![Page 1: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/1.jpg)
Processes of Evolution
Chapter 8 part 2
![Page 2: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/2.jpg)
![Page 3: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/3.jpg)
Fig. 18-5a, p. 282
![Page 4: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/4.jpg)
Fig. 18-5b, p. 282
![Page 5: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/5.jpg)
Fig. 18-5c, p. 282
![Page 6: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/6.jpg)
Predation and Peppered Moths
![Page 7: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/7.jpg)
Predation and Rock-Pocket Mice
In rock-pocket mice, two alleles of a single gene control coat color
Night-flying owls are the selective pressure that directionally shifts the allele frequency
![Page 8: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/8.jpg)
![Page 9: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/9.jpg)
Time 2
Time 3Fig. 18-8, p. 284
Stepped Art
Stabilizing Selection
Range of values for the trait
Nu
mb
er o
f in
div
idu
als
in p
op
ula
tio
n
Time 1
![Page 10: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/10.jpg)
Fig. 18-10a, p. 285
![Page 11: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/11.jpg)
Fig. 18-10b, p. 285
![Page 12: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/12.jpg)
Fig. 18-10c, p. 285
![Page 13: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/13.jpg)
![Page 14: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/14.jpg)
![Page 15: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/15.jpg)
Evidence of Evolution
Biogeography Fossils/geology Anatomy• Homologous structures• Analogous structures• embryos• Vestigial structures
Molecular biology Field and lab studies
![Page 16: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/16.jpg)
Patterns in Biogeography
![Page 17: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/17.jpg)
Geography
evolution.berkeley.edu/evosite/lines/IVCexperiments.shtmlen.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg
Marsupials
![Page 18: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/18.jpg)
![Page 19: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/19.jpg)
Fig. 17-17, p. 273
A 420 mya B 237 mya C 152 mya D 65.5 mya E 14 mya
![Page 20: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/20.jpg)
About Fossils
Fossils are remnants or traces of organisms that lived in the past
give us clues about evolutionary relationships
The fossil record will always be incomplete
![Page 21: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/21.jpg)
Fossils
Fossils• Remains of bones,
teeth, shells, seeds, spores, or other body parts
Trace fossils• Evidence of an
organism’s activities (nests, trails, footprints, burrows, bore holes, eggshells, feces)
![Page 22: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/22.jpg)
Fossils
![Page 23: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/23.jpg)
Transitional fossils
Archaeopteryx
• Many fossils show a clear transition from one species, or group, to another.
•
http://chem.tufts.edu/science/evolution/horseevolution.htmhttp://www.talkorigins.org/faqs/faq-transitional/part2a.html http://evolution.berkeley.edu/evolibrary/article/lines_03http://evolution.berkeley.edu/evolibrary/home.php
![Page 24: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/24.jpg)
![Page 25: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/25.jpg)
![Page 26: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/26.jpg)
A Whale of a Story
New fossil discoveries are continually filling the gaps in our understanding of the ancient history of many lineages
![Page 27: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/27.jpg)
New Links in the Ancient Lineage of Whales
![Page 28: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/28.jpg)
New Links in the Ancient Lineage of Whales
![Page 29: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/29.jpg)
Dating Pieces of the Puzzle
Radiometric dating• Ex: uranium 238 →
lead 206 Half-life• time it takes for half of
a radioisotope’s atoms to decay into a daughter element
![Page 30: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/30.jpg)
Fig. 17-14a, p. 270
![Page 31: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/31.jpg)
Fig. 17-14b, p. 271
![Page 32: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/32.jpg)
Anatomy- comparative morphology
Homologous structures• Similar body parts that
reflect shared ancestry
• The same genes direct their development
![Page 33: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/33.jpg)
![Page 34: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/34.jpg)
![Page 35: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/35.jpg)
Analogous structures• Body parts that evolved independently in
separate lineages in response to the same environmental pressure
![Page 36: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/36.jpg)
Vestigial Structures
As evolution progresses, some structures get side-lined as they are not longer of use.
Fig. 17-3, p. 261
coccyxlimb bud
![Page 37: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/37.jpg)
Anatomy-embryos
Embryos of many vertebrate species develop in similar ways
![Page 38: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/38.jpg)
Molecular Evidence
DNA for Information
Transfer
ATP for Energy Transfer
![Page 39: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/39.jpg)
Comparing Cytochrome b Sequences
![Page 40: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/40.jpg)
Similar Genes
HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGACHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGAGORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans
![Page 41: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/41.jpg)
Field/Lab Evidence-Antibiotic resistance
Staphylococcus
![Page 42: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/42.jpg)
![Page 43: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/43.jpg)
Reproductive Isolation
Speciation• Evolutionary process by which new species form
Biological species concept- species are populations of organisms that interbreed under natural conditions
![Page 44: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/44.jpg)
![Page 45: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/45.jpg)
![Page 46: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/46.jpg)
![Page 47: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/47.jpg)
![Page 48: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/48.jpg)
Allopatric Speciation
![Page 49: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/49.jpg)
Fig. 18-21a, p. 293
B Later, a few individuals of a new species colonize nearby island 2. Speciation follows genetic divergence in the new habitat.
C Genetically different descendants of the ancestral species may colonize islands 3 and 4 or even invade island 1. Genetic divergence and speciation may follow.
A A few individuals of a mainland species reach isolated island 1. In the new habitat, populations of their descendants diverge, and speciation occurs.
The Inviting Archipelagos
![Page 50: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/50.jpg)
Fig. 18-21b, p. 293
Insects, spiders from buds twisted apart by bill, some nectar; high mountain rain forest
Akekee (L. caeruleirostris) Insects, spiders, some nectar; high mountain rain forest
Nihoa finch (Telespiza
ultima) Insects, buds, seeds, flowers, seabird eggs; rocky or shrubby slopes
Mamane seeds ripped from pods; buds, flowers, some berries, insects; high mountain dry forests
Maui parrotbill (Pseudonestor xanthophrys)
Rips dry branches for insect larvae, pupae, caterpillars; mountain forest with open canopy, dense underbrush
Apapane (Himatione sanguinea)
Nectar, especially of ohialehua flowers; caterpillars and other insects; spiders; high mountain forests
Akepa (Loxops
coccineus)
Palila(Loxioides bailleui)
![Page 51: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/51.jpg)
Fig. 18-21c, p. 293
Tree snails, insects in understory; last known male died in 2004
Bark or leaf insects, some nectar; high mountain rain forest
Kauai Amakihi (Hemignathus kauaiensis) Bark-picker; insects, spiders, nectar; high mountain rain forest
Akiapolaau (Hemignathus
munroi)
Akohekohe (Palmeria dolei)
Iiwi (Vestiaria coccinea)
Probes, digs insects from big trees; high mountain rain forest
Mostly nectar from flowering trees, some insects, pollen; high mountain rain forest
Mostly nectar (ohia flowers, lobelias, mints), some insects; high mountain rain forest
Maui Alauahio (Paroreomyza
montana)
Poouli (Melamprosops phaeosoma)
![Page 52: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/52.jpg)
![Page 53: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/53.jpg)
![Page 54: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/54.jpg)
![Page 55: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/55.jpg)
![Page 56: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/56.jpg)
![Page 57: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/57.jpg)
![Page 58: Processes of Evolution Chapter 8 part 2. Fig. 18-5a, p. 282](https://reader038.vdocument.in/reader038/viewer/2022110101/56649e895503460f94b8dc89/html5/thumbnails/58.jpg)
Extinction• The irrevocable loss of a species from Earth
Background extinctions- extinctions that occur at lower rates during periods periods other than mass extinctions
Mass extinctions• Extinctions of many lineages, followed by adaptive
radiations• Five catastrophic events in which the majority of
species on Earth disappeared