genetic polymorphism of the renin-angiotensin system and organ damage in essential hypertension

Kidney International, Vol. 57 (2000), pp. 561–569

VASCULAR BIOLOGY – HEMODYNAMICS – HYPERTENSION

Genetic polymorphism of the renin-angiotensin system andorgan damage in essential hypertension

ROBERTO PONTREMOLI, MAURA RAVERA, FRANCESCA VIAZZI, CLIZIA NICOLELLA,VALERIA BERRUTI, GIOVANNA LEONCINI, FRANCESCA GIACOPELLI, GIAN PAOLO BEZANTE,GIORGIO SACCHI, ROBERTO RAVAZZOLO, and GIACOMO DEFERRARI

Department of Internal Medicine, Department of Oncology Biology and Genetics, and Laboratory of Molecular Genetics,G. Gaslini Hospital; and Department of General Pathology, University of Genoa, Genoa, Italy

when data were analyzed on the basis of the AGT and AT1Genetic polymorphism of the renin-angiotensin system andgenotypes, respectively. Potentially unfavorable combinationsorgan damage in essential hypertension.of genotypes were also investigated by K-means cluster analy-Background. The renin-angiotensin-aldosterone systemsis. Two subgroups of patients were identified (cluster 1, N 5(RAAS) plays a significant role in the development of hyper-70; cluster 2, N 5 57), and each differed significantly withtensive cardiac and vascular remodeling. Recently, several ge-

netic variants of its key components, which may be clinically regards to the presence and degree of TOD and patterns ofrelevant and thus prove to be useful in the evaluation of cardio- RAAS gene polymorphisms (F, 15.97 for ACR; F, 7.19 forvascular risk, have been described. We therefore investigated IMT; F, 217.03 for LVMI; F, 3.91 for ACE; F, 4.06 for AGT;the association between ACE I/D, AGT M235T, and AT1 and F, 5.22 for AT1; df 1 to 214, P , 0.02, for each one of theA1266C gene polymorphisms and early signs of target organ variables examined).damage in 215 untreated patients with essential hypertension Conclusion. The D allele of the ACE gene may be an inde-(EH). pendent risk factor for the development of target organ dam-

Methods. Genotyping was based on the polymerase chain age, and evaluating it could be useful for assessing cardiovascularreaction technique, with further restriction analysis when re- risk in EH. Unfavorable patterns of RAAS genotypes seem toquired. Albuminuria was measured as the albumin-to-creati- predispose patients to subclinical cardiovascular disease in EH.nine ratio (ACR). The left ventricular mass index (LVMI) wasassessed by echocardiography (LVH 5 LVMI $ 125 g/m2),carotid wall thickness (IMT) by an ultrasonographic (US) scan,

Genetic variants of several key components of theand retinal vascular changes by direct ophthalmoscopy (Keith–Wagener classification). renin-angiotensin-aldosterone system (RAAS) have been

Results. The prevalence of microalbuminuria (Mi), LVH, described [1–3], which may be biologically and clinicallyand retinal vascular changes was 14, 46, and 74%, respectively. relevant and, by means of various mechanisms, may in-ACE, AGT, and AT1 genotype distribution was in agreement

fluence the activity of the system both at the circulatorywith the Hardy–Weinberg equilibrium. There was no differ-ence in age, duration of disease, body mass index (BMI), blood and tissue levels. In particular, an insertion/deletion (I/D)pressure, and lipid profile when data were analyzed on the basis polymorphism in intron 16 of the angiotensin-convertingof genotype. Serum levels of angiotensin-converting enzyme enzyme (ACE) gene is strongly associated with plasma(ACE) were related to the ACE genotype (10.2 6 0.5, DD;

and cellular ACE levels [2, 4] and has been suggested8.2 6 0.3, ID; 6.5 6 0.4 IU/mL, II; P , 0.0001 by analysis ofas a risk factor for the development and/or progression ofvariance). The ACE genotype independently influences serum

ACE levels and accounts for approximately 14% of its varia- several cardiovascular diseases, including left ventriculartions (F 5 26.7, r 2 5 0.1393, df 1 to 214, P , 0.0001). Patients hypertrophy (LVH) [5–7] and ischemic heart diseasewith DD and ID genotypes showed higher levels of ACR (1.59 6 [8–10], carotid atherosclerosis [11], cerebrovascular dis-0.2, DD 1 ID; 0.8 6 0.2 mg/mmol, II; P , 0.006 by ANOVA)

ease [12], as well as diabetic [13] and nondiabetic renaland bigger LVMI (124.1 6 2.3, DD 1 ID vs. 117.8 6 3.6g/m2, II; P , 0.01 by ANOVA). No differences in the preva- disease [14], although some studies have yielded con-lence and degree of target organ damage (TOD) were found flicting results. Similarly, an association has also been

reported among the M235T angiotensinogen (AGT)gene polymorphism, plasma AGT levels [3, 15], and aKey words: renin-angiotensin-aldosterone system, cardiovascular dis-

ease, blood pressure, microalbuminuria, ACE gene. number of unfavorable clinical features such as earlyonset of essential hypertension [16], coronary heart dis-

Received for publication March 26, 1999ease [17], higher blood pressure levels in patients withand in revised form July 22, 1999

Accepted for publication September 9, 1999 diabetic nephropathy [18], and faster progression towardend-stage renal disease in patients with IgA nephropathy 2000 by the International Society of Nephrology

561

Pontremoli et al: RAAS genes and hypertensive organ damage562

[19]. Finally, a variant in the gene encoding subtype 1 complete physical examination and routine biochemicalanalyses of blood and urine, as well as an assessmentof the angiotensin II type 1 receptor (AT1R), correspond-

ing to an adenine to cytosine (A→C) transversion at of the presence and extent of target organ damage. Adiagnosis of essential hypertension was made in all casesnucleotide position 1166 of the mRNA sequence has

been described and reported to be associated with essen- by the attending physician, and additional testing wasperformed only when signs or symptoms suggesting sec-tial hypertension [20] and vascular stiffness [21].

The RAAS plays an important role in the develop- ondary hypertension were present. Hypertension wasdefined according to fifth Joint Committee on Detection,ment of hypertensive end-organ damage not only as a

key regulator of both blood pressure and sodium homeo- Evaluation and Treatment of High Blood Pressure crite-ria as an average blood pressure $ 140/90 mm Hg onstasis, but also as a modulator of vascular tone and struc-

ture and of cardiac and renal tissue remodeling [22]. at least three different occasions or by the presence ofantihypertensive treatment. Twenty-four–hour urinaryThese effects are primarily mediated by the final product

of its enzymatic cascade, that is, angiotensin II, which has collection was obtained from each subject on the dayprior to the study to assess dietary sodium intake. Allbeen shown to promote cellular growth, and interstitial

matrix deposition by multiple mechanisms [23]. The im- patients were on a free, salt-unrestricted diet at the timeof the study. They had never been treated for hypertensionportance of the RAAS in the development of renal and

cardiovascular damage is also supported by several stud- (N 5 173, 80%) or had been taken off therapy at leastfour weeks prior to the study (N 5 42, 20%). On theies, pointing out the beneficial effect that inhibiting this

system has on the development and progression of these study day, blood pressure was measured on the right armby a trained nurse, with the patient in the sitting positioncomplications [24].

Thus, studying the potential connections between ge- after a five-minute rest, with a mercury sphygmomanome-ter (cuff size 12.5 3 40 cm). The systolic and diastolicnetic variants of the RAAS components, which might

influence the local availability of angiotensin II, and tar- blood pressures were read to the nearest 2 mm Hg. Thedisappearance of Korotkoff’s sounds (phase V) was theget organ damage is of great importance and could pro-

vide a useful clinical tool not only in the stratification criterion for diastolic blood pressure. The lowest of threeconsecutive readings was recorded. Body mass indexof cardiovascular risk, but also in devising therapeutic

strategies in hypertensive patients. Previous studies by (BMI) was calculated using the formula: BMI 5 weight(kg)/height (m2). Creatinine, blood urea nitrogen, elec-ourselves [25] and other authors [26] indicate that hyper-

tensive patients with the ACE DD polymorphism show trolytes, uric acid, triglycerides, total and high-densitylipoprotein (HDL) cholesterol, and other standardan increased prevalence of microalbuminuria, which is

a well-established, integrated marker of end organ chemistry evaluations were performed on serum ac-cording to routine methods. Low-density lipoproteindamage.

The present study was therefore set up to evaluate (LDL) cholesterol was calculated using Friedewald’s for-mula [27], and creatinine clearance (CCr) was calculatedthe relationship between genetic RAAS polymorphisms,

namely ACE I/D, AGT M235T, and AT1R A1166C, and using Cockroft’s formula [28]. Serum ACE activity wasmeasured in duplicate by the colorimetric method basedearly signs of cardiovascular damage in patients with

essential hypertension. on the quinoneimine dye produced from the substratep-hydroxyhippuryl-l-histidyl-l-leucine [29].

A family history of hypertension was ascertained byMETHODS

means of a standardized questionnaire and was definedPatients as a diastolic blood pressure of greater than 90 mm Hg

or blood pressure elevation requiring antihypertensiveFrom January 1996 to January 1997, 215 consecutivepatients with essential hypertension attending the outpa- therapy occurring in a parent or sibling. Smoking was

graded using a five-point scale: nonsmoker, ex-smoker,tient clinic of our department were asked to take partin this clinical study, which was approved by the ethical smoking 1 to 14 g/day, smoking 15 to 25 g/day, or smoking

more than 25 g/day (1 cigarette 5 1 g).committee of our institution. Patients with neoplastic,hepatic, and/or renal disease, chronic heart failure

Assessment of RAAS genotypes(NYHA class III and IV), diabetes mellitus, renal failure(defined as serum creatinine $124 mmol/L males, $106 DNA was isolated from frozen whole blood containing

ethylenediaminetetraacetic acid (EDTA) as an anticoag-mmol/L females), severe obesity (defined as body weight.150% of ideal body weight according to the 1983 Met- ulant by a standard salting-out procedure and resus-

pended in a TE (10 mmol/L Tris/1 mmol/L EDTA, pHropolitan Life Insurance Company tables), disabling dis-eases such as dementia, or inability to cooperate were 7.6) buffer. Genomic DNA (0.25 mg) was amplified by

the polymerase chain reaction in a 50 mL reaction mix-excluded from the study. Written informed consent wasobtained from each participant. All patients underwent ture containing 10 mmol/L Tris-HCl, pH 8.8, 50 mmol/L

Pontremoli et al: RAAS genes and hypertensive organ damage 563

KCl, 1.5 mmol/L MgCl2, 0.1% Triton X-100, 200 mmol/L 63 normal subjects recruited from among the staff of ourhospital. To account for differences in basal creatinineeach of dATP, dCTP, dGTP, and dTTP, 0.12 mmol/L

each primer, and 0.5 U thermostable DNA polymerase excretion rates and BMI, different criteria were used todefine microalbuminuria in men (ACR between 2.38(Dynazyme, Espoo, Finland). The primer pairs used and

the annealing temperatures were the following: for the and 19) and women (ACR between 2.96 and 20). Thesecriteria proved to have good sensitivity and specificityACE I/D polymorphism, forward 59CTGGAGACCAC

TCCCATCCTTTCT39 and reverse 59GATGTGGCCA for the detection of an albumin excretion rate betweenTCACATTCGTCAGAT39, 588C, which amplify the in- 20 and 200 mg/min [32]. The intra-assay and interassaytron 16 region where the I/D fragment is located [30] variabilities of the method in our laboratory were 4.5and, to avoid ID/DD mistyping, a pair of primers that and 6.1%, respectively.produce an amplified product only in the presence of

Echocardiographythe insertion [9], forward 59TGGGACCACAGCGCCCGCCACTAC39 and reverse 59TCGCCAGCCCTCC All echocardiographic studies were performed usingCATGCCCATAA39, 678C; for the AGT M235T poly- an Acuson XP-128 ultrasound machine. Echocardio-morphism, forward 59CAGGGTGCTGTCCACACTG grams were obtained at rest with patients supine in theGACCCC39 and reverse 59CCGTTTGTGCAGGGCC left lateral position, using standard parasternal and apicalTGGCTCTCT39, 678C; for the AT1 receptor, forward views. The overall monodimensional left ventricular59AGAAGCCTGCACCATGTTTTGAG39 and reverse measurements and the bidimensional (apical four and59CCTGTTGCTCCTCTAACGATTTA39, 618C. Am- two chamber) views were obtained according to the rec-plification was obtained after the following steps were ommendations of the American Society of Echocardiog-carried out: five minutes of denaturation at 958C, fol- raphy [33, 34]. All tracings were obtained and read bylowed by 30 one-minute cycles at 948C, one minute at a single observer who was blinded to the clinical charac-annealing temperature, and two minutes of DNA synthe- teristics of the patients under observation. Left ventricu-sis at 728C, followed by 10 minutes at 728C. In any given lar mass was derived using the formula described byset of reactions, a negative control containing no genomic Devereux et al [35]:DNA and a positive control of known genotype were

LV mass (grams) 5 0.80 3 1.04 [(VSTd 1 LVIDdalways included. For the AGT M235T polymorphism,primer-induced restriction analysis with AspI enzyme 1 PWTd)3 2 (LVIDd) 3] 1 0.6was performed as previously reported [31]. The AT1-

where VSTd is ventricular septal thickness at the endreceptor A1166C polymorphism was assayed by restric-diastole, LVIDd is the LV internal dimension at thetion analysis of the PCR product with the DdeI enzymeend diastole, and PWTd is left ventricular posterior wall[20]. All samples were visualized after electrophoresisthickness at the end diastole. Left ventricular mass wason a 2% agarose gel and ethidium bromide staining.corrected for body surface area (LVMI) and was ex-Genotyping was performed in a blinded fashion.pressed in units of g/m2. The presence of LVH was de-

Albuminuria fined for LVMI $ 125 g/m2 in either gender [36, 37]. Nopatient showed dyssynergic areas that would invalidateUrinary albumin excretion was evaluated at the endthe theoretical assumptions behind the cardiac mass cal-of the wash out period, if any, as the albumin-to-creati-culations.nine ratio (ACR) on three nonconsecutive first-morning

samples in the presence of a negative urine culture.Common carotid ultrasonographic scanWhenever a positive urine culture was found, urine sam-

The intima plus media thickness (IMT) of both carotidples were discarded, appropriate antibacterial treatmentarteries was evaluated by a high-resolution ultrasono-instituted, and collections for albuminuria repeated onlygraphic (US) scan as described by Kawagishi et al [38].after a second culture tested negative. The ACR wasCarotid arteries were investigated in the longitudinal andcalculated as urine albumin concentration (mg/L)/urinethe transverse projections by high-resolution real-timecreatinine concentration (mmol/L). Creatinine levelsultrasonography using a 10 MHz in-line duplex Diasonicwere determined by the routine Jaffe reaction and albu-Spectra System. The carotid artery was scanned at themin concentration by a commercially available radioim-bifurcation and at the common carotid artery (CCA).munoassay kit (Sclavo, Cinisello). The average (arithme-At each longitudinal projection, the far-wall IMT, astic mean) of three urine collections was taken as the ACRdefined by Weldelhag, Wiklund, and Wikstrand [39], wasfor each patient. Normal values of albumin excretion, asmeasured at the distal end of the CCA, 10 mm caudallypreviously defined in our laboratory, were obtained byto the point where the near and far walls lose theirsimultaneously measuring both the albumin excretionparallel configuration. Carotid plaque was defined asrate in timed overnight urine collections and the ACR

in first-morning urine samples within the same group of IMT . 1.3 mm. IMT was always measured on the CCA


Table 1. Clinical characteristics of 215 patientsoutside the plaque, if any was present. Each measure-with essential hypertension

ment was calculated taking the averages of three read-Rangeings.

N men/women 133/82SBP mm Hg 16061.1 125–230Retinal vascular changesDBP mm Hg 10360.6 80–140

The presence, type, and extent of hypertensive reti- MBP mm Hg 12260.6 103–163Age years 4860.6 21–65nopathy were investigated in a darkened room and underBMI kg/m2 2660.2 17–38pupil dilation. Direct ophthalmoscopy was carried outFamily history of Ht % 68

with a halogen ophthalmoscope. The first arteriovenous Duration of disease mos 5163.5 2–240Serum glucose mg/dL 9060.8 62–115crossing at least one disc in diameter from the disc inSerum uric acid mg/dL 5.260.1 1.8–9.4each quadrant was selected and assessed. Each quadrantSerum creatinine mg/dL 0.960.01 0.5–1.4

of the fundus was photographed by means of a Zeiss Creatinine clearancea mL/min 8761.6 54–167Triglycerides mg/dL 12664.9 39–369fundus camera with a 308 field. Photographic slides wereTotal cholesterol mg/dL 21563 102–332projected and evaluated by the same ophthalmologistLDL cholesterol mg/dL 13863 9–245

who was unaware of the patients’ clinical data. Retinal HDL cholesterol mg/dL 5161.1 21–100Smokers % 61features sought were venule nipping, venule deviation,ACR mg/mmol 1.5360.2 0.1–19and light reflex change at all clearly visualized crossingsPrevalence of Mib % 14

with comparably sized arterioles at least one disc in diam- LVMI g/m2 12362 48–213LVHc % 46eter from the disc. The mean ratio of diameters of equiva-Carotid IMT mm 0.6860.02 0.3–1.25lent order arterioles and venules in each quadrant wasRetinal changes % 74

measured, and the presence of focal arteriolar nar-Data are mean 6 sem. Abbreviations are: Ht, hypertension; Mi, microalbumi-rowing, hemorrhages, exudates, and papilledema was nuria; LVMI, left ventricular mass index; LVH, left ventricular hypertrophy as

evaluated by echocardiogram; IMT, intima plus media thickness; MBP, meansought. Retinal lesions were classified according to theblood pressure.Keith–Wagener–Barker classification [40]. a Calculated using Cockroft’s formula [(1402age) · lean body mass (kg)/(serumcreatinine · 72)], in women the value was further multiplied by 0.85

Statistical analysis

All data are expressed as mean 6 sem. Differencesamong variables were assessed using the appropriate

clustering procedure is to classify patients in clustersstatistical test based on the underlying distribution of thewith the smallest within-group variability and the biggestvariables [41]. One-way analysis of variance (ANOVA)between-group variability for any given set of variables.with the Bonferroni test or Tukey multiple comparisonPatients within the same cluster show similar values forpost-test was used to analyze data from patients withthe variables taken into consideration, while differingdifferent genotypes and with/without organ damage.from patients in the other cluster for those same vari-Variables found to deviate from normality were eitherables. The algorithm will start with k random clusters,log transformed or a nonparametric test (Kruskal-Wallis)and then move cases in and out of clusters in an attemptwas applied. Relationships among variables were as-to (a) minimize variability within clusters and (b) max-sessed using linear regression analysis and Pearson’s cor-imize variability between clusters. This is analogous torelation coefficient. Comparisons of proportion between“ANOVA in reverse” in the sense that the significancegroups were performed using the chi-square test. Multi-test in ANOVA evaluates the between-group variabilityple regression analysis was performed to assess the inde-against the within-group variability when computingpendent contribution of several variables, includingthe significance test for the hypothesis that the meansRAAS polymorphisms. The relationship between genein the groups are different from each other. To evaluatepolymorphism and organ damage was evaluated takingthe appropriateness of classification, the within-clusterinto consideration various models of inheritance (addi-variability (small if the classification is good) is comparedtive, dominant, and recessive). Grouping of heterozy-

gotes and homozygotes for I/D polymorphism was per- with the between-cluster variability (large if the classifi-formed to evaluate the relationship of the D allele with cation is good); that is, a standard between-group analy-quantitative variables such as ACR and LVMI according sis of variance for each variable is performed [42]. Allto a dominant model of inheritance (for example, with statistical analyses were performed using SPSS, Releasescores of 0 for II and 1 for ID and DD combined). 6.1. A P , 0.05 was considered statistically significant.Multivariate (k-mean cluster) analysis was performedon the entire cohort of patients to identify subgroups

RESULTS(clusters) of patients on the basis of the presence andClinical characteristics of study patients are reportedseverity of target organ damage and various patterns of

RAAS gene polymorphisms. The goal of the K-means in Table 1. The prevalence of different genetic polymor-


phisms of the RAAS genes in our study patients was thefollowing: DD 32, ID 53, II 15% for the ACE gene; MM28, MT 49, TT 23% for the AGT gene; and AA 50, AC45, CC 5% for the AT1R gene. All genotypes distribu-tions were in Hardy–Weinberg equilibrium (Table 1).There was an overall frequency of 58% for the D alleleand 42% for the I allele of the ACE gene, 52 and 48%for M and T alleles at position 235 of the AGT gene,and finally 72 and 28% for A and C at position 1166 ofthe AT1R gene. All of these calculations compare closelywith those of a control group of healthy, volunteer blooddonors of our hospital (N 5 56, age 51 6 0.9; ACE gene:DD 30, ID 54, II 16%; AGT gene: MM 26, MT 50, TT24%; AT1R gene: AA 48, AC 46, CC 6%), as well aswith other Caucasian populations [42].

There were no differences in age, prevalence of familyhistory for hypertension, current smokers, known dura-tion of disease, BMI, blood pressure, serum glucose, uricacid, and lipid profile when patients were grouped onthe basis of the three RAAS genotypes (data not shown).

The overall prevalence of end organ damage, namelymicroalbuminuria, retinal vascular changes, and LVHwas 14, 74, and 46%, respectively. The overall prevalenceof carotid plaque was 25%.

Serum levels of ACE were higher in DD as comparedwith ID and II patients (10.2 6 0.5, DD; 8.2 6 0.3, ID;6.5 6 0.4 IU/mL, II; P , 0.0001 by ANOVA), as wasexpected on the basis of genetic codominance. Multiplelinear regression analysis showed that the ACE genotypesignificantly influences serum ACE levels and accounts Fig. 1. Urinary albumin excretion (A) and left ventricular mass index

(B) in hypertensive patients with and without the D allele of the angio-for approximately 14% of its variations (F 5 26.7, r 2 5tensin converting enzyme (ACE) gene. P , 0.01 for albumin-to-creati-0.145, df 1 to 214, P , 0.0001). nine ratio (ACR) and P , 0.01 for left ventricular mass index (LVMI).

Patients with the DD genotype showed significantly Data are mean 6 sem.higher ACR levels than II patients (1.8 6 0.4, DD; 0.8 60.2 mg/mmol, II; P 5 0.03). An association of the Dallele with higher urinary albumin excretion was also

Overall, no difference in the prevalence and degreeevident when pooled data from patients with the D alleleof different signs of target organ damage was found when(DD 1 ID) were compared with II patients (1.59 6 0.2,the patients’ characteristics were analyzed on the basisDD 1 ID; 0.8 6 0.2 mg/mmol, II; P , 0.01 by analysisof M/T polymorphism both when considering the threeof variance; Fig. 1A).genotypes separately and when heterozygotic patientsNo difference was found in the prevalence of LVH,were grouped either with MM or TT patients.evaluated either by electrocardiogram (ECG) or by

No association was detected between A/C polymor-echocardiogram (data not shown), in patients with differ-phism and the presence and degree of end organ damageent genotypes of the ACE gene. However, patients within the study population, except for a greater LVMI inDD and ID genotypes showed significantly higher LVMIpatients with the AC and CC genotypes, as comparedas compared with II patients (124.1 6 2.3, DD 1 ID vs.with those with the AA genotype (P , 0.05). However,117.8 6 3.6 g/m2, II; P , 0.01 by ANOVA; Fig. 1B).this difference was largely due to age differences be-Furthermore, when data were analyzed on the basis oftween the two groups, as indicated by results of ANOVALVMI, patients in the top quartile showed a greaterperformed on LVMI by the AT1R genotype, taking ageprevalence of the D allele as compared with the rest ofas a covariate (covariate: age, F 15.41, P , 0.001; mainthe study population (68 vs. 54%, P 5 0.016, OR 5 1.85,effect: AT1R, F 2.499, P 5 0.116).CI, 1.13 to 3.03). No association was found between ACE

To further investigate the relationship between combi-genotypes and either the prevalence of retinal vascularnations of RAAS polymorphisms and target organ dam-changes or the degree of common carotid intima plus

media thickness. age, k-means cluster analysis was applied to data from


the entire study population. Two subgroups of patients findings, showing that a significant part of plasma ACElevels are under genetic control, confirm those by Rigatwere identified (cluster n8 1, N 5 70 and cluster n8 2,

N 5 57), differing significantly from each other by the et al [1], even though in this study the magnitude ofvariations in serum ACE activity accounted for by I/Dpresence and severity of several features of target organ

damage (that is, albuminuria, carotid IMT, and LVMI), polymorphism is considerably lower.Data reported here confirm and extend earlier prelimi-as well as by patterns of RAAS gene polymorphisms.

Besides showing higher blood pressure levels and BMI nary reports by our group [25] and others [26], indicatingthat the ACE DD polymorphism is a risk factor for(P , 0.05), patients with more severe involvement of

target organs were more likely to carry a combination microalbuminuria and possible later development ofclinically relevant hypertensive renal damage. The rela-of the ACE D, AGT T, and AT1R C alleles (P , 0.05

for each one of the variables examined by multimethod, tionship between ACE I/D polymorphism and left ven-tricular mass is a somewhat more controversial issue.between-group ANOVA, and contrast analysis). The re-

sults not only show that different signs of end organ Although some cross-sectional studies failed to detectany association between mutations in the ACE gene anddamage cluster within the same subgroup of patients but

also, and most intriguingly, that subclinical cardiovascu- echocardiographically determined LVMI, a recent studyperformed on a group of twins demonstrated that a sig-lar damage tends to be associated with potentially unfa-

vorable patterns of the RAAS genes. nificant quantity of LVM variation is under the influenceof the ACE gene [46]. These discrepancies are likelydue, at least in part, to the heterogeneity of the genetic

DISCUSSIONbackground of some study populations and sometimes

The RAAS genes are potential etiological candidates to inadequate sample size or to differences in clinicalfor cardiovascular damage because through modulation characteristics (that is, hypertensive and normotensiveof both circulating and tissue actions of angiotensin II, subjects). Indeed, a recent review of the literature indi-they might exert a significant effect on vascular remodel- cates that the ACE gene polymorphism may be a risking. Our results show that the ACE I/D polymorphism factor for the development of LVH [45].is associated to silent end-organ damage in patients with The AGT locus on chromosome 1q has been impli-essential hypertension, namely increased urinary albu- cated as a candidate region for blood pressure-determin-min excretion and left ventricular mass index (LVMI). ing genes in several studies. However, other studies haveFurthermore, this study suggests that potentially unfa- failed to confirm any association between the M235Tvorable combinations of RAAS polymorphisms such as polymorphism and the hypertensive phenotype [47].ACE DD, AGT TT, and AT1R AC/CC could synergisti- Nevertheless, it has been demonstrated that this poly-cally affect the development of hypertensive-atheroscle- morphism is a marker for AGT production, with carriersrotic cardiovascular disease. Although the link between of the T235 variant showing, on average, higher plasmathese RAAS gene polymorphisms and the development levels of AGT [48]. Furthermore, the homozygosity forof cardiovascular disease remains elusive, the observa- the T allele might be clinically relevant because thesetion that polymorphisms in the ACE and AGT genes patients have been reported to show greater blood pres-act as markers for interindividual variations in the sure decreases when treated with ACE-I, thus suggestingplasma and possibly cellular levels of their respective that differences in plasma AGT levels might affect theprotein products [2, 16] suggests a mechanism by which degree of the RAAS activation and in turn influencegenotype might have a bearing on the physiology of the the formation rate of angiotensin II [49]. Our study,renin-angiotensin axis. however, failed to demonstrate a direct association of

Several studies have shown an association between the T allele with any hypertensive end-organ damageACE DD and ID genotypes and a large series of cardio- taken into consideration, thus confirming and expandingvascular diseases ranging from ischemic heart disease the previous report by Fernandez-Llama et al [47].and LVH to cerebral and peripheral vascular disease, as The AT1R A/C polymorphism is located in the 39 un-well as to the susceptibility and rate of progression of translated region of the gene [20] and is apparently arenal damage [44]. However, some other studies failed nonfunctional mutation. However, it may be linked toto demonstrate a significant association between genetic an unidentified functional mutation in the AT1R genevariations and clinically relevant end points [45]. or in another strictly linked gene that plays a major role

Although observational studies such as this one cannot in the development or progression of vascular damagebe used to define pathophysiological mechanisms, it is [50]. After an initial report by Tiret et al indicating thatreasonable to assume that the influence the ACE gene this polymorphism had a synergistic effect with ACE DDhas on hypertensive target organ damage might be medi- genotype in conveying an increased risk for myocardialated by genotype-dependent differences in renin-angio- infarction [51], Benetos et al suggested that it may be

responsible for increased aortic vascular stiffness, whichtensin system activity, possibly at the tissue level. Our


Table 2. Cluster analysis of target organ damage and renin-angiotensin-aldosterone (RAAS) gene polymorphisms

Descriptive statistics

Analysis of varianceCluster n8 1 (N 5 70) Cluster n8 2 (N 5 57)

Variable Mean SD Variance Mean SD Variance Between SS Within SS F P

ACR 0.75157 1.27848 1.63452 2.8493 4.15938 17.3004 138.251 1081.6 15.9775 0.000109IMT 0.63786 0.17413 0.03032 0.73158 0.21705 0.04711 0.27596 4.73034 7.29236 0.007885LVMI 101.101 15.0482 226.448 144.189 17.9137 320.901 58329 33595.4 217.028 0.00000ACE 0.87143 0.33714 0.11366 6.14035 22.3211 498.23 872.193 27908.7 3.90645 0.050303AGT 0.67143 0.47309 0.22381 6.05263 22.3434 499.229 909.762 27972.3 4.06546 0.045912AT1R 0.45714 0.50176 0.25176 7.45614 25.6543 658.145 1539.01 36873.5 5.21719 0.024052

Among the entire study population, two subgroups of patients were identified (cluster n81 and n82), differing significantly from each other by the presence andseverity of several features of target organ damage (that is, albuminuria, carotid IMT and LVMI) as well as by patterns of RAAS gene polymorphisms (P , 0.05for each one of the variables examined by multimethod, between group ANOVA, and contrast analysis). Degrees of freedom are 1 to 125. Abbreviations are: ACR,albumin-to-creatinine ratio; IMT, intima plus media thickness; LVMI, left ventricular mass index; ACE, angiotensin converting enzyme; AGT, angiotensinogen;AT1R, angiotensin II type 1 receptor antagonist.

can be selectively attenuated by treatment with ACE-I factors could determine the development of target organdamage in essential hypertension.[52]. Subsequently, it was reported that this polymor-

Although these results must be taken with cautionphism contributes to blood pressure variations [53] andbecause of the small sample size and potential bias inis involved in the development of coronary artery steno-the selection of patients, from a clinical perspective, theysis [54] and LVH in normotensive subjects [55]. How-imply that genotyping for the RAAS genes could becomeever, in a study of 212 subjects randomly selected froma useful tool in the clinical process of cardiovascularthe general population, Castellano et al failed to detectrisk stratification and possibly in planning therapeuticany relationship between AT1R A/C genotypes and ca-strategies for hypertensive patients.rotid wall thickness or left ventricular mass [56]. Accord-

ingly, our data do not support a major role for this geneticACKNOWLEDGMENTSpolymorphism as a risk factor for end organ damage in

hypertensive patients. We thank Raffaella Lotti, M.D., for performing ophthalmoscopicevaluations and Paola Zagami, M.D., for performing the carotid USAn intriguing additional result of this study is the pos-scan on study patients. The excellent technical assistance of Natiasibility that a given pattern of potentially deleteriousRuello, B.S., and Cinzia Tomolillo, B.S., is also gratefully acknowl-

RAAS genotypes may have a synergistic effect and con- edged.vey increased risk for cardiovascular disease in hyperten-

Reprints request to Giacomo Deferrari, M.D., Department of Internalsive patients. Data supporting a similar hypothesis wereMedicine, University of Genoa, Viale Benedetto XV, 6-16132 Genova,

previously published by Tiret and later by others [4, 57]. Italy.E-mail: [email protected], given the multifactorial pathogenesis of hyper-

tensive vascular damage and the relative weakness ofcase-control studies, a very large sample would certainly REFERENCESbe needed in order to detect a role for a given pattern 1. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P,

Soubrier F: An insertion/deletion polymorphism in the angiotensinof RAAS genes. We therefore set out with a different,I-converting enzyme gene accounting for half the variance of serumintegrated approach and used the K-means cluster analy-enzyme levels. J Clin Invest 86:1343–1346, 1990

sis to identify two subgroups of patients differing not 2. Costerousse O, Allegrini J, Lopez M, Alhenc-Gelas F: Angio-tensin I-converting enzyme in human circulating mononuclearonly in the degree of organ damage involvement butcells: Genetic polymorphism of expression in T-lymphocytes. Bio-also in their genetic patterns of RAAS polymorphisms.chem J 290:33–40, 1993

The two clusters differ significantly from each other for 3. Jeunemaitre X, Soubrier F, Kotelevtsev Y, Lifton R, WilliamsC, Charru A, Hunt S, Hopkins P, Williams R, Lalouel JM,the variables taken into consideration, whereas patientsCorvol P: Molecular basis of human hypertension: The role ofwithin the same cluster show similar values, as indicatedangiotensinogen. Cell 71:169–180, 1992

by ANOVA (Table 2). Thus, our results indicate that 4. Tiret L, Rigat B, Visvikis S, Breda C, Corvol P, Cambien F,Soubrier F: Evidence, from combined segregation and linkagepatients sharing the most unfavorable genetic combina-analysis, that a variant of the angiotensin I converting enzymetions, that is, ACE DD/ID, AGT TT/MT, and AT1R(ACE) gene controls plasma ACE levels. Am J Hum Genet 51:197–

AC/CC, show significantly greater cardiovascular dam- 205, 19925. Schunkert H, Hense HW, Holmer SR, Stender M, Perz S, Keilage, that is, higher urinary albumin excretion, LVMI, and

U, Lorell BH, Riegger GA: Association between a deletion poly-carotid wall thickness. These data suggest that RAASmorphism of the angiotensin converting enzyme gene and left

polymorphisms may take part in the modulation of the ventricular hypertrophy. N Engl J Med 330:1634–1638, 19946. Iwai N, Ohmichi N, Nakamura Y, Kinoshita M: DD genotypesystem, and together with blood pressure and other risk


of the angiotensin converting enzyme gene is a risk factor for left and end-organ protection: Pharmacological rationale and evidence.J Hypertens 16:S3–S9, 1998ventricular hypertrophy. Circulation 90:2622–2628, 1994

25. Pontremoli R, Sofia A, Tirotta A, Ravera M, Nicolella C,7. Lindpaintner K, Lee M, Larson MG, Rao VS, Pfeffer MA,Viazzi F, Bezante GP, Borgia L, Bobola N, Ravazzolo R, Sac-Ordovas JM, Schaefer EJ, Wilson AF, Wilson PWF, Vasanchi G, Deferrari G: The deletion polymorphism of the angiotensinRS, Myers RH, Levy D: Absence of association or genetic linkageI-converting enzyme gene is associated with target organ damagebetween the angiotensin-converting-enzyme gene and ventricularin essential hypertension. J Am Soc Nephrol 7:2550–2558, 1996mass. N Engl J Med 334:1023–1028, 1996

26. Kario K, Kanai N, Nishiuma S, Fujii T, Saito K, Matsuo T,8. Cambien F, Poirier O, Lecerf L, Evans A, Cambou JP, ArveilerMatsuo M, Shimada K: Hypertensive nephropathy and the geneD, Luc G, Bard JM, Bara L, Ricard S: Deletion polymorphismfor angiotensin-converting enzyme. Arterioscler Thromb Vasc Biolin the gene for angiotensin converting enzyme is a potent risk17:252–256, 1997factor for myocardial infarction. Nature 359:641–644, 1992

27. Friedewald WT, Levy RI, Fredrickson DS: Estimation of the9. Lindpaintner K, Pfeffer MA, Kreutz R, Stampfer MJ, Grosteinconcentration of low density lipoprotein cholesterol in plasma with-F, Lamotte F, Buring J, Hennekens CH: A prospective evaluationout use of the preparative ultracentrifuge. Clin Chem 18:499–502,of an angiotensin-converting-enzyme gene polymorphism and the1972risk of ischemic heart disease. N Engl J Med 332:706–711, 1995

28. Cockroft DW, Gault MH: Prediction of creatinine clearance from10. Nakai K, Itoh C, Miura Y, Hotta K, Musha T, Itoh T, Miyakawaserum creatinine. Nephron 16:31–41, 1976T, Iwasaki R, Hiramori K: Deletion polymorphism of the

29. Kasahara Y, Ashihara Y: Colorimetry of angiotensin-I con-angiotensin-I converting enzyme gene is associated with serumverting enzyme activity in serum. Clin Chem 27:1922–1925, 1981ACE concentration and increased risk for CAD in the Japanese.

30. Rigat B, Hubert C, Corvol P, Soubrier F: PCR detection of theCirculation 90:2199–2202, 1994insertion/deletion polymorphism of the human angiotensin con-11. Castellano M, Muiesan ML, Rizzoni D, Beschi M, Pasini G,verting enzyme gene (DCP1). Nucleic Acids Res 20:1433, 1992Cinelli A, Salvetti M, Porteri E, Bettoni G, Kreutz R, Lind-

31. Russ P, Maerz W, Ruzicka V, Stein U, Gross W: Rapid detectionpaintner K, Agabiti Rosei E: Angiotensin-converting-enzymeof the hypertension-associated Met235-Thr allele of the humanI/D polymorphism and arterial wall thickness in a general popula-angiotensinogen gene. Hum Mol Genet 2:609–610, 1993tion: The Vobarno Study. Circulation 91:2721–2724, 1995

32. Mangili R, Deferrari G, Di Mario U, Giampietro O, Navalesi12. Catto A, Carter AM, Barrett JA, Stickland M, Bamford J,R, Nosadini R, the Italian Microalbuminuria Study Group:Davies JA, Grant PJ: Angiotensin-converting-enzyme insertion/Prevalence of hypertension and microalbuminuria in adult type 1deletion polymorphism and cerebrovascular disease. Stroke 27:(insulin dependent) diabetic patients without renal failure in Italy:435–440, 1996Validation of screening techniques to detect albuminuria. Acta13. Schmidt S, Schone N, Ritz E, the Diabetic Nephropathy StudyDiabetol 29:156–166, 1992Group: Association of ACE gene polymorphism and diabetic ne-

33. Sahn DJ, Demaria A, Kisslo J, Weyman A: Recommendationsphropathy? Kidney Int 47:1176–1181, 1995regarding quantitation in M-mode echocardiography: Results of a14. McLaughlin KJ, Harden PN, Ueda S, Boulton-Jones M, Con-survey of echocardiographic measurements. Circulation 58:1072–nell JMC, Jardine AG: The role of genetic polymorphisms of 1083, 1978angiotensin-converting-enzyme in the progression of renal disease. 34. Schiller NB, Shah PM, Crawford M, Demaria A, Devereux R,

Hypertension 28:912–915, 1996 Feigenbaum H, Gutgesell H, Reichek N, Sahn D, Schnittger15. Inoue I, Nakajima T, Williams CS, Quackenbush J, Puryear I: Recommendations for quantitation of the left ventricle by two

R, Powers M, Cheng T, Ludwig EH, Sharma AM, Hata A, dimensional echocardiography: American Society of Echocardiog-Jeunemaitre X, Lalouel JM: A nucleoside substitution in the raphy Committee on standards, subcommittee on quantitation ofpromoter of human angiotensinogen is associated with essential two-dimensional echocardiograms. J Am Soc Echocardiogr 2:358–hypertension and affects basal transcription in vitro. J Clin Invest 367, 198999:1786–1797, 1997 35. Devereux RB, Alonso DR, Lutas EM, Gottlieb GJ, Campo E,

16. Caulfield M, Lavender P, Farrall M, Path MRC, Munroe P, Sachs I, Reichek N: Echocardiographic assessment of left ventricu-Lawson M, Turner P, Clark AJL: Linkage of the angiotensinogen lar hypertrophy: Comparison to necropsy findings. Am J Cardiolgene to essential hypertension. N Engl J Med 330:1629–1633, 1994 57:450–458, 1986

17. Katsuya T, Koike G, Yee TW, Sharpe N, Jackson R, Norton R, 36. Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP:Horiuchi M, Pratt RE, Dzau VE, McMahon S: Association of Prognostic implications of echocardiographically determined leftangiotensinogen gene T235 variant with increased risk of coronary ventricular mass in the Framingham heart study. N Engl J Medheart disease. Lancet 345:1600–1603, 1995 322:1561–1566, 1990

18. Tarnow L, Cambien F, Rossing P, Nielsen FS, Hansen BV, 37. Koren MJ, Devereux RB, Casale PN, Savage DD, Laragh JH:Ricard S, Poirier O, Parving H-H: Angiotensinogen gene poly- Relation of left ventricular mass and geometry to morbidity andmorphisms in IDDM patients with diabetic nephropathy. Diabetes mortality in uncomplicated essential hypertension. Ann Intern Med45:367–369, 1996 114:345–352, 1991

19. Yoshida H, Mitarai T, Kawamura T, Kitajima T, Miyazaki Y, 38. Kawagishi T, Nishizawa Y, Konishi T, Kawasaki K, Emoto M,Nagasawa R, Kawaguchi Y, Kubo H, Ichikawa I, Sakai O: Role Shoji T, Tabata T, Inoue T, Morii H: High-resolution B-modeof the deletion of polymorphism of the angiotensin converting ultrasonography in evaluation of atherosclerosis in uremia. Kidneyenzyme gene in the progression and therapeutic responsiveness of Int 48:820–826, 1995IgA nephropathy. J Clin Invest 96:2162–2169, 1995 39. Weldelhag I, Wiklund O, Wikstrand J: Atherosclerotic changes

20. Bonnardeaux A, Davies E, Jeunemaitre X, Fery I, Charru A, in the femoral and carotid arteries in familial hypercholesterolemia:Clauser E, Tiret L, Cambien F, Corvol P, Soubrier F: Angioten- Ultrasonographic assessment of intima-media thickness and plaquesin II type 1 receptor gene polymorphisms in human essential occurrence. Arterioscler Thromb 13:1404–1411, 1993hypertension. Hypertension 24:63–69, 1994 40. Keith NM, Wagener HP, Barker MW: Some different types of

21. Benetos A, Gautier S, Ricard S, Topouchian J, Asmar R, Poirier essential hypertension: Their course and prognosis. Am J Med SciO, Larosa E, Guize L, Safar M, Soubrier F, Cambien F: Influence 197:332–343, 1939of angiotensin II type 1 receptor gene polymorphisms on aortic 41. Snedecor GW, Cochran WG: Statistical Methods. Ames, Amesstiffness in normotensive and hypertensive patients. Circulation Iowa State University Press, 1967, pp 1–45694:698–703, 1996 42. Tryon RC, Bailey D: Cluster Analysis. New York, McGraw-Hill

22. Laragh JH: Renin profiling for diagnosis, risk assessment, and Book, 1970, pp 1–347treatment of hypertension. Kidney Int 44:1163–1175, 1993 43. Staessen JA, Ginocchio G, Wang JG, Saavedra AP, Soubrier

23. Bataineh A, Raij L: Angiotensin II, nitric oxide, and end-organ F, Vlietinck R, Fagard R: Genetic variability in the renin-angio-damage in hypertension. Kidney Int 68(Suppl):S14–S19, 1998 tensin system: Prevalence of alleles and genotypes. J Cardiovasc

Risk 4:401–422, 199724. Unger T, Culman J, Gohlke P: Angiotensin II receptor blockade


44. Berglund L: A recurrent theme with a new spin: ACE polymor- 52. Benetos A, Cambien F, Gautier S, Ricard S, Safar M, LaurentS, Lacolley P, Poirier O, Topouchian J, Asmar R: Influence ofphism and cardiovascular disease. J Lab Clin Med 131:485–486,

1998 the angiotensin II type 1 receptor gene polymorphism on the effectsof perindopril and nitrendipine on arterial stiffness in hypertensive45. Schunkert H: Controversial association of left ventricular hyper-

trophy and the ACE I/D polymorphism: Is the mist clearing up? individuals. Hypertension 28:1081–1084, 199653. Hingorani AD, Jia H, Stevens PA, Hopper R, Dickerson JEC,Nephrol Dial Transplant 13:1109–1112, 1998

46. Busjahn A, Knoblauch H, Knoblauch M, Bohlender J, Menz Brown MJ: Renin-angiotensin system gene polymorphisms influ-ence blood pressure and the response to angiotensin convertingM, Faulhaber HD, Becker A, Schuster H, Luft F: Angiotensin-

converting enzyme and angiotensinogen gene polymorphisms, enzyme inhibition. J Hypertens 13:1602–1609, 199554. Nakauchi Y, Suehiro T, Yamamoto M, Yasuoka N, Arii K, Ku-plasma levels, cardiac dimensions: A twin study. Hypertension

29:165–170, 1997 mon Y, Hamashige N, Hashimoto K: Significance of angiotensinI-converting enzyme and angiotensin II type 1 receptor gene poly-47. Fernandez-Llama P, Poch E, Oriola J, Botey A, Rivera F,

Revert L: Angiotensinogen gene M235T and T174M polymor- morphisms as risk factors for coronary heart disease. Atherosclero-sis 125:161–169, 1996phisms in essential hypertension: Relation with target organ dam-

age. Am J Hypertens 11:439–444, 1998 55. Takami S, Katsuya T, Rakugi H, Sato N, Nakata Y, KamitaniA, Miki T, Higaki J, Ogihara T: Angiotensin II type 1 receptor48. Bloem LJ, Foroud TM, Ambrosius WT, Hanna MP, Tewksbury

DA, Pratt JH: Association of the angiotensinogen gene to serum gene polymorphism is associated with increase of left ventricularmass but not with hypertension. Am J Hypertens 11:316–321, 1998angiotensinogen in blacks and whites. Hypertension 29:1078–1082,

1997 56. Castellano M, Muiesan ML, Beschi M, Rizzoni D, Cinelli A,Salvetti M, Pasini G, Porteri E, Bettoni G, Zulli R, Agabiti-49. Hopkins PN, Lifton RP, Hollenberg NK, Jeunemaitre X, Hal-

louin MC, Skuppin J, Williams CS, Dluhy RG, Lalouel JM, Rosei E: Angiotensin II type 1 receptor A/C1166 polymorphism:Relationships with blood pressure and cardiovascular structure.Williams RR, Williams GH: Blunted renal vascular response to

angiotensin II is associated with a common variant of the angioten- Hypertension 28:1076–1080, 199657. Marre M, Jeunemaitre X, Gallois Y, Rodier M, Chatellier G,sinogen gene and obesity. J Hypertens 14:199–207, 1996

50. van Geel PP, Pinto YM, Bulkema H, van Gilst WH: Is the Sert C, Dusselier L, Kahal Z, Chaillous L, Halimi S, MullerA, Sackmann H, Bauduceau B, Bled F, Passa P, Alhenc-GelasA1166C polymorphism of the angiotensin II type 1 receptor in-

volved in cardiovascular disease? Eur Heart J 19(Suppl G):G13– F: Contribution of genetic polymorphism in the renin angiotensinsystem to the development of renal complications in insulin depen-G17, 1998

51. Tiret L, Bonnardeaux A, Poierier O, Ricard S, Marques-Vidal dent diabetes. J Clin Invest 99:1585–1595, 199758. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P,P, Evans A, Arveiler D, Luc G, Kee F, Ducimetiere P, Soubrier

F, Cambien F: Synergistic effects of angiotensin-converting enzyme Soubrier F: An insertion/deletion polymorphism in the angiotensinI-converting enzyme gene accounting for half the variance of serumand angiotensin-II type 1 receptor gene polymorphisms on risk of

myocardial infarction. Lancet 344:910–913, 1994 enzyme levels. J Clin Invest 86:1343–1346, 1990

genetic polymorphism of the renin-angiotensin system and organ damage in essential hypertension

Documents