Expression of proliferative and in!ammatory markers in a full-thickness human skinequivalent following exposure to the model sulfur mustard vesicant, 2-chloroethylethyl sul"de

Adrienne T. Black a, Patrick J. Hayden b, Robert P. Casillas c, Diane E. Heck d, Donald R. Gerecke a,Patrick J. Sinko e, Debra L. Laskin a, Jeffrey D. Laskin f,!a Pharmacology and Toxicology, Rutgers University, Piscataway, NJ, USAb MatTek Corporation, Ashland, MA, USAc Battelle Memorial Institute, Columbus, OH, USAd Environmental Health Sciences, New York Medical College, Valhalla, NY, USAe Pharmaceutics, Rutgers University, Piscataway, NJ, USAf Environmental and Occupational Medicine, UMDNJ-Robert Wood Johnson Medical School, Piscataway, NJ, USA

a b s t r a c ta r t i c l e i n f o

Article history:Received 8 July 2010Revised 31 August 2010Accepted 3 September 2010Available online 16 September 2010

Keywords:VesicantSulfur mustardEicosanoidsApoptosisSkin

Sulfur mustard is a potent vesicant that induces in!ammation, edema and blistering following dermalexposure. To assess molecular mechanisms mediating these responses, we analyzed the effects of the modelsulfur mustard vesicant, 2-chloroethyl ethyl sul"de, on EpiDerm-FT™, a commercially available full-thicknesshuman skin equivalent. CEES (100–1000 !M) caused a concentration-dependent increase in pyknotic nucleiand vacuolization in basal keratinocytes; at high concentrations (300–1000 !M), CEES also disrupted keratin"lament architecture in the stratum corneum. This was associated with time-dependent increases inexpression of proliferating cell nuclear antigen, a marker of cell proliferation, and poly(ADP-ribose)polymerase (PARP) and phosphorylated histone H2AX, markers of DNA damage. Concentration- and time-dependent increases in mRNA and protein expression of eicosanoid biosynthetic enzymes including COX-2, 5-lipoxygenase, microsomal PGE2 synthases, leukotriene (LT) A4 hydrolase and LTC4 synthase were observed inCEES-treated skin equivalents, as well as in antioxidant enzymes, glutathione S-transferases A1-2 (GSTA1-2),GSTA3 and GSTA4. These data demonstrate that CEES induces rapid cellular damage, cytotoxicity andin!ammation in full-thickness skin equivalents. These effects are similar to human responses to vesicants invivo and suggest that the full thickness skin equivalent is a useful in vitro model to characterize the biologicaleffects of mustards and to develop potential therapeutics.

© 2010 Elsevier Inc. All rights reserved.

Introduction

Sulfur mustard is a potent skin vesicant known to cause oxida-tive stress, in!ammation, blistering and persistent tissue damage(Papirmeister et al., 1991; Shakarjian et al., 2009). As a bifunctionalalkylating agent, sulfur mustard modi"es many tissue componentsincluding lipids, proteins and nucleic acids, forming monofunctionaladducts and intermolecular cross-links (Debouzy et al., 2002; van der

Schans et al., 2002; Mol et al., 2008). Basal keratinocytes appear to beparticularly sensitive to sulfur mustard and the blistering processinvolves apoptosis and necrosis, and detachment from the basementmembrane (Papirmeister et al., 1991). This is followed by woundhealing, a process by which surviving keratinocytes in adjacent areasmigrate into sites of tissue damage and regenerate the epidermallayers of the skin. A variety of factors regulate the response of the skinto sulfur mustard including dose and duration of exposure, persis-tence in the tissue, the generation of reactive metabolites, and theactivity of antioxidant defense and detoxi"cation pathways. Turnoverof damaged cells in the epidermis following sulfur mustard exposurecan also contribute to the wound healing response.

Most studies on the mechanism of action of sulfur mustard haveused animal models including mice, guinea pigs, pigs and rabbits(Dannenberg et al., 1985; Harada et al., 1987; Monteiro-Riviere andInman, 1997; Monteiro-Riviere et al., 1999; Babin et al., 2000; Reidet al., 2000; Dachir et al., 2002, 2004, 2010; Wormser et al., 2004a;Pal et al., 2009; Tewari-Singh et al., 2009). While these models

Toxicology and Applied Pharmacology 249 (2010) 178–187

Abbreviations: CEES, 2-chloroethyl ethyl sul"de; COX-2, cyclooxygenase-2; GST,glutathione S-transferase; LTA4, leukotriene A4; LTC4, leukotriene C4; 5-LOX, 5-lipoxygenase; FLAP, 5-LOX activating protein; phospho-H2AX, phosphorylated histoneH2AX; (PARP), poly(ADP-ribose) polymerase; PCNA, proliferating cell nuclear antigen;PGE2, prostaglandin E2; mPGES-1, microsomal PGE2 synthase-1; mPGES-2, microsomalPGE2 synthase-2; SOD, superoxide dismutase.! Corresponding author. Department of Environmental and Occupational Medicine,

UMDNJ-Robert Wood Johnson Medical School, 170 Frelinghuysen Road, Piscataway, NJ08854, USA. Fax: +1 732 445 0119.

E-mail address: jlaskin@eohsi.rutgers.edu (J.D. Laskin).

0041-008X/$ – see front matter © 2010 Elsevier Inc. All rights reserved.doi:10.1016/j.taap.2010.09.005

Contents lists available at ScienceDirect

Toxicology and Applied Pharmacology

j ourna l homepage: www.e lsev ie r.com/ locate /ytaap

recapitulate many of the actions of sulfur mustard in human skinincluding in!ammation, necrosis and wound repair, gross blistering, amajor response following human exposure is not observed (Smithet al., 1997a). This has limited the utility of animal models for thedevelopment of dermal pharmaco-therapeutics.

In vitro models have also been used to investigate the cytotoxicactions of sulfur mustard including human skin explants, isolatedhuman andmouse epidermal keratinocytes, and keratinocyte cell lines(Smith et al., 1990; Cowan et al., 2002; Lefkowitz and Smith, 2002;Dillman et al., 2003, 2004; Gross et al., 2006; Shakarjian et al., 2006;Simbulan-Rosenthal et al., 2006; Rebholz et al., 2008; Black et al., 2010;Tewari-Singh et al., 2010). Using these models, sulfur mustard-induced cell signaling pathways have been identi"ed, and DNA andantioxidantmodi"cations characterized (Dillman et al., 2004; Rebholzet al., 2008; Black et al., 2010). However, these systems are also limitedin their utility since they do not resemble differentiated keratinocytesin the skin.

Of recent interest is the development of in vitro human skinequivalents that more closely resemble human skin (Ponec et al., 2002;Hayden et al., 2003). These models, referred to as full-thickness skinequivalents, consist of primary human epidermal keratinocytes grown onmembrane supports in the absence and presence of a dermal substratumsuch as primary human"broblasts embedded in an arti"cial extracellularmatrix. Keratinocyteswithin these skin equivalents differentiate, formingdistinct basal, spinous and granular layers, as well as a stratum corneum,whenplaced at an air–liquid interface. In addition to expressing a numberof differentiationmarkers including involucrin, K1/K10 cytokeratins, andtype I epidermal transglutaminase, full-thickness skin equivalents alsoform a well de"ned basement membrane overlaying the dermalcomponent (Boelsma et al., 2000; Ponec et al., 2002). These modelshavealsobeen reported toexpressmanyof thegenesencodingxenobioticmetabolizingenzymes found inhumanskin, includingphase I andphase IIenzymes (Luu-The et al., 2009; Hu et al., 2010).

Full-thickness skin equivalents have been shown to be highlysensitive to exposure to sulfur mustard and the related vesicant, 2-chloroethyl ethyl sul"de (CEES), which readily induce microblisterformation and associated structural damage to basal keratinocytes(Blaha et al., 2000b, 2001; Hayden et al., 2009). CEES treatment alsoresults in the release of in!ammatory proteins including interleukin-1(IL-1) ", prostaglandin E2 and IL-1 receptor antagonist (Blaha et al.,2000b). In the present studies, we used a full-thickness skinequivalent to further characterize the effects of CEES on keratinocyteDNA damage and expression of antioxidants and enzymes thatgenerate in!ammatory mediators. Our data provide support for theuse of this human skin equivalent model for investigating mechan-isms of sulfur mustard-induced toxicity and developing effectivecountermeasures.

Materials and methods

Reagents. Rabbit polyclonal anti-poly(ADP-ribose) polymerase (PARP)antibody was purchased from Cell Signaling Technology (Beverly, MA),anti-proliferating cell nuclear antigen (PCNA) and anti-cyclooxygenase-2(COX-2) antibodies fromAbcam (Cambridge,MA), anti-5-lipooxygenase(5-LOX) antibody from Cayman Chemical (Ann Arbor, MI), and anti-phospho-histoneH2AXantibodies fromR&Dsystems (Minneapolis,MN)or Cell Signaling Technology (Beverly, MA). Rabbit polyclonal antibodiesto leukotriene A4 hydrolase (LTA4 hydrolase), goat polyclonal antibodiesto #-actin, and horseradish peroxidase-labeled donkey anti-goat sec-ondary antibodieswere from Santa Cruz Biotechnology (Santa Cruz, CA).Horseradish peroxidase-labeled goat anti-rabbit secondary antibodiesand detergent-compatible protein assay reagents were from Bio-RadLaboratories (Hercules, CA). Rabbit IgGwas from ProSci (Poway, CA) andthe Vectastain Rabbit Kit and the Peroxidase Substrate Kit DAB fromVector Labs (Burlingame, CA). Multiscribe Reverse Transcriptase wasfrom Promega Corporation (Madison, WI), the RNeasy puri"cation kit

from Qiagen (Minneapolis, MN), precast gradient polyacrylamide gelsfromPierce Biotechnology, Inc. (Rockford, IL), and theWestern LightningEnhanced Chemiluminescence (ECL) kit from Perkin Elmer Life Sciences,Inc. (Boston, MA). SYBR Green Master Mix and other PCR reagents werepurchased from Applied Biosystems (Foster City, CA). CEES, proteaseinhibitor cocktail, and all other chemicals were from Sigma-Aldrich(St. Louis, MO).

Treatment of skin equivalents. EpiDerm-FT™ full-thickness humanskin equivalents (EFT-400) and EFT-400-MM (medium supplementedwith growth factors, hormones and lipid precursors) were kindlyprovided by MatTek Corporation (Ashland, MA). The skin equivalentswere placed in 6-well plates in 2 ml of EFT-400-MM. After overnightincubation at 37 °C in a humidi"ed incubator, 1 ml of PBS containingvehicle control or CEES was added to the apical surface of the tissues.The cultures were then incubated at 37 °C. A stock CEES solution(100 mM)was prepared fresh in absolute ethanol immediately beforeuse and diluted to the appropriate concentrations in PBS. After 2 h, theskin equivalents were removed from the plates, washed in PBS,immediately placed in the same 6-well culture dishes and incubatedfor the indicated times. Analysis of the effects of CEES on EpiDerm-FT™was performed in four independent experiments.

Tissues were then harvested and stored at 4 °C in 3% paraformalde-hyde in PBS supplemented with 2% sucrose. For histological andimmunohistochemical analysis, tissues were removed from the sup-ports and transferred to 50% ethanol and then paraf"n embedded.Tissue sections (5 !m)were stained with hematoxylin and eosin (H&E)or Gomori One-Step Trichrome stain, followed by counterstaining withaniline blue (Goode Histolabs, New Brunswick, NJ). Specimens wereanalyzed by light microscopy using ProgRes Capture v2.5 software. Forimmunohistochemistry, tissue sections were deparaf"nized, blocked in5% or 100% serum at room temperature for 2 h, and then incubated for30 min at room temperature or overnight at 4 °Cwith rabbit IgG control,a 1:250 dilution of PCNA or PARP antibodies, 1:100 dilution of phospho-H2AX antibodies or a 1:400 dilution of COX-2 antibodies. The sectionswere then incubated for 30 min at room temperature. Binding wasvisualized using a Peroxidase Substrate Kit. In some experiments, theepidermiswas removed fromun"xed skin equivalents by gentle peelingand immediately used for either mRNA or protein analysis.

Western blotting. Epidermal sheets were lysed in buffer containing50 mM Tris–HCl pH 8.0, 150 mM NaCl and 1% Triton X-100supplemented with 5 !l protease inhibitor cocktail which consisted of4-(2-aminoethyl)benzenesulfonyl !uoride, aprotinin, bestatin hydro-chloride, N-(trans-epoxysuccinyl)-L-leucine 4-guanidinobutylamide,EDTA and leupeptin. Proteins (20 !g) from lysates were separated on10% or precast 4–20% gradient SDS-polyacrylamide gels and thentransferred to nitrocellulose membranes. After incubation in blockingbuffer (5% dry milk Tris-buffered saline containing 0.1% Tween 20) for1 h at room temperature, the membranes were incubated overnight at4 °C with primary antibodies (PCNA, 1:200 dilution; PARP, phospho-H2AX and COX-2, 1:1000 dilutions; 5-LOX, 1:7500 dilution; or LTA4

hydrolase, 1:1500 dilution) followed by horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. Proteinexpressionwas visualized using ECL reagents. Densitometric analysis ofWestern blots was performed using Adobe Photoshop CS2 (AdobeSystems Inc., San Jose, CA) and results are reported in arbitrary units.

Real-time polymerase chain reaction (PCR). For analysis of mRNA byRT-PCR, each point was analyzed in triplicate. RNAwas isolated from theepidermis using an RNeasy puri"cation kit following the manufacturer'sprotocol. RNA was converted to cDNA using a Multiscribe reversetranscriptase and diluted 1:10 in RNase–DNase-free water for PCRanalysis. For each gene to be tested, a standard curve composed of a serialdilution of pooled cDNA from the samples was used as a reference. Allvalues were normalized to GAPDH (n=3). The control was assigned a

179A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187

value of 1 and treated samples calculated relative to control. Real-timePCR was performed on an ABI Prism 7300 Sequence Detection Systemusing 96-well optical reaction plates. SYBR-Greenwas used for detectionof!uorescent signal and the standard curvemethodwas used for relativequanti"cation analysis. The primer sequences for the genes weregenerated using Primer Express software (Applied Biosystems) and theoligonucleotides synthesized by Integrated DNA Technologies, Inc.(Coralville, IA). The forward and reverse sequences (5"!3") were:COX-2, GCCTGATGATTGCCCGACT and GCTGGCCCTCGCTTATGATCT;FLAP, AAGTGGAGCACGAAAGCAGG and CGGTCCTCTGGAAGCTCCTC; GAPDH, TGGGCTACACTGAGCACCAG and GGGTGTCGCTGTTGAAGTCA; GSTA1–2, TTGATGTTCCAGCAAGTGCC and CACCAGCTTCATCCCATCAAT; GSTA3, TTCTGCCCTTATGTCGACCTG and TGATCAAGGCAATCTTGGCAT; GSTA4, GCTCCACTATCCCAACGGAA and AAAACCCATCTCACGGACTCC; 5-LOX, TCGAGTTCCCCTGCTACCG and TCAGGACAACCTCGACATCG;LTA4 hydrolase, TGAAGTTTACCCGGCCCTTA and GGATTTGTCAAAGGCAGCA; LTC4synthase, AGTACTTCCCGCTGTTCCTCG and GAAAGAAGATGCCGGCGAC;mPGES-1, CACCGGAACGACATGGAGACandGACGAAGCCCAGGAAAAGG; mPGES-2, GATGTACGTGGTGGCCATCA and CTCTTCTTCCGCAGCCTCAC; Cu,Zn-SOD, GTCGTAGTCTCCTGCAGCGTC and CTGGTTCCGAGGACTGCAA; and Mn-SOD, TCTGGACAAACCTCAGCCCT andGCAACTCCCCTTTGGGTTCT.

Statistical analysis. Data are expressed as mean±SEM. Statisticaldifferences between the means were determined using two-wayANOVA and were considered signi"cant at pb0.05.

Results

Effects of CEES on skin structure

In initial studies, we assessed structural alterations in full-thickness human skin equivalents following CEES administration.H&E staining of control tissue showed a strati"ed epidermal layercontaining both basal keratinocytes and differentiated suprabasalcells including prominent granular cells and a thick stratum corneum(Fig. 1A). Following exposure to CEES (100–1000 !M), an increase inthe number of pyknotic nuclei and cytoplasmic vacuolization wasevident in basal keratinocytes (Figs. 1A and 2). In the stratumcorneum from both control and CEES (100 !M)-treated skin equiva-lents, prominent trichrome staining was detected (Fig. 1B). However,a marked decrease in staining was noted with 300 and 1000 !M CEES(Fig. 1B). These data indicate that CEES causes a dose-relateddisruption of the keratin "lament structure in the stratum corneum.

Effects of CEES on markers of cell proliferation and DNA damage

PCNA is a DNA polymerase cofactor important in both DNAsynthesis and repair (Moldovan et al., 2007). Immunohistochemistryrevealed that PCNA was constitutively expressed in basal keratino-cytes in the skin equivalent. CEES treatment resulted in a time-dependent increase in expression of PCNAwhich reached a maximumafter 6–24 h with 1000 !M CEES; subsequently, levels decreased, andby 72 h were at control levels (Fig. 3). PCNA was detected largely inbasal keratinocytes and in "broblasts. Western blot analysis of lysatesfrom epidermal sheets isolated from the skin equivalents indicatedthat PCNA was constitutively expressed in keratinocytes. Expressionof the protein was upregulated as early as 15 min post-exposure,persisting for at least 24 h (Fig. 4). Maximal protein expression wasevident with 300–1000 !M CEES (Fig. 4).

The DNA repair enzyme, PARP, was also constitutively expressed inskin equivalents (Debiak et al., 2009). Treatment with CEES(1000 !M) increased PARP expression within 2–6 h, mainly in basalkeratinocytes (Fig. 5). These effects were transient, with little to nostaining detectable at 72 h post-CEES treatment. PARP protein was

also upregulated 15 min, 6 h and 24 h following CEES treatment withmaximum expression at 1000 !M CEES (Fig. 4).

Phosphorylated histone H2AX (phospho-H2AX) is key for therepair of double-strand DNA breaks (Mah et al., 2010). Lowconstitutive expression of phospho-H2AX was evident in the granularkeratinocyte layer of the epidermis in the skin equivalents (Fig. 6).Treatment with 1000 !M CEES resulted in a rapid increase inexpression of phospho-H2AX in basal keratinocytes with a maximumat 2–6 h. In the granular layer, phospho-H2AX protein continued toincrease up to 72 h. Western blot analysis of the tissue con"rmed thatphospho-H2AX protein expression increased 24 h following CEEStreatment. Maximum levels were evident with 100–1000 !M CEES(Fig. 4).

Effects of CEES on expression of enzymes that mediate eicosanoidproduction

A characteristic response of the skin to irritants is upregulation ofCOX-2, the rate-limiting enzyme in the production of prostaglandins

control 100 µM

300 µM 1000 µM

control 100 µM

300 µM 1000 µM

A

B

Fig. 1. Morphologic changes in full-thickness human skin equivalents following CEEStreatment. EpiDerm-FT™ was treated with CEES (100–1000 !M) or vehicle control.After 24 h, tissue samples were stained with hematoxylin and eosin (Panel A) ortrichrome (Panel B). Arrows indicate abnormal trichrome staining in the stratumcorneum. Original magni"cation, 400!.

180 A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187

(Fitzpatrick, 2004). Treatment of skin equivalents with CEES caused atime and dose-dependent increase in COX-2 expression; maximalincreases were observed 6 h post-treatment with 1000 !M of thevesicant (Fig. 7). At early time points (2 h), COX-2 expression wasdetected largely in "broblasts, while subsequently (6 h), the proteinwas also evident in keratinocytes (Fig. 7). CEES (100–1000 !M) alsoupregulated expression of COX-2 mRNA and protein at 6 and 24 hpost-treatment as determined by real-time PCR and Western blotanalysis of lysates from epidermal sheets isolated from the skinequivalents (Figs. 4 and 8).

Oxidation of arachidonic acid by COX-2 generates prostaglandinPGH2, which is converted to PGE2 by at least two microsomal PGE2synthases, mPGES-1 and mPGES-2 (Murakami et al., 2002). CEES(100–1000 !M) treatment of skin equivalents resulted in a 2-foldincrease in mRNA expression of mPGES-1 and mPGES-2, which wasobserved 24 h post-exposure. Expression of mPGES-1, but notmPGES-2, was also upregulated 6 h post-treatment (Fig. 8).

Leukotrienes are generated via the actions of 5-LOX and 5-LOXactivating protein (FLAP) (Funk, 2001). Products include leukotrieneA4 (LTA4) which is converted to leukotriene B4 (LTB4) and leukotrieneC4 (LTC4) by LTA4 hydrolase and LTC4 synthase, respectively (Funk,2001). Increased mRNA expression of 5-LOX (3–4-fold at 6 and 24 h),but not FLAP, was detected in the skin equivalents following CEEStreatment (Fig. 8 and not shown). LTA4 hydrolase and LTC4 synthasemRNA were also upregulated 2–3-fold after 6 and 24 h (Fig. 8). Thiswas correlated with increased expression of 5-LOX and LTA4

hydrolase protein at 6 and 24 h post-CEES treatment (Fig. 4).

Effects of CEES on expression of primary and secondary antioxidantenzymes

In further studies, we determined if CEES exposure alteredantioxidant enzyme expression in the full-thickness skin equivalents.CEES (100–1000 !M) treatment resulted in a 2–fold increase in mRNAexpression of Cu,Zn-SOD after 24 h (Fig. 9). In contrast, Mn-SODmRNA expression decreased rapidly (6 h) after CEES (Fig. 9). Theglutathione S-transferase (GST) superfamily of secondary antioxidantenzymes, in particular, members of the GST alpha (GSTA) subfamily,are critical mediators in the detoxi"cation of oxidized macromole-cules via glutathione conjugation (Hayes et al., 2004). Fig. 9 showsthat CEES treatment of human skin equivalents resulted in increasedmRNA expression of GSTA1–2 (4-fold at 6 and 24 h), GSTA3 (3–6-foldat 6 and 24 h) and GSTA4 (4-fold at 6 and 24 h).

Discussion

Sulfur mustard has been shown to injure basal keratinocytes inhumans and in animal models, inducing chromatin condensation andcytoplasmic vacuolization followed by cellular swelling and loss of cellmembrane integrity (Papirmeister et al., 1991; Smith et al., 1995,1998; Rice, 2003; Shakarjian et al., 2009). This results in microblisterformation at the dermal–epidermal junction and, in some cases,separation of the epidermis from the dermis (Smith et al., 1997a).Consistent with these studies, we found that CEES treatment of thefull-thickness human skin equivalent results in the formation ofpyknotic nuclei and vacuolization in basal keratinocytes. Thesemorphologic changes are directly linked to blister formation inhuman skin (Proskuryakov et al., 2003), suggesting that the full-thickness human skin equivalent model is useful in recapitulating thein vivo dermal responses of humans to vesicants. Trichrome staining

Fig. 2. Alterations in basal keratinocytes in a full-thickness human skin equivalentfollowing CEES treatment. EpiDerm-FT™ was treated with CEES (100–1000 !M) orvehicle control. After 24 h, tissue samples were stained with hematoxylin and eosin.Note the prominent nuclear condensation in basal keratinocytes following exposure to300 and 1000 !M CEES. Original magni"cation, 1000!.

control 2 hr 6 hr

24 hr 48 hr 72 hr

Fig. 3. Effects of CEES on PCNA expression. EpiDerm-FT™ was treated with CEES (1000 !M) or control. Tissues were collected 2–72 h later and stained with anti-PCNA antibody.Binding was visualized using a peroxidase DAB substrate kit. Original magni"cation, 400!.

181A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187

5-LOX

LTA 4 hydrolase

COX -2

0 100 300 1000 0 100 300 1000

CEES (µM)

-actin

6 hr 24 hr

Phospho-H2AX

0 100 300 1000 0 100 300 1000 0 100 300 1000

CEES (µM)

15 min 6 hr 24 hrPCNA

PARP

-actin

Den

sito

met

ry(a

rbitr

ary

units

)

CEES (µM)

15 min 6 hr 24 hr

PCNA

PARP

Phospho-H2AX

0 100 3001000 0 100 3001000 0 100 3001000

10

5

4

2

6

3

0

CEES (µM)

6 hr 24 hr

COX-2

5 LOX

LTA4hydrolase

6

3

4

2

6

3

0

A

B

0 100 3001000 0 100 3001000

Fig. 4. Effects of CEES on expression of markers of injury and in!ammation. EpiDerm-FT™ was treated with CEES (100, 300 or 1000 !M) or control for 15 min, 6 h, or 24 h, asindicated. Panel A. Epidermal sheets were collected and analyzed for protein expression by Western blotting using anti-PCNA, PARP, phospho-H2AX, COX-2, 5-LOX, and LTA4

hydrolase antibodies. #-Actin was used as a control to ensure equal protein loading. Panel B. Densitometry was performed on Western blots shown in Panel A. Data is presented inarbitrary units.

2 hr 6 hr

72 hr

control

24 hr 48 hr

Fig. 5. Effects of CEES on PARP expression. EpiDerm-FT™ was treated with CEES (1000 !M) or control. Tissues were collected 2–72 h later and stained with anti-PARP antibody.Binding was visualized using a peroxidase DAB substrate kit. Original magni"cation, 400!.

182 A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187

of CEES-treated full-thickness skin equivalents also revealed altera-tions in keratin organization in the stratum corneum. These results arein agreementwith earlier studies demonstrating that vesicants inducekeratin aggregation and abnormal "lament assembly and can directlymodify cytoskeletal proteins including cytokeratins 5, 6, 9, 14 and 16,actin and annexin A2 (Dillman et al., 2003; Hess and FitzGerald, 2007;Mol et al., 2008; Sayer et al., 2009). Single amino acid mutations inkeratin 5 and keratin 14 can perturb "lament assembly, resulting inskin blistering diseases (Uitto et al., 2007). Sulfur mustard-inducedmodi"cations in keratins 5 and 14 are thought to lead to alterations inhemidesmosomes which attach basal keratinocytes to the basementmembrane (Dillman et al., 2003). Further studies are needed todetermine if these keratins are similarly modi"ed in skin equivalentsand if this can lead to the detachment of keratinocytes from thedermal–epidermal junction. It should be noted that the stratumcorneum is also key for maintaining the barrier functions of the skin;disruption of the cytokeratin architecture by vesicants may interferewith this activity, contributing to toxicity. In this regard, sulfur

mustard has been reported to increase transepidermal water loss inboth animal and in vitro models (Graham et al., 2002; Dachir et al.,2010).

DNA is a major target for sulfur mustard and related vesicants andis readily modi"ed by the formation of both monofunctional andbifunctional adducts, generating apurinic sites and strand breaks(Papirmeister et al., 1991). In response to DNA damage, several keybiochemical pathways are activated which are important in protect-ing cells against injury and initiating repair processes. For example,following CEES administration, phosphorylation of the DNA damagesensors, ataxia telangiectasia-mutated (ATM) and ataxia telangiecta-sia-RAD-3-related (ATR) proteins is observed, as well as check pointkinases 1 and 2, and the down-stream cell cycle regulatory proteins,cdc25A, cdc25C and cdk2 (Tewari-Singh et al., 2010). PCNA, a DNApolymerase cofactor that promotes DNA replication, is also increasedin mouse and pig skin following sulfur mustard or CEES exposure(Smith et al., 1997b; Tewari-Singh et al., 2009). Similarly, we foundthat CEES treatment of the full-thickness skin equivalent model

2 hrcontrol 6 hr

24 hr 48 hr 72 hr

Fig. 6. Effects of CEES on phospho-H2AX expression. EpiDerm-FT™was treatedwith CEES (1000 !M) or control. Tissueswere collected 2–72 h later and stainedwith anti-phospho-H2AXantibody. Binding was visualized using a peroxidase DAB substrate kit. Original magni"cation, 400!.

Fig. 7. Effects of CEES on COX-2 expression. EpiDerm-FT™ was treated with CEES (1000 !M) or control. Tissues were collected 2–72 h later and stained with anti-COX-2 antibody.Binding was visualized using a peroxidase DAB substrate kit. Original magni"cation, 400!.

183A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187

results in increased PCNA expression which was evident in histologysections and in Western blots of isolated epidermis. Increased PARPexpression was also detected. PARP is a NAD+-dependent nuclearenzyme activated in response to single- and double-strand DNAbreaks (Debiak et al., 2009). Following activation, PARP binds to DNAand (ADP-ribosyl)ates itself, as well as many other proteins involvedin DNA repair and chromatin remodeling. Previous studies haveshown that PARP is rapidly activated by sulfur mustard and CEES inguinea pig skin and in cultured keratinocytes (Hinshaw et al., 1999;Bhat et al., 2000, 2006; Kan et al., 2003; Tewari-Singh et al., 2010).Moreover, inhibition of PARP suppresses DNA repair in sulfurmustard-treated human keratinocytes, demonstrating that activationof this enzyme is involved in this process. It has also been suggestedthat PARP may indirectly contribute to sulfur mustard toxicity.According to this “PARP hypothesis”, sulfur mustard-induced DNAadducts impair the replication process, resulting in extensive DNAstrand breaks and activation of PARP. Subsequent activation of PARPcan lead to rapid depletion of intracellular stores of pyridinenucleotides and, consequently, inhibition of ATP production resultingin cell death (Papirmeister et al., 1985, 1991). Whether PARPcontributes to toxicity or wound healing may depend on doses andduration of exposure to sulfur mustard.

H2AX is rapidly phosphorylated following double-strand DNAbreaks and is key in activating DNA damage response pathwaysimportant in repair (Mah et al., 2010). Following CEES treatment,increased phosphorylation of H2AXwas detected in the nuclei of basalcells of the full-thickness human skin equivalents, con"rming DNAdamage. Interestingly, low constitutive expression of phosphorylatedH2AX was also evident in granular layers of the skin equivalents, andthis increased after CEES administration. In contrast to nuclearlocalization in basal cells, in granular cells, phosphorylated H2AX

was distributed throughout the cytoplasm. Granular keratinocytes areknown to undergo terminal differentiation and form the stratumcorneum; during this process, the nuclear membrane and the DNAdegrade and this may underlie nuclear delocalization of H2AX(Houben et al., 2007). Thus, increased phosphorylated H2AX in thegranular layer post-CEES treatment may result from increases inexpression of this protein in individual keratinocytes and in thenumber of cells undergoing differentiation. Increased levels ofphoshorylated-H2AX have also been described in human "broblastsand Chinese hamster cells following exposure to DNA alkylatingagents including cisplatin and nitrogenmustard (Clingen et al., 2008),and human keratinocytes treated with sulfur mustard (Miller et al.,2010).

Accumulating evidence suggests that the toxicity of vesicantsinvolves the generation of reactive oxygen species (ROS) andinduction of oxidative stress (Laskin et al., 2010). This is associatedwith increased expression of antioxidant enzymes, which function tolimit cytotoxicity (Droge, 2002). We have recently reported that CEESstimulates ROS generation by mouse keratinocytes and inducesprotein oxidation (Black et al., 2010). This was correlated withincreased expression of a number of antioxidant enzymes includingCu,Zn-SOD, thioredoxin reductase, catalase, GSTA1–2 and GST-P1.Increased protein and DNA oxidation have also been described inCEES-treated mouse skin (Pal et al., 2009). The present studiesdemonstrate that CEES similarly alters expression of antioxidants infull-thickness human skin equivalents. Thus, while increases in Cu,Zn-SOD expression were evident 24 h after CEES treatment, a smalldecrease in Mn-SOD was noted after 6 h. GSTA1–2, GSTA3 and GSTA4mRNAwere also upregulated after 6 and 24 h. Cu,Zn-SOD is a cytosolicenzyme, while Mn-SOD is localized in the mitochondria (Droge,2002). Sulfur mustard exposure is known to selectively damage

* * *

* **

* **

*

*

***

**

* **

**

**

* * *

COX-2 mPGES-1 mPGES-2

5-LOX LTA4 hydrolase LTC4 synthase

4

2

04

2

0

Fol

d C

hang

es

4

2

04

2

0

Fol

d C

hang

es

0 100 300 1000 0 100 300 1000 0 100 300 1000

0 100 300 10000 100 300 10000 100 300 1000

CEES (µM)CEES (µM)CEES (µM)

6 hr

24 hr

6 hr

24 hr

Fig. 8. Effects of CEES on mRNA expression of eicosanoid biosynthetic enzymes. EpiDerm-FT™ was treated with CEES (100, 300 or 1000 !M) or control. After 6 or 24 h, epidermalsheets were collected and mRNA isolated and analyzed for gene expression by real-time PCR. Data are presented as fold change in gene expression relative to untreated cells.*Signi"cantly different from control (pb0.05).

184 A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187

mitochondria and this may result in decreased Mn-SOD expression(Shahin et al., 2001; Gould et al., 2009). Antioxidants including SODare known to play a role in protecting cells from oxidative DNAdamage and previous studies have shown that pretreatment of guineapigs with Mn-SOD or Cu,Zn-SOD reduce sulfur mustard-induced skindamage (Eldad et al., 1998). Our "ndings of increased expression ofCu,Zn-SOD after CEES treatment are consistent with this protectiverole in full-thickness human skin equivalents. Earlier work has alsoshown that sulfur mustard increases total GST activity in humankeratinocytes (Gross et al., 2006). GSTs constitute a large superfamilyof detoxi"cation enzymes that conjugate glutathione to oxidizedcellular macromolecules, a process that increases their eliminationfrom cells (Hayes et al., 2004). The GST alpha (GSTA) family ofenzymes is known to remove lipid hydroperoxides, thereby breakingradical-forming chain reactions (Hayes et al., 2004). Increases inexpressionofGSTAenzymes followingCEES exposuremaybe importantin protecting keratinocyte membranes from lipid peroxide-induceddamage.

Hallmarks of sulfur mustard-induced skin toxicity include erythe-ma, edema and pruritis (Rice, 2003). This is accompanied by increasedproduction of eicosanoids (Shakarjian et al., 2009). Sulfur mustardand CEES have been reported to upregulate expression of COX-2, therate-limiting enzyme in prostaglandin biosysnthesis, in mouse skin(Nyska et al., 2001) and inmouse keratinocytes grown at an air–liquidinterface (Black et al., 2010). Consistent with these results, we foundthat COX-2 mRNA and protein expression were increased in the full-thickness skin equivalent following CEES treatment, suggesting thatthis enzyme plays a key role in mediating dermal in!ammation andinjury following vesicant exposure. This is supported by "ndings thatsulfur mustard-induced skin injury and in!ammation are reduced inCOX-2 de"cient mice and in mice treated with topical inhibitors ofcyclooxygenase activity (Babin et al., 2000; Casillas et al., 2000; Dachir

et al., 2002, 2004; Wormser et al., 2004b). In full-thickness skinequivalents, CEES was also found to upregulate mPGES-1 and mPGES-2 mRNA expression, two prostanoid synthases downstream of COX-2that generate PGE2, a key mediator in the development of dermalin!ammatory responses (Murakami et al., 2002). Increased PGE2production has been reported in sulfur mustard-treated human skinexplants andmouse skin (Rikimaru et al., 1991; Dachir et al., 2004), aswell as in CEES-treated full-thickness human skin equivalents (Blahaet al., 2000a,b). Our "ndings that COX-2, mPGES-1 and mPGES-2 arecoordinately upregulated in the human full thickness skin equivalentfollowing CEES treatment suggest a potentially important mechanismfor the generating of PGE2 in the skin following vesicant exposure. 5-LOX, LTA4 hydrolase and LTC4 synthase, enzymes responsible for thesynthesis of LTB4 and LTC4, were also upregulated in the skinequivalents after CEES exposure. These results are in agreementwith previous "ndings on the effects of CEES in mouse keratinocytesgrown at an air–liquid interface (Black et al., 2010), and that sulfurmustard increases LTB4 levels in in!ammatory lesions in rabbit skin(Tanaka et al., 1997). Additional studies correlating eicosanoidbiosynthetic enzyme gene and protein expression with enzymaticactivity and production of prostaglandins and leukotrienes in the full-thickness human skin equivalent will be important in assessing therole of these mediators in vesicant-induced in!ammation and injury.

In summary, the present studies demonstrate the utility of the full-thickness human skin equivalent model to investigate mechanisms ofvesicant-induced skin toxicity and for the development of counter-measures. Vesicants can be applied directly to the stratum corneum onthe air surface, which more accurately re!ects human exposure.Moreover, vesicants generate basal cell damage generally similar tothat observed in human skin.Markers forDNAdamage in both basal andgranular layers of the full thickness skin equivalents were evident, aswell as increased expression of mediators that regulate in!ammation

* * *

* *

* **

*** * *

* *

**

**

*

*

0 100 300 1000 0 100 300 1000

0 100 300 1000

Cu,Zn-SOD Mn-SOD

GSTA1-2 GSTA3 GSTA4

2

1

02

1

0

6

3

06

3

0

CEES (µM)0 100 300 1000

CEES (µM)0 100 300 1000

CEES (µM)

6 hr

24 hr

6 hr

24 hrFol

d C

hang

esF

old

Cha

nges

Fig. 9. Effects of CEES on keratinocyte mRNA expression of primary antioxidants and glutathione S-transferases. EpiDerm-FT™ was treated with CEES (100, 300 or 1000 !M) orcontrol. After 6 or 24 h, epidermal sheets were collected andmRNA isolated and analyzed for gene expression by real-time PCR. Data are presented as fold change in gene expressionrelative to untreated cells. *Signi"cantly different from control (pb0.05).

185A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187

and wound repair including enzymes that generate arachidonic acid-derived lipid mediators. We also observed changes in expression ofantioxidants that may be important in protecting keratinocytes fromoxidative stress. At the present time, there are few effective counter-measures against vesicant-induced dermal toxicity. Vesicant-inducedchanges in the full thickness human skin equivalentmodelmay provideimportant leads in identifying effective therapeutic strategies. The factthat the skin equivalents are an in vitro model will also allow a betterunderstanding of the mechanisms of vesicant toxicity as well as earlydevelopment of drugs to counter toxicity without the use of animalmodels.

Con!ict of interest statementOne of the authors (P.J. Hayden) is employed byMatTek Corporation, manufacturer of theEpiDerm-FT™ full-thickness skin equivalent used in the experiments. The other authorshave no con!icts of interest to declare.

Acknowledgments

This research was supported by the CounterACT Program, NationalInstitutes of Health Of"ce of the Director, and the National Institute ofArthritis and Musculoskeletal and Skin Diseases, Grant numberU54AR055073. Its contents are solely the responsibility of the authorsand do not necessarily represent the of"cial views of the federalgovernment. This work was also supported in part by NationalInstitutes of Health grants CA100994, CA093798, CA132624,AR055073, ES004738, ES005022, GM034310, AI084138 and AI51214.

References

Babin, M.C., Ricketts, K., Skvorak, J.P., Gazaway, M., Mitcheltree, L.W., Casillas, R.P., 2000.Systemic administration of candidate antivesicants to protect against topicallyapplied sulfur mustard in the mouse ear vesicant model (MEVM). J. Appl. Toxicol.20 (Suppl 1), S141–S144.

Bhat, K.R., Benton, B.J., Rosenthal, D.S., Smulson, M.E., Ray, R., 2000. Role of poly(ADP-ribose) polymerase (PARP) in DNA repair in sulfur mustard-exposed normalhuman epidermal keratinocytes (NHEK). J. Appl. Toxicol. 20 (Suppl 1), S13–S17.

Bhat, K.R., Benton, B.J., Ray, R., 2006. Poly (ADP-ribose) polymerase (PARP) is essentialfor sulfur mustard-induced DNA damage repair, but has no role in DNA ligaseactivation. J. Appl. Toxicol. 26, 452–457.

Black, A.T., Joseph, L.B., Casillas, R.P., Heck, D.E., Gerecke, D.R., Sinko, P.J., Laskin, D.L.,Laskin, J.D., 2010. Role of MAP kinases in regulating expression of antioxidants andin!ammatory mediators in mouse keratinocytes following exposure to the halfmustard, 2-chloroethyl ethyl sul"de. Toxicol. Appl. Pharmacol. 245, 352–360.

Blaha, M., Bowers Jr., W., Kohl, J., DuBose, D., Walker, J., 2000a. IL-1-related cytokineresponses of nonimmune skin cells subjected to CEES exposure with and withoutpotential vesicant antagonists. In Vitro Mol. Toxicol. 13, 99–111.

Blaha, M., Bowers Jr., W., Kohl, J., DuBose, D., Walker, J., Alkhyyat, A., Wong, G., 2000b.Effects of CEES on in!ammatory mediators, heat shock protein 70A, histology andultrastructure in two skin models. J. Appl. Toxicol. 20 (Suppl 1), S101–S108.

Blaha, M., Kohl, J., DuBose, D., Bowers Jr., W., Walker, J., 2001. Ultrastructural andhistological effects of exposure to CEES or heat in a human epidermal model. InVitro Mol. Toxicol. 14, 15–23.

Boelsma, E., Gibbs, S., Faller, C., Ponec, M., 2000. Characterization and comparison ofreconstructed skin models: morphological and immunohistochemical evaluation.Acta Derm. Venereol. 80, 82–88.

Casillas, R.P., Kiser, R.C., Truxall, J.A., Singer, A.W., Shumaker, S.M., Niemuth, N.A.,Ricketts, K.M., Mitcheltree, L.W., Castrejon, L.R., Blank, J.A., 2000. Therapeuticapproaches to dermatotoxicity by sulfur mustard: I. Modulation of sulfur mustard-induced cutaneous injury in the mouse ear vesicant model. J. Appl. Toxicol. 20(Suppl 1), S145–S151.

Clingen, P.H., Wu, J.Y., Miller, J., Mistry, N., Chin, F., Wynne, P., Prise, K.M., Hartley, J.A.,2008. Histone H2AX phosphorylation as a molecular pharmacological marker forDNA interstrand crosslink cancer chemotherapy. Biochem. Pharmacol. 76, 19–27.

Cowan, F.M., Broom"eld, C.A., Smith, W.J., 2002. Suppression of sulfur mustard-increasedIL-8 in human keratinocyte cell cultures by serine protease inhibitors: implications fortoxicity and medical countermeasures. Cell Biol. Toxicol. 18, 175–180.

Dachir, S., Fishbeine, E., Meshulam, Y., Sahar, R., Amir, A., Kadar, T., 2002. Potential anti-in!ammatory treatments against cutaneous sulfur mustard injury using the mouseear vesicant model. Hum. Exp. Toxicol. 21, 197–203.

Dachir, S., Fishbeine, E., Meshulam, Y., Sahar, R., Chapman, S., Amir, A., Kadar, T., 2004.Amelioration of sulfur mustard skin injury following a topical treatment with amixture of a steroid and a NSAID. J. Appl. Toxicol. 24, 107–113.

Dachir, S., Cohen, M., Fishbeine, E., Sahar, R., Brandies, R., Horwitz, V., Kadar, T., 2010.Characterization of acute and long-term sulfur mustard-induced skin injuries inhairless guinea-pigs using non-invasive methods. Skin Res. Technol. 16, 114–124.

Dannenberg Jr., A.M., Pula, P.J., Liu, L.H., Harada, S., Tanaka, F., Vogt Jr., R.F., Kajiki, A.,

Higuchi, K., 1985. In!ammatory mediators and modulators released in organculture from rabbit skin lesions produced in vivo by sulfur mustard: I. Quantitativehistopathology; PMN, basophil, and mononuclear cell survival; and unbound(serum) protein content. Am. J. Pathol. 121, 15–27.

Debiak, M., Kehe, K., Burkle, A., 2009. Role of poly(ADP-ribose) polymerase in sulfurmustard toxicity. Toxicology 263, 20–25.

Debouzy, J.C., Aous, S., Dabouis, V., Neveux, Y., Gentilhomme, E., 2002. Phospholipidmatrix as a target for sulfur mustard (HD): NMR study in model membranesystems. Cell Biol. Toxicol. 18, 397–408.

Dillman III, J.F., McGary, K.L., Schlager, J.J., 2003. Sulfur mustard induces the formation ofkeratin aggregates in human epidermal keratinocytes. Toxicol. Appl. Pharmacol.193, 228–236.

Dillman III, J.F., McGary, K.L., Schlager, J.J., 2004. An inhibitor of p38 MAP kinasedownregulates cytokine release induced by sulfur mustard exposure in humanepidermal keratinocytes. Toxicol. In Vitro 18, 593–599.

Droge, W., 2002. Free radicals in the physiological control of cell function. Physiol. Rev.82, 47–95.

Eldad, A., Ben Meir, P., Breiterman, S., Chaouat, M., Shafran, A., Ben-Bassat, H., 1998.Superoxide dismutase (SOD) for mustard gas burns. Burns 24, 114–119.

Fitzpatrick, F.A., 2004. Cyclooxygenase enzymes: regulation and function. Curr. Pharm.Des. 10, 577–588.

Funk, C.D., 2001. Prostaglandins and leukotrienes: advances in eicosanoid biology.Science 294, 1871–1875.

Gould, N.S., White, C.W., Day, B.J., 2009. A role for mitochondrial oxidative stress insulfur mustard analog 2-chloroethyl ethyl sul"de-induced lung cell injury andantioxidant protection. J. Pharmacol. Exp. Ther. 328, 732–739.

Graham, J.S., Schomacker, K.T., Glatter, R.D., Briscoe, C.M., Braue Jr., E.H., Squibb, K.S.,2002. Bioengineering methods employed in the study of wound healing of sulphurmustard burns. Skin Res. Technol. 8, 57–69.

Gross, C.L., Nealley, E.W., Nipwoda, M.T., Smith, W.J., 2006. Pretreatment of humanepidermal keratinocytes with D, L-sulforaphane protects against sulfur mustardcytotoxicity. Cutan. Ocul. Toxicol. 25, 155–163.

Harada, S., Dannenberg Jr., A.M., Vogt Jr., R.F., Myrick, J.E., Tanaka, F., Redding, L.C.,Merkhofer, R.M., Pula, P.J., Scott, A.L., 1987. In!ammatory mediators andmodulators released in organ culture from rabbit skin lesions produced in vivoby sulfur mustard: III. Electrophoretic protein fractions, trypsin-inhibitory capacity,alpha 1-proteinase inhibitor, and alpha 1- and alpha 2-macroglobulin proteinaseinhibitors of culture !uids and serum. Am. J. Pathol. 126, 148–163.

Hayden, P.J., Ayehunie, S., Jackson,G.R., Kupfer-Lamore, S., Last, T.J., Klausner,M., Kubilus, J.,2003. In vitro skin equivalentmodels for toxicity testing. In: Salem, H., Katz, S.A. (Eds.),Alternative Toxicological Methods. CRC Press, Boca Raton, pp. 229–247.

Hayden, P.J., Petrali, J.P., Stolper, G., Hamilton, T.A., Jackson Jr., G.R., Wertz, P.W., Ito, S.,Smith, W.J., Klausner, M., 2009. Microvesicating effects of sulfur mustard on an invitro human skin model. Toxicol. In Vitro 23, 1396–1405.

Hayes, J.D., Flanagan, J.U., Jowsey, I.R., 2004. Glutathione transferases. Annu. Rev.Pharmacol. Toxicol. 45, 51–88.

Hess, J.F., FitzGerald, P.G., 2007. Treatment of keratin intermediate "laments with sulfurmustard analogs. Biochem. Biophys. Res. Commun. 359, 616–621.

Hinshaw, D.B., Lodhi, I.J., Hurley, L.L., Atkins, K.B., Dabrowska,M.I., 1999. Activation of poly[ADP-Ribose] polymerase in endothelial cells and keratinocytes: role in an in vitromodel of sulfur mustard-mediated vesication. Toxicol. Appl. Pharmacol. 156, 17–29.

Houben, E., De Paepe, K., Rogiers, V., 2007. A keratinocyte's course of life. SkinPharmacol. Physiol. 20, 122–132.

Hu, T., Khambatta, Z.S., Hayden, P.J., Bolmarcich, J., Binder, R.L., Robinson, M.K., Carr, G.J.,Tiesman, J.P., Jarrold, B.B., Osborne, R., Reichling, T.D., Nemeth, S.T., Aardema, M.J.,2010. Xenobiotic metabolism gene expression in the EpiDerm in vitro 3D humanepidermis model compared to human skin. Toxicol. In Vitro 24, 1450–1463.

Kan, R.K., Pleva, C.M., Hamilton, T.A., Anderson, D.R., Petrali, J.P., 2003. Sulfur mustard-induced apoptosis in hairless guinea pig skin. Toxicol. Pathol. 31, 185–190.

Laskin, J.D., Black, A.T., Jan, Y.H., Sinko, P.J., Heindel, N.D., Heck, D.E., Laskin, D.L., 2010.Oxidants and antioxidants in themechanismof sulfurmustard injury. Ann.NYAcad. Sci.1203, 92–100.

Lefkowitz, L.J., Smith, W.J., 2002. Sulfur mustard-induced arachidonic acid release ismediated by phospholipase D in human keratinocytes. Biochem. Biophys. Res.Commun. 295, 1062–1067.

Luu-The, V., Duche, D., Ferraris, C., Meunier, J.R., Leclaire, J., Labrie, F., 2009. Expressionpro"les of phases 1 and 2metabolizing enzymes in human skin and the reconstructedskin models Episkin and full thickness model from Episkin. J. Steroid Biochem. Mol.Biol. 116, 178–186.

Mah, L.J., El-Osta, A., Karagiannis, T.C., 2010. gammaH2AX: a sensitive molecular markerof DNA damage and repair. Leukemia 24, 679–686.

Miller, A.L., Gross, C.L., Nealley, E.W., Clark, O.E., Waraich, N.K., Rodgers, K.L., Smith, W.J.,2010. Different methods to study the genotoxic marker $-H2AX following sulfurmustard exposure in cultured human skin cells and a skin tissue construct.Proceedings of the U.S. Army Medical Defense Bioscience Review, p. 103.

Mol, M.A., van den Berg, R.M., Benschop, H.P., 2008. Proteomic assessment of sulfurmustard-induced protein adducts and other protein modi"cations in humanepidermal keratinocytes. Toxicol. Appl. Pharmacol. 230, 97–108.

Moldovan, G.L., Pfander, B., Jentsch, S., 2007. PCNA, the maestro of the replication fork.Cell 129, 665–679.

Monteiro-Riviere, N.A., Inman, A.O., 1997. Ultrastructural characterization of sulfurmustard-induced vesication in isolated perfused porcine skin. Microsc. Res. Tech.37, 229–241.

Monteiro-Riviere, N.A., Inman, A.O., Babin,M.C., Casillas, R.P., 1999. Immunohistochemicalcharacterization of the basement membrane epitopes in bis(2-chloroethyl) sul"de-induced toxicity in mouse ear skin. J. Appl. Toxicol. 19, 313–328.

186 A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187

Murakami, M., Nakatani, Y., Tanioka, T., Kudo, I., 2002. Prostaglandin E synthase.Prostaglandins Other Lipid Mediat. 68–69, 383–399.

Nyska, A., Lomnitski, L., Maronpot, R., Moomaw, C., Brodsky, B., Sintov, A., Wormser, U.,2001. Effects of iodine on inducible nitric oxide synthase and cyclooxygenase-2expression in sulfur mustard-induced skin. Arch. Toxicol. 74, 768–774.

Pal, A., Tewari-Singh, N., Gu, M., Agarwal, C., Huang, J., Day, B.J., White, C.W., Agarwal, R.,2009. Sulfur mustard analog induces oxidative stress and activates signalingcascades in the skin of SKH-1 hairless mice. Free Radic. Biol. Med. 47, 1640–1651.

Papirmeister, B., Gross, C.L., Meier, H.L., Petrali, J.P., Johnson, J.B., 1985. Molecular basisfor mustard-induced vesication. Fundam. Appl. Toxicol. 5, S134–S149.

Papirmeister, B., Feister, A.J., Robinson, S.I., Ford, R.D., 1991. Medical Defense against MustardGas: ToxicMechanisms andPharmacological Implications. CRC Press, Inc., BocaRaton, FL.

Ponec, M., Boelsma, E., Gibbs, S., Mommaas, M., 2002. Characterization of reconstructedskin models. Skin Pharmacol. Appl. Skin Physiol. 15 (Suppl 1), 4–17.

Proskuryakov, S.Y., Konoplyannikov, A.G., Gabai, V.L., 2003. Necrosis: a speci"c form ofprogrammed cell death? Exp. Cell Res. 283, 1–16.

Rebholz, B., Kehe, K., Ruzicka, T., Rupec, R.A., 2008. Role of NF-kappaB/RelA and MAPKpathways in keratinocytes in response to sulfur mustard. J. Invest. Dermatol. 128,1626–1632.

Reid, F.M., Graham, J., Niemuth, N.A., Singer, A.W., Janny, S.J., Johnson, J.B., 2000. Sulfurmustard-induced skin burns in weanling swine evaluated clinically and histopatho-logically. J. Appl. Toxicol. 20 (Suppl 1), S153–S160.

Rice, P., 2003. Sulphur mustard injuries of the skin. Pathophysiology and management.Toxicol. Rev. 22, 111–118.

Rikimaru, T., Nakamura, M., Yano, T., Beck, G., Habicht, G.S., Rennie, L.L., Widra, M.,Hirshman, C.A., Boulay, M.G., Spannhake, E.W., et al., 1991. Mediators, initiatingthe in!ammatory response, released in organ culture by full-thickness humanskin explants exposed to the irritant, sulfur mustard. J. Invest. Dermatol. 96,888–897.

Sayer, N.M., Whiting, R., Green, A.C., Anderson, K., Jenner, J., Lindsay, C.D., 2009. Directbinding of sulfur mustard and chloroethyl ethyl sulphide to human cell membrane-associated proteins; implications for sulfur mustard pathology. J. Chromatogr. BAnal. Technol. Biomed. Life Sci. 878, 1426–1432.

Shahin, S., Cullinane, C., Gray, P.J., 2001. Mitochondrial and nuclear DNA damageinduced by sulphur mustard in keratinocytes. Chem. Biol. Interact. 138, 231–245.

Shakarjian, M.P., Bhatt, P., Gordon, M.K., Chang, Y.C., Casbohm, S.L., Rudge, T.L., Kiser, R.C.,Sabourin, C.L., Casillas, R.P., Ohman-Strickland, P., Riley, D.J., Gerecke, D.R., 2006.Preferential expression of matrix metalloproteinase-9 in mouse skin after sulfurmustard exposure. J. Appl. Toxicol. 26, 239–246.

Shakarjian, M.P., Heck, D.E., Gray, J.P., Sinko, P.J., Gordon, M.K., Casillas, R.P., Heindel, N.D.,Gerecke, D.R., Laskin, D.L., Laskin, J.D., 2009. Mechanisms mediating the vesicantactions of sulfur mustard after cutaneous exposure. Toxicol. Sci. 114, 5–19.

Simbulan-Rosenthal, C.M., Ray, R., Benton, B., Soeda, E., Daher, A., Anderson, D., Smith,

W.J., Rosenthal, D.S., 2006. Calmodulin mediates sulfur mustard toxicity in humankeratinocytes. Toxicology 227, 21–35.

Smith, W.J., Gross, C.L., Chan, P., Meier, H.L., 1990. The use of human epidermalkeratinocytes in culture as a model for studying the biochemical mechanisms ofsulfur mustard toxicity. Cell Biol. Toxicol. 6, 285–291.

Smith, K.J., Hurst, C.G., Moeller, R.B., Skelton, H.G., Sidell, F.R., 1995. Sulfurmustard: itscontinuing threat as a chemical warfare agent, the cutaneous lesions induced,progress in understanding its mechanism of action, its long-term health effects,and new developments for protection and therapy. J. Am. Acad. Dermatol. 32,765–776.

Smith, K.J., Casillas, R., Graham, J., Skelton, H.G., Stemler, F., Hackley Jr., B.E., 1997a.Histopathologic features seen with different animal models following cutaneoussulfur mustard exposure. J. Dermatol. Sci. 14, 126–135.

Smith, K.J., Graham, J.S., Hamilton, T.A., Skelton, H.G., Petrali, J.P., Hurst, C.G., 1997b.Immunohistochemical studies of basement membrane proteins and proliferationand apoptosis markers in sulfur mustard induced cutaneous lesions in weanlingpigs. J. Dermatol. Sci. 15, 173–182.

Smith, K.J., Smith, W.J., Hamilton, T., Skelton, H.G., Graham, J.S., Okerberg, C., Moeller, R.,Hackley Jr., B.E., 1998. Histopathologic and immunohistochemical features inhuman skin after exposure to nitrogen and sulfur mustard. Am. J. Dermatopathol.20, 22–28.

Tanaka, F., Dannenberg Jr., A.M., Higuchi, K., Nakamura, M., Pula, P.J., Hugli, T.E.,Discipio, R.G., Kreutzer, D.L., 1997. Chemotactic factors released in culture by intactdeveloping and healing skin lesions produced in rabbits by the irritant sulfurmustard. In!ammation 21, 251–267.

Tewari-Singh, N., Rana, S., Gu, M., Pal, A., Orlicky, D.J., White, C.W., Agarwal, R., 2009.In!ammatory biomarkers of sulfur mustard analog 2-chloroethyl ethyl sul"de-induced skin injury in SKH-1 hairless mice. Toxicol. Sci. 108, 194–206.

Tewari-Singh, N., Gu, M., Agarwal, C., White, C.W., Agarwal, R., 2010. Biological andmolecular mechanisms of sulfur mustard analogue-induced toxicity in JB6 andHaCaT cells: possible role of ataxia telangiectasia-mutated/ataxia telangiectasia-Rad3-related cell cycle checkpoint pathway. Chem. Res. Toxicol. 23, 1034–1044.

Uitto, J., Richard, G., McGrath, J.A., 2007. Diseases of epidermal keratins and their linkerproteins. Exp. Cell Res. 313, 1995–2009.

van der Schans, G.P., Noort, D., Mars-Groenendijk, R.H., Fidder, A., Chau, L.F., de Jong, L.P.,Benschop, H.P., 2002. Immunochemical detection of sulfur mustard adducts withkeratins in the stratum corneum of human skin. Chem. Res. Toxicol. 15, 21–25.

Wormser, U., Langenbach, R., Peddada, S., Sintov, A., Brodsky, B., Nyska, A., 2004a.Reduced sulfur mustard-induced skin toxicity in cyclooxygenase-2 knockout andcelecoxib-treated mice. Toxicol. Appl. Pharmacol. 200, 40–47.

Wormser, U., Sintov, A., Brodsky, B., Casillas, R.P., Nyska, A., 2004b. Protective effect oftopical iodine containing anti-in!ammatory drugs against sulfur mustard-inducedskin lesions. Arch. Toxicol. 78, 156–166.

187A.T. Black et al. / Toxicology and Applied Pharmacology 249 (2010) 178–187