Processes of Evolution

Chapter 8 part 2

Fig. 18-5a, p. 282

Fig. 18-5b, p. 282

Fig. 18-5c, p. 282

Predation and Peppered Moths

Predation and Rock-Pocket Mice

In rock-pocket mice, two alleles of a single gene control coat color

Night-flying owls are the selective pressure that directionally shifts the allele frequency

Time 2

Time 3Fig. 18-8, p. 284

Stepped Art

Stabilizing Selection

Range of values for the trait

Nu

mb

er o

f in

div

idu

als

in p

op

ula

tio

n

Time 1

Fig. 18-10a, p. 285

Fig. 18-10b, p. 285

Fig. 18-10c, p. 285

Evidence of Evolution

Biogeography Fossils/geology Anatomy• Homologous structures• Analogous structures• embryos• Vestigial structures

Molecular biology Field and lab studies

Patterns in Biogeography

Geography

evolution.berkeley.edu/evosite/lines/IVCexperiments.shtmlen.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg

Marsupials

Fig. 17-17, p. 273

A 420 mya B 237 mya C 152 mya D 65.5 mya E 14 mya

About Fossils

Fossils are remnants or traces of organisms that lived in the past

give us clues about evolutionary relationships

The fossil record will always be incomplete

Fossils

Fossils• Remains of bones,

teeth, shells, seeds, spores, or other body parts

Trace fossils• Evidence of an

organism’s activities (nests, trails, footprints, burrows, bore holes, eggshells, feces)

Fossils

Transitional fossils

Archaeopteryx

• Many fossils show a clear transition from one species, or group, to another.

•

http://chem.tufts.edu/science/evolution/horseevolution.htmhttp://www.talkorigins.org/faqs/faq-transitional/part2a.html http://evolution.berkeley.edu/evolibrary/article/lines_03http://evolution.berkeley.edu/evolibrary/home.php

A Whale of a Story

New fossil discoveries are continually filling the gaps in our understanding of the ancient history of many lineages

New Links in the Ancient Lineage of Whales

New Links in the Ancient Lineage of Whales

Dating Pieces of the Puzzle

Radiometric dating• Ex: uranium 238 →

lead 206 Half-life• time it takes for half of

a radioisotope’s atoms to decay into a daughter element

Fig. 17-14a, p. 270

Fig. 17-14b, p. 271

Anatomy- comparative morphology

Homologous structures• Similar body parts that

reflect shared ancestry

• The same genes direct their development

Analogous structures• Body parts that evolved independently in

separate lineages in response to the same environmental pressure

Vestigial Structures

As evolution progresses, some structures get side-lined as they are not longer of use.

Fig. 17-3, p. 261

coccyxlimb bud

Anatomy-embryos

Embryos of many vertebrate species develop in similar ways

Molecular Evidence

DNA for Information

Transfer

ATP for Energy Transfer

Comparing Cytochrome b Sequences

Similar Genes

HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGACHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGAGORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans

Field/Lab Evidence-Antibiotic resistance

Staphylococcus

Reproductive Isolation

Speciation• Evolutionary process by which new species form

Biological species concept- species are populations of organisms that interbreed under natural conditions

Allopatric Speciation

Fig. 18-21a, p. 293

B Later, a few individuals of a new species colonize nearby island 2. Speciation follows genetic divergence in the new habitat.

C Genetically different descendants of the ancestral species may colonize islands 3 and 4 or even invade island 1. Genetic divergence and speciation may follow.

A A few individuals of a mainland species reach isolated island 1. In the new habitat, populations of their descendants diverge, and speciation occurs.

The Inviting Archipelagos

Fig. 18-21b, p. 293

Insects, spiders from buds twisted apart by bill, some nectar; high mountain rain forest

Akekee (L. caeruleirostris) Insects, spiders, some nectar; high mountain rain forest

Nihoa finch (Telespiza

ultima) Insects, buds, seeds, flowers, seabird eggs; rocky or shrubby slopes

Mamane seeds ripped from pods; buds, flowers, some berries, insects; high mountain dry forests

Maui parrotbill (Pseudonestor xanthophrys)

Rips dry branches for insect larvae, pupae, caterpillars; mountain forest with open canopy, dense underbrush

Apapane (Himatione sanguinea)

Nectar, especially of ohialehua flowers; caterpillars and other insects; spiders; high mountain forests

Akepa (Loxops

coccineus)

Palila(Loxioides bailleui)

Fig. 18-21c, p. 293

Tree snails, insects in understory; last known male died in 2004

Bark or leaf insects, some nectar; high mountain rain forest

Kauai Amakihi (Hemignathus kauaiensis) Bark-picker; insects, spiders, nectar; high mountain rain forest

Akiapolaau (Hemignathus

munroi)

Akohekohe (Palmeria dolei)

Iiwi (Vestiaria coccinea)

Probes, digs insects from big trees; high mountain rain forest

Mostly nectar from flowering trees, some insects, pollen; high mountain rain forest

Mostly nectar (ohia flowers, lobelias, mints), some insects; high mountain rain forest

Maui Alauahio (Paroreomyza

montana)

Poouli (Melamprosops phaeosoma)

Extinction• The irrevocable loss of a species from Earth

Background extinctions- extinctions that occur at lower rates during periods periods other than mass extinctions

Mass extinctions• Extinctions of many lineages, followed by adaptive

radiations• Five catastrophic events in which the majority of

species on Earth disappeared