirm the photo-induced cleavage of NPOM from DNA
and indicate that the photocleavage reaction can be modulated by light doses 9. The
photocleavage reaction may, in principle, be accelerated by using light of higher intensity and
shorter time duration, as indicated previously 9, 57. Although there have been multiple studies
using NPOM as photoactivatable group that elicit various biological outcomes, this is the first
time the photocleavage reaction progress was characterized in situ (through monitoring of the
absorption spectra).
NPOM lowers the thermal stability of DNA duplex which can be reversed by
photocleavage. Several studies show that Rad4/XPC-binding and NER repair propensity for
various lesions are positively correlated with the thermal destabilization induced by the lesion,
which can be measured by DNA melting temperatures 40, 50, 58. To see if thermal stability of DNA
was impacted by the NPOM modification, we measured the melting temperatures (Tm) of the
NPOM-DNA before and after photocleavage and compared them with that of the unmodified
DNA. The Tm of NPOM-DNA (AT2, 45.2 °C) was ~7 °C lower than that of the unmodified
DNA (AT1, 52.0 °C) while the Tm of NPOM-DNA after photocleavage (2 min irradiation)
was the same as that of the unmodified DNA (52.0 °C) (Table 1, Figure S2A). These results
showed that covalent NPOM adduct destabilized the DNA duplex but its photoremoval
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
12
restored the DNA stability. The reaction products such as nitrosoacetophenone, though
present in the reaction mix, did not affect the DNA thermal stability.
Competitive electrophoretic mobility shift assays (EMSA) show that NPOM-DNA is
specifically recognized by Rad4, which is abolished upon NPOM photocleavage. After
observing NPOM is a helix-destabilizing DNA adduct, we set out to examine if the adduct can
indeed be recognized as a DNA lesion by Rad4/XPC, by using a competitive electrophoretic
mobility shift assay (EMSA) as extensively used before (Figure 3) 40-41, 43, 47, 50. In this assay,
the binding of the protein to 5 nM 32P-labeled substrate DNA is monitored in the presence of
1,000 nM unlabeled, undamaged “competitor” DNA (CH7_NX). The NPOM-DNA (AT2)
showed ~15-fold lower apparent dissociation constant (Kd,app ~48 nM) than the corresponding
unmodified DNA (AT1) (Kd,app ~701 nM). This specificity of NPOM-DNA (AT2) is even
slightly higher than another specific model DNA substrate containing CCC/CCC mismatches
(CH10_NX; Kd,app ~79 nM), and is comparable to that of a bona fide NER lesion, 6-4
thymidine-thymidine photoproduct (6-4PP) (Kd,app ~35 nM) 40. On the other hand, the NPOM-
DNA after photocleavage (AT2 + hν) showed Kd,app ( ~744 nM) comparable to that of the
unmodified DNA (AT1). These results show that the NPOM adduct in DNA is specifically
recognized by Rad4/XPC as a lesion and that its photoremoval abolishes the specific binding.
Therefore, the NPOM adduct could be useful as a new photoswitchable model DNA lesion for
Rad4/XPC and potentially for NER.
DNA conformation landscape mapped by fluorescence lifetime analyses (FLT) of the
tCo-tCnitro-labeled DNA shows DNA with NPOM becomes heterogeneously distorted upon
binding to Rad4. Previously, we showed that fluorescence lifetime (FLT) analyses combined
with a unique set of FRET probes (tCo and tCnitro) in DNA can be used to map the conformations
of DNA in solution 43. The tCo and tCnitro are a FRET pair that serve as donor and acceptor,
respectively 44-45. As cytosine analogs, these probes retain normal Watson–Crick pairing with
guanines with minimal perturbation of DNA structure and stability 44, 50. Furthermore, the rigid
exocyclic ring and its base stacking interactions hold these nucleotide analogs in relatively fixed
orientations within the DNA helical structure, making their FRET sensitive to subtle distortions
in DNA helicity that alter the probes’ separation and/or relative orientation 59-61. For example,
Rad4-induced untwisting and ‘opening’ of 3-bp mismatched DNA could be monitored by the
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
13
FRET efficiency between tCo (donor) and tCnitro (acceptor) placed on either side of the mismatch 43, 50. The FRET efficiency (E) relates directly to the lifetimes of the excited donor fluorophore,
as E =1− !!"!!
, where 𝜏!" and 𝜏! are the donor lifetimes in the presence and absence of the
acceptor, respectively. The lifetime approach offers distinct advantages over other techniques
such as single-molecule FRET and is a more robust way to obtain FRET efficiency than the
intensity-based steady-state measurements 43, 62. Here, we adopted our previous approach and
incorporated the tCo-tCnitro FRET probes in the context of the NPOM-DNA construct (AT2) in
the same positions relative to the lesion site as before (Table 1)43, 50. tCo-tCnitro probes did not
significantly alter DNA duplex stability of these DNA constructs as measured by DNA melting
temperatures (Figure S2B) 43, 50. The fluorescence decays of each sample were obtained (Figure
S3) and analyzed using two different methods, discrete exponential (DE) and maximum entropy
method (MEM), as before 43. Results from DE analyses are shown in Figures S4-S5 and Table
S1, and MEM results are detailed in Figures S5-S6 and Tables S2. Both analyses resulted in
FLT profiles largely consistent with each other (Figure S5), as shown before 43. Our discussion
below is primarily based on the results obtained from MEM.
First, for the unmodified DNA (AT10), the donor-only construct (AT10_D) showed a
single major lifetime peak (𝜏!) at 5.1 ns, which corresponds to the intrinsic lifetime of the donor
fluorescence (since there is no acceptor and thus no FRET), consistent with previous results by
us and the Wilhelmsson group (Figures 4A & S5A) 43, 63. In comparison, the DNA containing
both the donor and acceptor (AT10_DA) showed a major lifetime peak (𝜏!") at 0.27 ns with
86% fractional population with minor peaks at 1.8 ns (7%) and 4.8 ns (7%) (Figures 4A & S5B).
The major lifetime peak of ~0.3 ns corresponds to a FRET efficiency of ~0.94, which closely
matches the calculated FRET of 0.936 for an ideal B-DNA structure 43, 63-64. The 4.8 ns lifetime
is close to the intrinsic lifetime of the donor in the absence of the acceptor; however, this was not
due to an excess of unannealed donor strand, as the same was observed even in the presence of
50% excess acceptor strand (Figure S7). These characteristics of AT10_DA agree well with
those of other matched DNA duplexes we had previously examined and confirm that AT10
mainly adopts B-DNA conformation with perhaps a minor population of non-B-DNA
conformations 43. Also, Rad4-binding to the DNA did not alter the FLT profile, as shown with
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
14
other nonspecific DNA, indicating that nonspecific binding by Rad4 does not lead to detectable
changes in tCo-tCnitro-based FRET (Figures 4A & S5C).
In comparison to a single peak profile in the unmodified AT10_D, the donor-only
NPOM-modified DNA (AT7_D) showed two peaks: one major peak with a lifetime of 4.5 ns,
similar to the 𝜏! of AT10, but also a minor, 2.0 ns peak (Figures 4B & S5D). This additional 2.0
ns peak was present even for unannealed, single-stranded AT7_D, indicating that it is not
sensitive to the DNA’s conformation (Figure S5J), and it disappeared upon photocleavage, as
seen for AT7_D irradiated for 120 s (AT7_D+hν), indicating an influence of NPOM on the tCo
fluorescence (Figures 4A & S5G). However, despite this minor interference by NPOM on the
tCo fluorescence, the donor-acceptor-labeled NPOM-DNA (AT7_DA) showed remarkable
resemblance to that of the unmodified DNA (AT10_DA) with one major (0.31 ns (74%)) and
two minor peaks (1.8 ns (13%) and 4.8 ns (13 %)) (Figures 4B, 4C & S5E). The similarity
between the two DNA constructs indicates that the conformations of NPOM-modified DNA as
sensed by the tCo-tCnitro pair are largely unperturbed by the NPOM modification and most retain
B-DNA-like conformation. Upon binding to Rad4, however, the FLT profile of AT7_DA
changed distinctly compared with unbound DNA, unlike with AT10_DA (Figures 4B, 4D &
S5F). Two broader and shorter lifetime peaks (0.16 ns (55%) and 0.39 ns (31%)) replaced the
single major peak for unbound AT7_DA at ~0.3 ns while the 1.7 ns and 4.7 ns peaks reduced to
8% and 6% in the fractional population, compared with DNA without Rad4. Such changes in the
lifetime distribution translates to an increase in the average FRET efficiency from 0.78 to 0.87
upon Rad4 binding. A broader distribution of lifetimes with multiple peaks in AT7_DA indicated
that NPOM-DNA, when specifically bound to Rad4, can access a broader range of distinct
conformations with some that deviate from B-DNA. However, the FRET value of the Rad4-
bound DNA is significantly different from the FRET E calculated based on the ‘open’ DNA
conformation as seen in the crystal structure of Rad4-bound lesions (0.043), suggesting perhaps a
different binding mode for this DNA than other specific substrates 41, which we discuss further in
Discussion.
Lastly, NPOM-DNA after photocleavage (AT7+hν) showed profiles closely resembling
that of the unmodified AT10 without or with Rad4, consistent with the expected photoconversion
of NPOM-DNA to unmodified DNA (Figure 4A & S5G-I). The small differences in the peak
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
15
positions and widths were due to the nitrosoacetophenone released after photocleavage, as such
differences largely disappeared upon its removal using a G25 size-exclusion resin (Figure S5K).
These results reaffirm that light-induced cleavage of the NPOM group from DNA abolishes the
specific binding of Rad4 to the DNA and that the FLT profiles can be used to differentiate
specific versus nonspecific binding of Rad4 with DNA.
Progressive, light-induced conversion from specific to nonspecific Rad4-DNA complexes as
tracked by FLT. Seeing that FLT can discern the different conformational landscapes of NPOM-
DNA when specifically bound versus nonspecifically bound to Rad4, we next examined
progressive changes in FLT of Rad4-bound NPOM-DNA upon gradual increase in photo-
irradiation times (0-120 sec) (Figure 2). Progressive increase in photocleavage with increased
irradiation time under these conditions resulted in little change in the FLT distributions for free,
unbound NPOM-DNA: it mostly retained B-DNA conformation (𝜏 = 0.3 ns) although some
broadening of the peaks was observed (Figures S8A-E). In comparison, the FLT profiles of the
Rad4-bound NPOM-DNA changed distinctly with the increased irradiation (Figures 5A & S8F-
J). For instance, the two Gaussian peaks at ~0.16 ns and ~0.4 ns had comparable fractional
amplitudes (1.9:1) before irradiation but their ratios gradually increased with irradiation (2.8:1 at
60 sec), eventually merging as a single peak with τ of ~0.3 ns, closely resembling the non-
specifically bound unmodified AT10_DA (Figure S8J). Interestingly, the same tendency was
observed when the ratio between specific and nonspecific binding was altered by progressive
change in DNA:protein ratios (Figures 5B & S9-S10). The FLT profiles after 30 sec or 60 sec
irradiation resemble the profiles obtained when NPOM-DNA was bound to 2- or 3-fold molar
excess of Rad4 (Figure 5C-D). These results indicate that partial irradiation results in a mixture
of specifically and nonspecifically bound complexes, as anticipated, yielding conformational
distributions that are similar to when there is excess of protein and thus competition between
specific and nonspecific binding.
Conformational searches and MD simulations reveal two predominant major groove and
one base-displaced intercalated conformation for the NPOM-modified DNA duplex. Our
FLT study indicates that the NPOM-modified DNA retains a majority B-DNA conformation, at
least as sensed by the tCo and tCnitro FRET probes in these constructs. To gain molecular insights
into the FLT/FRET data and understand how the NPOM adduct may impact the DNA duplex
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
16
structure, we turned to extensive all-atom molecular dynamics (MD) simulations on NPOM-
modified DNA. As there is currently no structure available for the NPOM-adduct containing
DNA, we first carried out extensive conformational searches to obtain initial models for MD
simulations of NPOM-dT in B-DNA (Scheme 1). The search produced five geometry optimized
rotamer combinations of NPOM-dT that could fit into the 13-mer B-DNA structure without
causing extensive distortions to the duplex (Figure S11). Among these five conformations of
NPOM-dT, there were four major groove conformations where NPOM adopted various
orientations in the major groove with the dT in syn conformation (MJ1, MJ2, MJ3 and MJ4 in
Figure S12), and one base-displaced intercalated conformation where NPOM-dT intercalated
into the helix with the dT in anti conformation and its partner dA extruded into the major groove
(INT in Figure S12). We carried out 1.5 µs MD simulations for each of these systems as well as
an unmodified control duplex (Figure S13). Among our MD simulations of major groove
conformations, one ensemble exhibited denaturing of the duplex and extensive distortions (MJ3
in Figure S13A) and hence was excluded from our further analyses of the structural ensembles.
Our stable 1.5 µs MD simulations of major groove structures (MJ1, 2 and 4) for NPOM-
dT converged to two predominant conformations: two rotamers around the long axis of the
NPOM rings that placed the nitro group toward the major groove surface (MJ-I) or toward the
solvent (MJ-II) (Figures 6 & S13C). These two conformations were observed in all three stable
MD ensembles with varying proportions in each population (Figure 6A); they were able to
flexibly interchange through different combinations of rotations around the dihedral angles
between the NPOM rings and the modified dT (Figures 6 & S14). Of the combined ensembles,
66% adopted either of these two major groove conformations. In the major groove conformation
with the nitro group facing the major groove surface (MJ-I; 31% of the population), the NPOM
rings were oriented along the helix axis on the major groove surface with the five-atom ring
pointing toward the 5’ end of the lesion-containing strand, and its partner dA extruded
moderately toward the major groove. With the nitro group facing the solvent (MJ-II; 35% of the
population), the NPOM rings were oriented along the base pair planes with the five-atom ring
pointing toward its partner dA, protecting the dA from solvent. The remaining 34% of the major
groove population were transients that occurred during the transition between the two
predominant interchanging rotamers.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
17
For the base-displaced intercalated NPOM-dT, the structural ensemble remained stable,
with the NPOM rings intercalated into the DNA helix stacked with neighboring base pairs; the
partner dA was flipped into the major groove and protects the NPOM from the solvent (INT-I;
Figures 6, S13C & S14). This intercalated conformation comprised 86% of this base-displaced
intercalated conformational family. The remaining 14% represented one brief excursion during
the MD simulation where the NPOM rings were folded back to stack with dT and stretched the
base pair steps (INT-II; Figure S14).
To gain insight on the experimental FLT/FRET data, the two major groove
conformations, the intercalated conformation and the unmodified duplex were further analyzed.
We modeled the tCo-tCnitro FRET pairs at the respective nucleotide positions and calculated their
distances and dihedral angles between the dipoles (detailed in SI Methods). The distances were
measured between the center of mass for the middle ring of each fluorophore model (Figure
S15A). The dipole dihedral angles were calculated between the modeled dipoles of the FRET
pair (Figure S15B). The distance between the FRET pairs was very similar in all conformations
of the NPOM-dT-containing DNA and the unmodified DNA: 16.8 ± 1.8 Å for the major groove
conformations combined for the two rotamers, 16.7 ± 0.3 Å for the intercalated one, and 16.5 ±
0.1 Å for the unmodified DNA (Figure 6B). While the dipole dihedral angles showed slight
differences between the NPOM-dT-containing DNA and the unmodified DNA, the major groove
conformations combined for the two rotamers had a value of 170 ± 11º which was close to the
unmodified DNA of 182 ± 2º. However, the intercalated conformation was further from the
unmodified duplex with a value of 164 ± 5º (Figure 6B). The FRET efficiencies based on the
modeled FRET pairs were ~0.96-0.98 for the best representative structures of these conformers,
not too far away from the value expected of ideal B-DNA (0.936) and consistent with the FLT
experimental results.
These MD simulations provide atomistic models for the NPOM-DNA and insights into
their structural dynamics. While the major groove lesion-containing DNA structures were similar
to the unmodified DNA, they also exhibited local lesion conformational dynamics (Figure 6A)
that may be relevant to the recognition of the NPOM adduct by Rad4 (see Discussion).
DISCUSSION
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
18
Though a variety of photoswitchable DNA/RNA have been shown to modulate DNA/RNA
structures and functions, their applications for elucidating DNA repair mechanisms have been
relatively scarce. For instance, such chemistry has been used in DNA for inducing site-specific,
single or double strand breaks 65-67 and for triggering structural transition in a base excision
repair enzyme to study its mechanism 42. NPOM-related, 2-nitrobenzyl or 2-(2-
nitrophenyl)propyl groups have also been shown to mask the recognition of mismatches by the
mismatch binding protein MutS, which photo-irradiation could restore 68. Here in this study, we
show for the first time that a photoswitchable modification on DNA can be recognized as
efficiently as a bona fide DNA lesion by a DNA damage sensor, the Rad4/XPC nucleotide
excision repair complex. Furthermore, such specific binding could be abolished by
photocleavage in a manner dependent on the light dose. Our FRET study also demonstrates the
ability of the tCo/tCnitro pair to detect specific binding and the loss of it upon photocleavage. This
study thus sets the stage for future studies that can couple optical triggering with a variety of
other techniques (e.g., fluorescence conformational dynamics spectroscopy, time-resolved x-ray
crystallography, cellular repair kinetic studies, etc.).
NER is unique among DNA repair mechanisms in that it repairs an extraordinarily wide
range of DNA lesions caused by various environmental and endogenous agents, including intra-
strand crosslinks and bulky adduct lesions. A key to its versatility lies in its initial damage sensor
protein, XPC/Rad4 that senses lesions indirectly, by detecting local thermodynamic
destabilization induced by DNA damage rather than the lesion structures themselves. Our study
shows that the NPOM-DNA adduct is specifically recognized by Rad4 with a specificity
comparable to a bona fide NER lesion such as the 6-4 photoproduct UV lesion and that its
specific binding can be abolished upon photocleavage of the NPOM-adduct. Surprisingly, our
fluorescence-based conformational studies show that NPOM-adduct modification did not induce
a large deviation from the canonical B-DNA form, at least as probed by the tCo-tCnitro FRET
probes positioned as in these constructs. In a previous study with DNA labeled with tCo-tCnitro
FRET probes in analogous positions, a highly specific CCC/CCC mismatch showed a broad
heterogeneous distributions of fluorescence lifetimes that significantly deviated from B-DNA
towards longer lifetime (lower FRET) conformations 43. Furthermore, CCC/CCC mismatched
DNA showed further decrease in the average FRET upon Rad4 binding, a direction of change in
line with expected FRET changes based on the known DNA conformation in the ‘open’ crystal
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
19
structure 43. In contrast, with NPOM-DNA, we observed an increase in the average FRET upon
Rad4 binding even though NPOM-DNA shows higher specific binding to Rad4 than CCC/CCC.
Therefore, while both DNA substrates are specifically recognized by Rad4, our results suggest
that the different specific Rad4-DNA complexes may feature significantly different DNA
conformations in solution and also potentially different Rad4-binding modes for specific
recognition.
Our subsequent atomistic structures obtained by MD simulation provide intriguing
insights into how NPOM may be recognized by Rad4/XPC as a lesion. The existence of the two
nitro group conformations in the major groove is interesting in relation to the recognition by
Rad4: the electronegative nitro conformer that faces the solvent may favorably interact with
positively charged Arg and Lys amino acids in the DNA binding surface of Rad4 to foster Rad4
binding to a major groove NPOM conformer. The base-displaced intercalated conformer has
smaller FRET dipole dihedral angle than our unmodified control in or the major groove
conformers (Figure 6). This smaller value represents the well-known intercalation-induced
untwisting 69-70. In comparison, untwisting is more modest in the major groove conformers.
Base-displaced intercalated conformers have been shown to facilitate Rad4 recognition in
computational and experimental work 71-72. Computational studies have revealed that the
displaced partner base in the case of the NER-proficient (+) cis-benzo[a]pyrene-dG adduct is
readily captured by a pocket between BHD2 and BHD3 while the BHD2 hairpin binds into the
minor groove and untwists the duplex; in contrast, these structural hallmarks of initial lesion
recognition by Rad4 are missing when the partner nucleotide is absent, in which case the lesion
becomes NER-resistant 72. Different conformers of 2-(acetyl)aminofluorene-dG lesions have also
been shown to play a role in their recognition and repair by NER 73-74. While it is difficult to
ascertain which conformation is prevalent in solution here for NPOM-DNA, base-displaced
intercalated conformers can preferentially be stabilized in specific sequence contexts and be in
equilibrium with major groove conformers 75-77. Future studies are needed to reveal how Rad4-
binding changes the 3D structure of NPOM-DNA and how such structures impacts its repair by
NER.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
20
Acknowledgements. We thank the members of the Min, Broyde, and Ansari groups.
Funding. This work was funded by National Science Foundation (NSF) grants (MCB-1412692
to J.-H.M and MCB-1715649 to A.A.) and National Institutes of Health grants (R21-ES028384
to J.-H.M, R01-ES025987 to S.B.). This work used the Extreme Science and Engineering
Discovery Environment (XSEDE), which is supported by National Science Foundation (NSF)
Grant MCB-060037 to S.B., and the high-performance computing resources of New York
University (NYU-ITS).
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
21
Table 1. Sequences of the DNA duplexes used in this study
a D: tCo(FRET donor); P:tCnitro(FRET acceptor). This design is based on design in ref. 43
b Red indicates NPOM-modified dT.
c These values are from ref. 40.
Bold indicates the position of the 3-bp sequence corresponding to the CCC/CCC mismatched site
in CH10_NX.
The uncertainty in Tm as judged by half the temperature interval between successive data points
in the derivatives graph is 0.5 °C.
DNA Sequences Tm (°C)
61.0 ± 0.8c
76.5 ± 1.0c
45.2 ± 0.2
52.0 ± 0.0
47.1 ± 0.1
53.5 ± 0.5
Matched(CCC/GGG, CH7_NX)
5’-TTGACTCGACATCCCCCGCTACAA -3’3’- ACTGAGCTGTAGGGGGCGATGTTA -5’
Mismatched(CCC/CCC, CH10_NX)
NPOM-DNA(AT2)
5’-TTGACTCGACATCCCCCGCTACAA -3’3’- ACTGAGCTGTAGGCCCCGATGTTA -5’
5’-TTGACTCGACATCCGAAGCTACAA -3’3’- ACTGAGCTGTAGGCTTCGATGTTA -5’
5’-TTGACTCGACATCCGAAGCTACAA -3’3’- ACTGAGCTGTAGGCTTCGATGTTA -5’
Unmodified(AT1)
5’-TTGACTCGACATCPGAAGGTACAA -3’3’- ACTGAGCTGTAGGCTTCDATGTTA -5’
5’-TTGACTCGACATCPGAAGGTACAA -3’3’- ACTGAGCTGTAGGCTTCDATGTTA -5’
NPOM-DNAa,b
(AT7_DA)Unmodified-DNAa
(AT10_DA)
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
22
Figures 1-6 & Scheme 1
Figure 1. Light-induced photocleavage reaction of the NPOM group from DNA. (Top)
Schematic of the photocleavage reaction. Upon light irradiation (λ=365nm), the NPOM group
(orange) is cleaved from the modified thymidine (dT) in the DNA, restoring unmodified
thymidine while releasing nitrosoacetophenone. (Bottom) Cartoon of the photocleavage reaction
in NPOM-containing duplexed DNA.
nitroso-acetophenone
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
23
Figure 2. Dose-dependent photocleavage of NPOM from DNA as monitored in situ by UV-
Vis absorption spectroscopy. (A) Absorption at 395 nm versus time. Dotted lines indicate the
reaction kinetics fitted using first order exponential decay. The half-times were 54 ± 7 s for
NPOM-DNA for NPOM-DNA (orange circles) and 52 ± 8 s for NPOM-dT (brown circles). (B)
Absorption spectra of NPOM-DNA (AT2, orange), NPOM-dT (brown), and unmodified DNA
duplex (AT1, blue) before (solid line) and after 120 s of light irradiation (dotted line).
A B
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
24
Figure 3. Apparent Rad4-binding affinities of DNA constructs measured by competition
electrophoretic mobility shift assays (EMSA). (A) Typical gel images showing the wild-type
Rad4-Rad23 complex binding to various DNA constructs. Mismatched (CCC/CCC) and matched
(CCC/GGG) DNA represent typical specific and nonspecific binding substrates, respectively.
The sequences of DNA are in Table S1. (B) Quantification of the Rad4-bound DNA fractions
versus total concentrations of the protein from gels including those shown in (B). The symbols
and error bars indicate the means and ranges as calculated by ± sample standard deviations,
respectively, from triplicate experiments. Solid lines indicate the fit curves of the data point. (C)
Kd,app and R2 of the fits derived from (B).The errors indicate the errors of the nonlinear regression
fit.
Matched (CCC/GGG)
B C
ARad4-DNA complex
Free DNA
Rad4 (nM) 0 33
53
86 137
160
187
219
256
300
Mismatched (CCC/CCC)
Unmodified (AT1)
Matched DNA
0 33
53
86 137
160
187
219
256
300
Rad4-DNA complex
Free DNA
Rad4 (nM) 0 33
53
86 137
160
187
219
256
300
NPOM-DNA (AT2)
0 33
53
86 137
160
187
219
256
300
NPOM-DNA (AT2) + UV
0 33
53
86 137
160
187
219
256
300
Mismatch DNA
Free DNA
Rad4 (nM)Rad4-DNA complex Unmodified
DNANPOM-DNA
Mismatched (CCC/CCC)Matched (CCC/GGG)NPOM-DNA (AT2)
Unmodified (AT1)NPOM-DNA+hν
Kd, app(nM) R2
79 ± 3 0.97421 ± 53 0.95
701 ± 70 0.86
48 ± 3 0.97744 ± 94 0.80
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
25
Figure 4. Fluorescence lifetime distributions obtained from MEM analyses for various
tCo-tCnitro-labeled DNA and DNA-protein complexes. “_D” indicate DNA with donor only;
“_DA” indicate DNA with donor/acceptor pair. (A) Unmodified DNA (AT10) in the absence
and presence of Rad4 and its comparison with NPOM-DNA after 120 s of photocleavage
reaction (AT7+hν). (B) NPOM-modified DNA (AT7) in the absence and presence of Rad4. (C,
D) Overlay of unmodified (AT10_DA) and NPOM-DNA (AT7_DA) without Rad4 (C) and in
the presence of Rad4 (D) Reproducibility of MEM FLT distributions for each DA sample is
shown in Figure S6. Full reports of the lifetimes, fractional amplitudes, FRET efficiencies of
each peak as well as the sample’s average FRET efficiencies are in Table S2.
A B
C D
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
26
Figure 5. Light-induced conversion from specific to nonspecific Rad4-DNA complexes as
tracked by FLT. (A) FLT distributions obtained from MEM analyses of Rad4-bound NPOM-
DNA (AT7_DA) with varying photocleavage irradiation time (0-240 s). (B) FLT distributions of
NPOM-DNA with varying DNA:Rad4 ratios. (C) Overlay of 30 s irradiation and 1:2
AT7_DA:Rad4 complex. (D) Overlay of 60 s irradiation and 1:3 AT7_DA:Rad4 complex.
DC
A BAT7_DA+Rad4(1:1) AT7_DA+Rad4
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
27
Scheme 1. Conformational search strategy for NPOM-dT-containing DNA
Major groove (6 rotamers):
syn-dT with NPOM in the major groove
(Figure S11A top row)
5 geometry optimized rotamers
(Figure S11B top row)
syn-dT with NPOM in major groove pointing to partner strand backbone (MJ3)
Excluded due to ruptured lesion site and great
distortions(Figure S13)
syn-dT with NPOM in major groove pointing 5’ on damaged
strand (MJ2)
syn-dT with NPOM in major groove pointing 3’ on damaged
strand (MJ1)
Converged to two major groove
conformations with nitro group facing either the major groove surface (MJ-I) or the solvent that interchange
flexibly (MJ-II)(Figures 6 & S13)
Base-displaced intercalated (2 anti-dT and
2 syn-dT rotamers): NPOM intercalated in the helix and the partner dAextruded in major groove
(Figure S11A bottom row)
4 geometry optimized rotamers
(Figure S11B bottom row)
anti-dT with NPOM intercalated and partner dA
extruded (INT)
One base-displaced intercalated
conformation (INT-I)
(Figures 6 &S13)
syn-dT with NPOM in major groove pointing to damaged
strand backbone (MJ4)
Minor groove(none feasible):
anti-dT with NPOM in minor groove
Stage 2Geometry
optimization of all feasible NPOM-dT
nucleoside rotamers
Stage 1Build NPOM-dT structure and search for sterically
feasible NPOM-dTrotamer combinations
when modeled in B-DNA
Stage 3Geometry optimized NPOM-dT
structures containing no clashes with neighboring base pairs retained for modeling in
B-DNA to initiate MD
Stage 4Stable undistorted MD derived NPOM-dT containing DNA
ensembles
(Figure S12)
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
28
Figure 6. NPOM-containing DNA structures obtained from stable MD derived ensembles.
(A) Best representative structures for the two major groove (MJ) and one base-displaced
intercalated (INT) conformations. The NPOM-dT dihedral angles (Figure S14) that determine
these different conformations are shown for each conformational family (MJ and INT) with each
cluster color-coded and labeled with its percentage of population. The transient clusters in the
major groove ensembles are colored green. These structures are shown in cartoon in Figure S13.
(B) The distributions of the modeled FRET pair distances (PD distance) and dipole dihedral
angles for the major groove and base-displaced intercalated NPOM-dT-containing DNA and
unmodified DNA. The definitions for the PD distance and dipole dihedral angle are given in
Figure S15. The major groove values are for the two dominant major groove conformations
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
29
(66% of the population), and the base-displaced intercalated values are for the stable intercalated
conformation (86% of the population).
References
1. Greene,B.I.;Hochstrasser,R.M.;Weisman,R.B.;Eaton,W.A.,Spectroscopicstudiesofoxy-andcarbonmonoxyhemoglobinafterpulsedopticalexcitation.ProcNatlAcadSciUSA1978,75(11),5255-9.
2. Hofrichter,J.;Sommer,J.H.;Henry,E.R.;Eaton,W.A.,Nanosecondabsorptionspectroscopyofhemoglobin:elementaryprocessesinkineticcooperativity.ProcNatlAcadSciUSA1983,80(8),2235-9.
3. Bleger,D.;Hecht,S.,Visible-Light-ActivatedMolecularSwitches.AngewChemIntEdEngl2015,54(39),11338-49.
4. Klan,P.;Solomek,T.;Bochet,C.G.;Blanc,A.;Givens,R.;Rubina,M.;Popik,V.;Kostikov,A.;Wirz,J.,Photoremovableprotectinggroupsinchemistryandbiology:reactionmechanismsandefficacy.ChemRev2013,113(1),119-91.
5. Ballister,E.R.;Aonbangkhen,C.;Mayo,A.M.;Lampson,M.A.;Chenoweth,D.M.,Localizedlight-inducedproteindimerizationinlivingcellsusingaphotocageddimerizer.NatCommun2014,5(1),5475.
6. Hansen,M.J.;Feringa,F.M.;Kobauri,P.;Szymanski,W.;Medema,R.H.;Feringa,B.L.,PhotoactivationofMDM2Inhibitors:ControllingProtein-ProteinInteractionwithLight.JAmChemSoc2018,140(41),13136-13141.
7. Schimer,J.;Pavova,M.;Anders,M.;Pachl,P.;Sacha,P.;Cigler,P.;Weber,J.;Majer,P.;Rezacova,P.;Krausslich,H.G.;Muller,B.;Konvalinka,J.,TriggeringHIVpolyproteinprocessingbylightusingrapidphotodegradationofatight-bindingproteaseinhibitor.NatCommun2015,6(1),6461.
8. Xue,G.;Wang,K.;Zhou,D.;Zhong,H.;Pan,Z.,Light-InducedProteinDegradationwithPhotocagedPROTACs.JAmChemSoc2019,141(46),18370-18374.
9. Liu,Y.;Zou,R.S.;He,S.;Nihongaki,Y.;Li,X.;Razavi,S.;Wu,B.;Ha,T.,VeryfastCRISPRondemand.Science2020,368(6496),1265.
10.Gostl,R.;Senf,A.;Hecht,S.,Remote-controllingchemicalreactionsbylight:towardschemistrywithhighspatio-temporalresolution.ChemSocRev2014,43(6),1982-96.
11.Mafy,N.N.;Matsuo,K.;Hiruma,S.;Uehara,R.;Tamaoki,N.,PhotoswitchableCENP-EInhibitorEnablingtheDynamicControlofChromosomeMovementandMitoticProgression.JAmChemSoc2020,142(4),1763-1767.
12.Meldrum,R.A.;Shall,S.;Wharton,C.W.,KineticsandmechanismofDNArepair.Evaluationofcagedcompoundsforuseinstudiesofu.v.-inducedDNArepair.BiochemJ1990,266(3),891-5.
13.Liu,Q.;Deiters,A.,Optochemicalcontrolofdeoxyoligonucleotidefunctionviaanucleobase-cagingapproach.AccChemRes2014,47(1),45-55.
14.Measey,T.J.;Gai,F.,Light-triggereddisassemblyofamyloidfibrils.Langmuir2012,28(34),12588-92.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
30
15.Salveson,P.J.;Haerianardakani,S.;Thuy-Boun,A.;Kreutzer,A.G.;Nowick,J.S.,ControllingtheOligomerizationStateofAbeta-DerivedPeptideswithLight.JAmChemSoc2018,140(17),5842-5852.
16.Courtney,T.M.;Deiters,A.,Opticalcontrolofproteinphosphatasefunction.NatCommun2019,10(1),4384.
17.Grotenbreg,G.M.;Roan,N.R.;Guillen,E.;Meijers,R.;Wang,J.H.;Bell,G.W.;Starnbach,M.N.;Ploegh,H.L.,DiscoveryofCD8+TcellepitopesinChlamydiatrachomatisinfectionthroughuseofcagedclassIMHCtetramers.ProcNatlAcadSciUSA2008,105(10),3831-6.
18.Hemphill,J.;Borchardt,E.K.;Brown,K.;Asokan,A.;Deiters,A.,OpticalControlofCRISPR/Cas9GeneEditing.JAmChemSoc2015,137(17),5642-5.
19.Hemphill,J.;Chou,C.;Chin,J.W.;Deiters,A.,Geneticallyencodedlight-activatedtranscriptionforspatiotemporalcontrolofgeneexpressionandgenesilencinginmammaliancells.JAmChemSoc2013,135(36),13433-9.
20.Lusic,H.;Young,D.D.;Lively,M.O.;Deiters,A.,PhotochemicalDNAactivation.OrgLett2007,9(10),1903-6.
21.Deiters,A.;Lusic,H.,ANewPhotocagingGroupforAromaticN-Heterocycles.Synthesis2006,2006(13),2147-2150.
22.Givens,R.S.;Lee,J.-I.,Thep-hydroxyphenacylphotoremovableprotectinggroup.JournalofPhotoscience2003,10(1),37-48.
23.Luo,J.;Torres-Kolbus,J.;Liu,J.;Deiters,A.,GeneticEncodingofPhotocagedTyrosineswithImprovedLight-ActivationPropertiesfortheOpticalControlofProteaseFunction.Chembiochem2017,18(14),1442-1447.
24.Stroppel,A.S.;Paolillo,M.;Ziegler,T.;Feil,R.;Stafforst,T.,Npom-ProtectedNONOateEnablesLight-TriggeredNO/cGMPSignallinginPrimaryVascularSmoothMuscleCells.Chembiochem2018,19(12),1312-1318.
25.Hanswillemenke,A.;Kuzdere,T.;Vogel,P.;Jekely,G.;Stafforst,T.,Site-DirectedRNAEditinginVivoCanBeTriggeredbytheLight-DrivenAssemblyofanArtificialRiboprotein.JAmChemSoc2015,137(50),15875-81.
26.Hemphill,J.;Liu,Q.;Uprety,R.;Samanta,S.;Tsang,M.;Juliano,R.L.;Deiters,A.,Conditionalcontrolofalternativesplicingthroughlight-triggeredsplice-switchingoligonucleotides.JAmChemSoc2015,137(10),3656-62.
27.Berroy,P.;Viriot,M.L.;Carré,M.C.,Photolabilegroupfor5′-OHprotectionofnucleosides:synthesisandphotodeprotectionrate.SensorsandActuatorsB:Chemical2001,74(1-3),186-189.
28.Young,D.D.;Deiters,A.,Photochemicalhammerheadribozymeactivation.BioorgMedChemLett2006,16(10),2658-61.
29.Young,D.D.;Lively,M.O.;Deiters,A.,ActivationanddeactivationofDNAzymeandantisensefunctionwithlightforthephotochemicalregulationofgeneexpressioninmammaliancells.JAmChemSoc2010,132(17),6183-93.
30.Deiters,A.;Garner,R.A.;Lusic,H.;Govan,J.M.;Dush,M.;Nascone-Yoder,N.M.;Yoder,J.A.,PhotocagedMorpholinoOligomersfortheLight-RegulationofGeneFunctioninZebrafishandXenopusEmbryos.JournaloftheAmericanChemicalSociety2010,132(44),15644-15650.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
31
31.Young,D.D.;Govan,J.M.;Lively,M.O.;Deiters,A.,PhotochemicalRegulationofRestrictionEndonucleaseActivity.ChemBioChem2009,10(10),1612-1616.
32.Govan,J.M.;Uprety,R.;Hemphill,J.;Lively,M.O.;Deiters,A.,Regulationoftranscriptionthroughlight-activationandlight-deactivationoftriplex-formingoligonucleotidesinmammaliancells.ACSChemBiol2012,7(7),1247-56.
33.Young,D.D.;Edwards,W.F.;Lusic,H.;Lively,M.O.;Deiters,A.,Light-triggeredpolymerasechainreaction.ChemCommun(Camb)2008,(4),462-4.
34.Moroz-Omori,E.V.;Satyapertiwi,D.;Ramel,M.-C.;Høgset,H.;Sunyovszki,I.K.;Liu,Z.;Wojciechowski,J.P.;Zhang,Y.;Grigsby,C.L.;Brito,L.;Bugeon,L.;Dallman,M.J.;Stevens,M.M.,PhotoswitchablegRNAsforSpatiotemporallyControlledCRISPR-Cas-BasedGenomicRegulation.ACSCentralScience2020,6(5),695-703.
35.Zhou,W.;Brown,W.;Bardhan,A.;Delaney,M.;Ilk,A.S.;Rauen,R.R.;Kahn,S.I.;Tsang,M.;Deiters,A.,SpatiotemporalControlofCRISPR/Cas9FunctioninCellsandZebrafishusingLight-ActivatedGuideRNA.AngewChemIntEdEngl2020,59(23),8998-9003.
36.Gillet,L.C.;Scharer,O.D.,Molecularmechanismsofmammalianglobalgenomenucleotideexcisionrepair.Chem.Rev.2006,106(2),253-76.
37.Marteijn,J.A.;Lans,H.;Vermeulen,W.;Hoeijmakers,J.H.,Understandingnucleotideexcisionrepairanditsrolesincancerandageing.NatRevMolCellBiol2014,15(7),465-81.
38.Puumalainen,M.R.;Ruthemann,P.;Min,J.H.;Naegeli,H.,XerodermapigmentosumgroupCsensor:unprecedentedrecognitionstrategyandtightspatiotemporalregulation.Cell.Mol.LifeSci.2016,73(3),547-66.
39.Kraemer,K.H.;Patronas,N.J.;Schiffmann,R.;Brooks,B.P.;Tamura,D.;DiGiovanna,J.J.,Xerodermapigmentosum,trichothiodystrophyandCockaynesyndrome:acomplexgenotype-phenotyperelationship.Neuroscience2007,145(4),1388-96.
40.Paul,D.;Mu,H.;Zhao,H.;Ouerfelli,O.;Jeffrey,P.D.;Broyde,S.;Min,J.H.,Structureandmechanismofpyrimidine-pyrimidone(6-4)photoproductrecognitionbytheRad4/XPCnucleotideexcisionrepaircomplex.NucleicAcidsRes2019,47(12),6015-6028.
41.Min,J.H.;Pavletich,N.P.,RecognitionofDNAdamagebytheRad4nucleotideexcisionrepairprotein.Nature2007,449(7162),570-5.
42.Lee,S.;Radom,C.T.;Verdine,G.L.,Trappingandstructuralelucidationofaveryadvancedintermediateinthelesion-extrusionpathwayofhOGG1.JournaloftheAmericanChemicalSociety2008,130(25),7784-7785.
43.Chakraborty,S.;Steinbach,P.J.;Paul,D.;Mu,H.;Broyde,S.;Min,J.H.;Ansari,A.,EnhancedspontaneousDNAtwisting/bendingfluctuationsunveiledbyfluorescencelifetimedistributionspromotemismatchrecognitionbytheRad4nucleotideexcisionrepaircomplex.NucleicAcidsRes2018,46(3),1240-1255.
44.Borjesson,K.;Preus,S.;El-Sagheer,A.H.;Brown,T.;Albinsson,B.;Wilhelmsson,L.M.,NucleicacidbaseanalogFRET-pairfacilitatingdetailedstructuralmeasurementsinnucleicacidcontainingsystems.JAmChemSoc2009,131(12),4288-93.
45.Preus,S.;Borjesson,K.;Kilsa,K.;Albinsson,B.;Wilhelmsson,L.M.,CharacterizationofnucleobaseanalogueFRETacceptortCnitro.JPhysChemB2010,114(2),1050-6.
46.Dumat,B.;Larsen,A.F.;Wilhelmsson,L.M.,StudyingZ-DNAandB-toZ-DNAtransitionsusingacytosineanalogueFRET-pair.NucleicAcidsRes2016,44(11),e101.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
32
47.Chen,X.;Velmurugu,Y.;Zheng,G.;Park,B.;Shim,Y.;Kim,Y.;Liu,L.;VanHouten,B.;He,C.;Ansari,A.;Min,J.H.,KineticgatingmechanismofDNAdamagerecognitionbyRad4/XPC.NatCommun2015,6,5849.
48.Cuellar,R.E.;Ford,G.A.;Briggs,W.R.;Thompson,W.F.,Applicationofhigherderivativetechniquestoanalysisofhigh-resolutionthermaldenaturationprofilesofreassociatedrepetitiveDNA.ProcNatlAcadSciUSA1978,75(12),6026-30.
49.Palais,R.;Wittwer,C.T.,Chapter13MathematicalAlgorithmsforHigh-ResolutionDNAMeltingAnalysis.InComputerMethods,PartA,AcademicPress:2009;Vol.454,pp323-343.
50.Velmurugu,Y.;Chen,X.;SlogoffSevilla,P.;Min,J.H.;Ansari,A.,Twist-openmechanismofDNAdamagerecognitionbytheRad4/XPCnucleotideexcisionrepaircomplex.ProcNatlAcadSciUSA2016,113(16),E2296-305.
51.Livesey,A.K.;Brochon,J.C.,Analyzingthedistributionofdecayconstantsinpulse-fluorimetryusingthemaximumentropymethod.BiophysJ1987,52(5),693-706.
52.Steinbach,P.J.,Filteringartifactsfromlifetimedistributionswhenmaximizingentropyusingabootstrappedmodel.AnalBiochem2012,427(1),102-5.
53.Steinbach,P.J.;Ionescu,R.;Matthews,C.R.,AnalysisofKineticsUsingaHybridMaximum-Entropy/Nonlinear-Least-SquaresMethod:ApplicationtoProteinFolding.BiophysicalJournal2002,82(4),2244-2255.
54.Frisch,M.J.;Trucks,G.W.;Schlegel,H.B.;Scuseria,G.E.;Robb,M.A.;Cheeseman,J.R.;Scalmani,G.;Barone,V.;Petersson,G.A.;Nakatsuji,H.;Li,X.;Caricato,M.;Marenich,A.;Bloino,J.;Janesko,B.G.;Gomperts,R.;Mennucci,B.;Hratchian,H.P.;Ortiz,J.V.;Izmaylov,A.F.;Sonnenberg,J.L.;Williams-Young,D.;Ding,F.;Lipparini,F.;Egidi,F.;Goings,J.;Peng,B.;Petrone,A.;Henderson,T.;Ranasinghe,D.;Zakrzewski,V.G.;Gao,J.;Rega,N.;Zheng,G.;Liang,W.;Hada,M.;Ehara,M.;Toyota,K.;Fukuda,R.;Hasegawa,J.;Ishida,M.;Nakajima,T.;Honda,Y.;Kitao,O.;Nakai,H.;Vreven,T.;Throssell,K.;Montgomery,J.A.J.;Peralta,J.E.;Ogliaro,F.;Bearpark,M.;Heyd,J.J.;Brothers,E.;Kudin,K.N.;Staroverov,V.N.;Keith,T.;Kobayashi,R.;Normand,J.;Raghavachari,K.;Rendell,A.;Burant,J.C.;Iyengar,S.S.;Tomasi,J.;Cossi,M.;Millam,J.M.;Klene,M.;Adamo,C.;Cammi,R.;Ochterski,J.W.;Martin,R.L.;Morokuma,K.;Farkas,O.;Foresman,J.B.;Fox,D.J.Gaussian09RevisionE.01,GaussianInc.:WallingfordCT,2016.
55.Case,D.A.;Ben-Shalom,I.Y.;Beozell,S.R.;Cerutti,D.S.;Cheatham,I.,T.E.,;Cruzeiro,V.W.D.;Darden,T.A.;Duke,R.E.;Ghoreishi,D.;Gilson,M.K.;Gohlke,H.;Goetz,A.W.;Greene,D.;Harris,R.;Homeyer,N.;Huang,Y.;Izadi,S.;Kovalenko,A.;Kurtzman,T.;Lee,T.S.;LeGrand,S.;Li,P.;Lin,C.;Liu,J.;Luchko,T.;Luo,R.;Mermelstein,D.J.;Merz,K.M.;Miao,Y.;Monard,G.;Nguyen,C.;Nguyen,H.;Omelyan,I.;Onufriev,A.;Pan,F.;Qi,R.;Roe,D.R.;Roitberg,A.;Sagui,C.;Schott-Verdugo,S.;Shen,J.;Simmerling,C.L.;Smith,J.;Salomon-Ferrer,R.;Swails,J.;Walker,R.C.;Wang,J.;Wei,H.;Wolf,R.M.;Wu,X.;Xiao,L.;York,D.M.AMBER2018,UniversityofCalifornia,SanFrancisco:CA,2018.
56.McGall,G.H.;Barone,A.D.;Diggelmann,M.;Fodor,S.P.A.;Gentalen,E.;Ngo,N.,TheEfficiencyofLight-DirectedSynthesisofDNAArraysonGlassSubstrates.JournaloftheAmericanChemicalSociety1997,119(22),5081-5090.
57.Liu,M.;Jiang,S.;Loza,O.;Fahmi,N.E.;Sulc,P.;Stephanopoulos,N.,RapidPhotoactuationofaDNANanostructureusinganInternalPhotocagedTriggerStrand.AngewChemIntEdEngl2018,57(30),9341-9345.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
33
58.Scharer,O.D.,Nucleotideexcisionrepairineukaryotes.ColdSpringHarbPerspectBiol2013,5(10),a012609.
59.Shi,Y.;Dierckx,A.;Wanrooij,P.H.;Wanrooij,S.;Larsson,N.G.;Wilhelmsson,L.M.;Falkenberg,M.;Gustafsson,C.M.,MammaliantranscriptionfactorAisacorecomponentofthemitochondrialtranscriptionmachinery.ProcNatlAcadSciUSA2012,109(41),16510-5.
60.Xia,S.;Wood,M.;Bradley,M.J.;DeLaCruz,E.M.;Konigsberg,W.H.,AlterationinthecavitysizeadjacenttotheactivesiteofRB69DNApolymerasechangesitsconformationaldynamics.NucleicAcidsRes2013,41(19),9077-89.
61.Posse,V.;Hoberg,E.;Dierckx,A.;Shahzad,S.;Koolmeister,C.;Larsson,N.G.;Wilhelmsson,L.M.;Hallberg,B.M.;Gustafsson,C.M.,TheaminoterminalextensionofmammalianmitochondrialRNApolymeraseensurespromoterspecifictranscriptioninitiation.NucleicAcidsRes2014,42(6),3638-47.
62.Klostermeier,D.;Millar,D.P.,Time-resolvedfluorescenceresonanceenergytransfer:aversatiletoolfortheanalysisofnucleicacids.Biopolymers2001,61(3),159-79.
63.Sandin,P.;Borjesson,K.;Li,H.;Martensson,J.;Brown,T.;Wilhelmsson,L.M.;Albinsson,B.,Characterizationanduseofanunprecedentedlybrightandstructurallynon-perturbingfluorescentDNAbaseanalogue.NucleicAcidsRes2008,36(1),157-67.
64.Preus,S.;Kilsa,K.;Miannay,F.A.;Albinsson,B.;Wilhelmsson,L.M.,FRETmatrix:ageneralmethodologyforthesimulationandanalysisofFRETinnucleicacids.NucleicAcidsRes2013,41(1),e18.
65.Dussy,A.;Meyer,C.;Quennet,E.;Bickle,T.A.;Giese,B.;Marx,A.,Newlight-sensitivenucleosidesforcagedDNAstrandbreaks.Chembiochem2002,3(1),54-60.
66.Ordoukhanian,P.;Taylor,J.S.,Cagedsingleanddoublestrandbreaks.BioconjugChem2000,11(1),94-103.
67.Zhang,K.;Taylor,J.S.,PhototriggeredformationandrepairofDNAcontainingasite-specificsinglestrandbreakofthetypeproducedbyionizingradiationorAPlyaseactivity.Biochemistry2001,40(1),153-9.
68.Seio,K.;Ohno,Y.;Ohno,K.;Takeshita,L.;Kanamori,T.;Masaki,Y.;Sekine,M.,Photo-controlledbindingofMutStophoto-cagedDNAduplexesincorporating4-O-(2-nitrobenzyl)or4-O-[2-(2-nitrophenyl)propyl]thymidine.BioorgMedChemLett2016,26(19),4861-4863.
69.Jain,S.C.;Sobell,H.M.,Visualizationofdrug-nucleicacidinteractionsatatomicresolution.VIII.Structuresoftwoethidium/dinucleosidemonophosphatecrystallinecomplexescontainingethidium:cytidylyl(3'-5')guanosine.JBiomolStructDyn1984,1(5),1179-94.
70.Dikic,J.;Seidel,R.,AnticooperativeBindingGovernstheMechanicsofEthidium-ComplexedDNA.BiophysJ2019,116(8),1394-1405.
71.Mu,H.;Zhang,Y.;Geacintov,N.E.;Broyde,S.,LesionSensingduringInitialBindingbyYeastXPC/Rad4:TowardPredictingResistancetoNucleotideExcisionRepair.ChemResToxicol2018,31(11),1260-1268.
72.Mu,H.;Geacintov,N.E.;Min,J.H.;Zhang,Y.;Broyde,S.,NucleotideExcisionRepairLesion-RecognitionProteinRad4CapturesaPre-FlippedPartnerBaseinaBenzo[a]pyrene-DerivedDNALesion:HowStructureImpactstheBindingPathway.ChemResToxicol2017,30(6),1344-1354.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint
34
73.Yeo,J.E.;Khoo,A.;Fagbemi,A.F.;Scharer,O.D.,Theefficienciesofdamagerecognitionandexcisioncorrelatewithduplexdestabilizationinducedbyacetylaminofluoreneadductsinhumannucleotideexcisionrepair.ChemResToxicol2012,25(11),2462-8.
74.Jain,V.;Hilton,B.;Patnaik,S.;Zou,Y.;Chiarelli,M.P.;Cho,B.P.,Conformationalandthermodynamicpropertiesmodulatethenucleotideexcisionrepairof2-aminofluoreneand2-acetylaminofluorenedGadductsintheNarIsequence.NucleicAcidsRes2012,40(9),3939-51.
75.Jain,V.;Vaidyanathan,V.G.;Patnaik,S.;Gopal,S.;Cho,B.P.,Conformationalinsightsintothelesionandsequenceeffectsforarylamine-inducedtranslesionDNAsynthesis:19FNMR,surfaceplasmonresonance,andprimerkineticstudies.Biochemistry2014,53(24),4059-71.
76.Stavros,K.M.;Hawkins,E.K.;Rizzo,C.J.;Stone,M.P.,Base-displacedintercalationofthe2-amino-3-methylimidazo[4,5-f]quinoloneN2-dGadductintheNarIDNArecognitionsequence.NucleicAcidsRes2014,42(5),3450-63.
77.Wang,F.;Elmquist,C.E.;Stover,J.S.;Rizzo,C.J.;Stone,M.P.,DNAsequencemodulatestheconformationofthefoodmutagen2-amino-3-methylimidazo[4,5-f]quinolineintherecognitionsequenceoftheNarIrestrictionenzyme.Biochemistry2007,46(29),8498-516.
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted September 29, 2020. ; https://doi.org/10.1101/2020.09.28.313114doi: bioRxiv preprint