fundamentals of next-generation sequencing: technologies ...technologies that: – perform numerous...
TRANSCRIPT
![Page 1: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/1.jpg)
Fundamentals of Next-Generation Sequencing: Technologies and
ApplicationsSociety for Hematopathology
European Association for Haematopathology2017 Workshop
Eric Duncavage, MDWashington University in St. Louis
![Page 2: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/2.jpg)
Disclosures• None
![Page 3: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/3.jpg)
Outline• Technologies
– NGS data generation– Enrichment methods– Basic Analysis
• Applications– Diagnostic sequencing in myeloid malignancies– Sequencing for measurable residual disease (MRD)– Sequencing based karyotyping
![Page 4: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/4.jpg)
Clinical NGS Overview(in one slide)
NGSLibrary Generation
![Page 5: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/5.jpg)
DNA Sequencing Enrichment Methods
– Multiplex PCR based enrichment• Advantage: lower input DNA amounts, rapid, workflow• Disadvantage: cannot target large regions, or unique reads
– Hybrid capture based enrichment• Advantage: large target space, identifies unique reads• Disadvantage: slower, more DNA input, lower on target
– Ligation based enrichment• Advantage: fast, large target space• Disadvantage: some regions difficult to target
![Page 6: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/6.jpg)
Capture-Based Enrichmentor
Blood/marrow tissue
DNA purification/QC
Fragmentation (~200 bp)
adapter Aadapter B Ligation of
universal adaptersSelective PCR amplification
Enriched library
fwd read
rev read
Capture Enrichment
Paired end sequencing
![Page 7: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/7.jpg)
PCR-Based Enrichmentor
Blood/marrow tissue
DNA purification/QC
Multiplex PCR of genomic DNA with primers of interest
Amplified genes of interest
Digest primers and add sequence adapters
Limited cycle PCR
fwd read
rev read
Paired end sequencing
![Page 8: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/8.jpg)
Gene Targeting Strategies• Whole genome sequencing
– Advantages: Unbiased, detects fusions, CNVs, etc– Disadvantages: Expensive, limited sensitivity
• Exome Sequencing– Advantages: Detects any coding mutation, CNVs– Disadvantages: Expensive, limited sensitivity, no
fusions• Hematologic Malignancy Panels
– Range from <50 genes to >400 genes– May use amplion, capture, or ligation based
enrichment– Advantages: inexpensive, rapid, highly sensitive– Disadvantages: biased to targeted genes, limited
structural variant detection
Whole Genome 3x109 bp
Exome5x107 bp
Clinical Cancer Panel5x105 bp
* Not to scale
![Page 9: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/9.jpg)
Sequencing
![Page 10: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/10.jpg)
Next Generation Sequencing• NGS or massively parallel sequencing
refers to a group of sequencing technologies that:– Perform numerous sequencing reactions
simultaneously through nano-scale engineering
– Use of a ‘sequencing by synthesis’ approach– Generate short reads
• Two major platforms in clinical labs– ThermoFisher Ion Torrent– Illumina Instruments
![Page 11: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/11.jpg)
Instrumentation
Illumina
ThermoFisher
• Higher throughput• Higher cost per run• Lower cost per base
![Page 12: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/12.jpg)
NGS Data Generation (Illumina)
Mardis ER. Annu Rev Genomics Hum Genet, 2018
![Page 13: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/13.jpg)
Data Analysis
![Page 14: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/14.jpg)
Sample De-multiplexing• For most clinical applications, multiple cases are
sequenced in the same NGS lane. • FASTQs must first be demultiplexed based on
sample-specific barcodes and split into separate files.
A
B
B
AA
BBB
A Reads B ReadsTotal Reads
![Page 15: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/15.jpg)
Read Mapping and Variant Calling• To make sense of short reads they have to first be aligned to the human genome• Most computationally intensive step of the process
A position with 22 reads aligned:-10 with the reference “T” allele-12 with an alternate “C” allele
Raw Reads Aligned Reads
FLT3
Variant Calling
![Page 16: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/16.jpg)
CNV calls (red)
Normalized Coverage (black)
Heterozygous deletion in all cells
Heterozygous deletion in 50% of cells
Del(7)
+ (8)
Del(5q)Del(16)partial
+ (1)
NGS can Identify all Mutations Types
Copy NumberAlterations
Translocations
![Page 17: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/17.jpg)
Variant Calls
![Page 18: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/18.jpg)
NGS coverage
• What’s the advantage of high coverage?– Gives confidence in the variants identified– Makes it possible to detect tumor mutations despite
admixture of nontumor tissue– Makes it possible to detect variants in subclones of
tumor cells
![Page 19: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/19.jpg)
Coverage and Sensitivity• To a large extent coverage determines the sensitivity
of an NGS assay
50% VAF10% VAF
~125x for >99% chance of seeing 10% VAF mutation twice
![Page 20: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/20.jpg)
Variant Allele Fraction (VAF)
VAF=3/(3+7)=30%
60% of cells
CTGCCTACTACTGCCTACTACAGCCTACTACAGCCTACTACAGACTACTACAGAGTACTACAGAGGACTACAGAGGGCTATAGAGGGCTATAGAGGGCTATAGAGGGCTA
VAF=4/(4+6)=40%
TGTGCAACCGAGGTGCAACCGAGATGCAACCGAGAGCAACCGAGAGCAACCGAGAGCAACCGAGAGCACCCGAAAGCACCCGAAAGCACCTGAAAGCACCTGAAAGCACCTGT
ASXL1U2AF1
WT
ASXL1U2AF1
ASXL1U2AF1
U2AF1
Jacoby et al, Expert Reviews, 2016
TGTGCAACCGAGAGCACCTG
U2AF1 Reference Sequence
VAF=Variant Allele Fraction=variant reads/total reads
Heterozygous mutation in 80% of cells
ASXL1Reference SequenceCTGCCTACTACAGAGGGCTA
Mut
ant
Mut
ant
![Page 21: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/21.jpg)
APPLICATIONS
Myeloid Sequencing PanelsSequencing for Measurable Residual DiseaseSequencing Based Karyotyping
![Page 22: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/22.jpg)
Sequencing Panels for Myeloid Malignancy• The first AML genome was reported in
2009 for an approximate cost of $2M • Identified 12 coding region mutations
including NRAS, NPM1, and IDH1• In less than 10 years clinical
sequencing is commonly performed on MDS and AML
• Small sequencing panels work great for myeloid malignancies due to the small number of recurrently mutated genes
Application #1
![Page 23: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/23.jpg)
AML TCGA Data, NEJM 2013
Exome/WGS (n=200)
Limited Number of Recurrent Mutations in AML
![Page 24: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/24.jpg)
n=1,540 patients111 genes sequenced
Papaemmanuil et al, NEJM 2016
Limited Number of Recurrent Mutations in AML
![Page 25: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/25.jpg)
Limited Number of Recurrent Mutations in MDS
Papaemmanuil et al, Blood, 2013; Haferlach, Leukemia, 2014; Walter, Leukemia, 2013
Percentage of MDS Cases with Mutation
~10 Frequently mutated genes
Long ‘tail’ of less frequently mutated genes
n=1,839 patients
![Page 26: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/26.jpg)
Adapted from Haferlach, Leukemia, 2014
Small Diagnostic Sequencing Panels are Ideally Suited to AML and MDS Evaluation
AML TCGA data, 40 gene panel MDS, 40 Gene Panel
![Page 27: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/27.jpg)
Sequencing Blood is Equivalent to Marrow
Duncavage et al, Blood, 2017
Blood MarrowDx-CR------ Relapse Dx-CR------ Relapse
![Page 28: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/28.jpg)
Clinical Sequencing PanelsMetric Range Consideration
Sequencing Coverage 500x to > 2,000x Higher coverage result in high sensitivities
VAF Sensitivity 3-10% VAFSensitivity depends on coverage and analysis approach
Number of genes 7-400+ genes More genes is not necessarily better
Spectrum of reported mutations
SNV and indels to translocation and CNAs
Some labs my report rearrangements and CNAs [e.g. del(5), del(7)] or translocations from NGS panel data
Cost $1,000-$3,000Generally reimbursed by private insurance and Medicare
Turn around Time ~2 weeks May be as long as 4 weeks
![Page 29: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/29.jpg)
Measurable Residual Disease
• Molecular risk stratification systems in AML rely on the prognostic significance of recurrent mutations identified at initial diagnosis
• In ‘tumor clearance’ methods of risk stratification AML is sequencing at diagnosis and again 30 days after 7+3 induction to determine if mutations have been cleared
• Patients in which mutations (VAF >2.5%) could be detected 30 days after treatment almost all died within 5 years
• Doesn't matter what the mutations are—if they are detectable after treatment it is a bad prognostic indicator
Klco et al, JAMA, 2015
Application #2
![Page 30: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/30.jpg)
Error Corrected UMI-based Methods
GenomicDNA
BarcodedDNA Library
BarcodeFamilies
CollapseFamilies
PCR & sequencing errors
VAF, Variant Allele FractionTrue mutation
VariantCalling
33% VAF
![Page 31: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/31.jpg)
No Error CorrectionWith Error Correction
Which mutation is real?
UMI Based Error Correction for Ultra Sensitive Sequencing
• BRAF V600E mutated cell line diluted to a VAF of 1.3%
• Sequenced to 10,000x coverage using amplicon-based enrichment
• High background noise below 2% VAF
![Page 32: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/32.jpg)
Sequencing Based MRD
• We can now use error corrected sequencing methods (UMIs) to find low level MRD representing one mutated cell in 1,000 normal cells.
![Page 33: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/33.jpg)
Sequencing Based Karyotyping• WGS can be used to recapitulate cytogenetic findings including
gains/losses and rearrangements• Cost of WGS continues to fall—currently $1000
Karyotype WGS
Application #3
![Page 34: Fundamentals of Next-Generation Sequencing: Technologies ...technologies that: – Perform numerous sequencing reactions simultaneously through nano-scale engineering – Use of a](https://reader034.vdocument.in/reader034/viewer/2022050314/5f760a4a1c56221f3c3dce76/html5/thumbnails/34.jpg)
AcknowledgementsPatients
McDonnell Genome Institute WU Oncology DivisionRichard Wilson Haley Abel Matt WalterElaine Mardis Gue Su Chang Tim LeyLi Ding Vince Magrini John DiPersio
Robert Fulton Heather Schmidt Dan LinkDave Larson Joelle Kalicki-Veizer John WelchChris Miller Michelle O’Laughlin Peter Westervelt
Meagan Jacoby
Funding Geoff Uy
NCI R33 CA217700-01 Jin Shao, Josh Robinson
Edward P. Evans Foundation David Spencer
SPORE in Myeloid Malignancies Career Enhancement Award