infection exposure promotes etv6-runx1 precursor b-cell ... · tumor and stem cell biology...

Tumor and Stem Cell Biology

Infection Exposure Promotes ETV6-RUNX1Precursor B-cell Leukemia via Impaired H3K4DemethylasesGuillermo Rodríguez-Hern�andez1,2, Julia Hauer3, Alberto Martín-Lorenzo1,2,Daniel Sch€afer3, Christoph Bartenhagen4, Idoia García-Ramírez1,2, Franziska Auer3,In�es Gonz�alez-Herrero1,2, Lucia Ruiz-Roca1,2, Michael Gombert3, Vera Okpanyi3,Ute Fischer3, Cai Chen3, Martin Dugas4, Sanil Bhatia3, Ren�e Martin Linka3,Marta Garcia-Suquia5, María Victoria Rasc�on-Trincado5, Angel Garcia-Sanchez5,6,Oscar Blanco2,7, Maria Bego~na García-Cenador2,8, Francisco Javier García-Criado2,8,C�esar Cobaleda9, Diego Alonso-L�opez10, Javier De Las Rivas2,10,11, Markus M€uschen12,Carolina Vicente-Due~nas2, Isidro S�anchez-García1,2, and Arndt Borkhardt3

Abstract

ETV6-RUNX1 is associated with the most common subtype ofchildhood leukemia. As few ETV6-RUNX1 carriers develop pre-cursor B-cell acute lymphocytic leukemia (pB-ALL), the underly-ing genetic basis for development of full-blown leukemia remainsto be identified, but the appearance of leukemia cases in time-space clusters keeps infection as a potential causal factor. Here,we present in vivo genetic evidence mechanistically connectingpreleukemic ETV6-RUNX1 expression in hematopoetic stemcells/precursor cells (HSC/PC) and postnatal infections forhuman-like pB-ALL. In our model, ETV6-RUNX1 conferred alow risk of developing pB-ALL after exposure to common patho-gens, corroborating the low incidence observed in humans.Murine preleukemic ETV6-RUNX1 pro/preB cells showed high

Rag1/2 expression, known for human ETV6-RUNX1 pB-ALL.Murine and human ETV6-RUNX1 pB-ALL revealed recurrentgenomic alterations, with a relevant proportion affecting genesof the lysine demethylase (KDM) family. KDM5C loss of functionresulted in increased levels of H3K4me3, which coprecipitatedwith RAG2 in a human cell linemodel, laying themolecular basisfor recombination activity. We conclude that alterations of KDMfamily members represent a disease-driving mechanism and anexplanation for RAG off-target cleavage observed in humans.Our results explain the genetic basis for clonal evolution of anETV6-RUNX1 preleukemic clone to pB-ALL after infection expo-sure and offer the possibility of novel therapeutic approaches.Cancer Res; 77(16); 4365–77. �2017 AACR.

Introduction

Childhood B-cell precursor-acute lymphoblastic leukemia(pB-ALL) arises from interactions between genetic (inherited)susceptibility and exogenous exposures. The ETV6-RUNX1 fusiongene is the most common chromosomal alteration in pediatriccancer and occurs in approximately 25% of childhood pB-ALL(1, 2). This fusion gene is one of the most extreme examples of

genotype–phenotype association. Its presence is only associatedwith pB-ALL and it seems to confer a low risk of developing thisleukemia. Secondary genetic events are required for a pB-ALLevolving from an ETV6-RUNX1 preleukemic clone. Studies ontwins with concordant ALL have revealed that ETV6-RUNX1 genefusion represents the first event ("hit") in the process of leuke-mogenesis, creating a preleukemic clone, which requires second-ary postnatal genetic aberrations (3–5). This is further supported

1Experimental Therapeutics and Translational Oncology Program, Instituto deBiología Molecular y Celular del C�ancer, CSIC/Universidad de Salamanca,Campus M. de Unamuno s/n, Salamanca, Spain. 2Institute of BiomedicalResearch of Salamanca (IBSAL), Salamanca, Spain. 3Department ofPediatric Oncology, Hematology and Clinical Immunology, Heinrich-HeineUniversity D€usseldorf, Medical Faculty, D€usseldorf, Germany. 4Department ofComputer Science, Bonn-Rhein-Sieg University of Applied Sciences,Sankt Augustin, Germany. 5Departamento de Ciencias Biom�edicas y del Diag-

n�ostico, �Area de Obstetricia y Ginecología, HUS-Universidad de Salamanca,Salamanca, Spain. 6IBSAL, Facultad de Medicina, Universidad de Salamanca,Salamanca, Spain. 7Departamento de Anatomía Patol�ogica, Universidadde Salamanca, Salamanca, Spain. 8Departamento de Cirugía, Universidadde Salamanca, Salamanca, Spain. 9Centro de Biología Molecular SeveroOchoa, CSIC/Universidad Aut�onoma de Madrid, Campus de Cantoblanco,Madrid, Spain. 10Bioinformatics Unit, Cancer Research Center (CSIC-USAL),Salamanca, Spain. 11Bioinformatics and Functional Genomics Research Group,

Cancer Research Center (CSIC-USAL), Salamanca, Spain. 12Department ofLaboratory Medicine, University of California San Francisco, San Francisco,California.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

G. Rodríguez-Hern�andez, J. Hauer, and A. Martín-Lorenzo share first authorshipof this article.

C. Vicente-Due~nas, I. S�anchez-García, and A. Borkhardt share senior authorshipof this article.

Corresponding Author: Arndt Borkhardt, Moorenstr. 5, 40225 D€usseldorf,Germany. Phone: 49-211-81-17680; Fax: 49-211-81-16707. E-mail:[email protected]

doi: 10.1158/0008-5472.CAN-17-0701

�2017 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 4365

on February 19, 2020. © 2017 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst June 19, 2017; DOI: 10.1158/0008-5472.CAN-17-0701

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-17-0701&domain=pdf&date_stamp=2017-8-9

http://cancerres.aacrjournals.org/

by the fact that the fusion gene may be present for up to 10 yearsbefore leukemia diagnosis (3–5). Correspondingly, high-resolu-tion genome-wide analysis revealed multiple additional geneticlesions in overt ETV6-RUNX1–associated leukemia (6). Thesecritical secondary events are frequently driven by genomic altera-tionsmediatedbyRAG recombinase activity, andonly infrequent-ly by point mutations (7). This suggests that high RAG expressionand/or facilitated recruitment of RAG to cryptic recombinationsignal sequence (RSS)might be a commonpath in the acquisitionof secondary alterations in ETV6-RUNX1 pB-ALL. The pendingchallenge is to identify the relevant exposures and decipher howandwhen these factors contribute to themultistep natural historyof ETV6-RUNX1 pB-ALL, because it can offer prophylactic inter-ventions. The lack of genetically engineered human-like ETV6-RUNX1 pB-ALL models has hampered our better understandingof the pathogenesis of this disease (8, 9). Thus far, experimentalmodels of ETV6-RUNX1–associated leukemia have recapitulatedsome aspects of disease evolution but not the full disease phe-notype, irrespective of the mode and timing of expression or thesource of target cells (10–15).

To address these issues, we have used a novel experimentalapproach tomodel the ETV6-RUNX1 preleukemic state by expres-sing the humanETV6-RUNX1 fusion geneunder the control of theSca1 promoter in the mouse hematopoietic system. Sca1-ETV6-RUNX1 mice developed exclusively pB-ALL at a low diseasepenetrance only when they were exposed to common pathogens.

Materials and MethodsPrimary human samples

Primary cases (Supplementary Fig. S1 and SupplementaryTable S1) were obtained with informed consent in compliancewith the institutional review board of the University ofD€usseldorf, Germany.

Mouse leukemia model for ETV6-RUNX1 pB-ALLAll animal work has been conducted according to relevant

national and international guidelines, and it has been approvedby the Bioethics Committee ofUniversity of Salamanca andby theBioethics Subcommittee of Consejo Superior de InvestigacionesCientificas (CSIC). The ETV6-RUNX1 vector was generated byinserting the human ETV6-RUNX1 cDNA into the ClaI site of thepLy6 vector. The transgene fragmentwas excised from its vector byrestriction digestion with NotI, purified and injected (2 ng/mL)into CBAxC57BL/6J-fertilized eggs. Transgenic mice were identi-fied by Southern blot analysis of tail snip DNA after EcoRIdigestion, using ETV6-RUNX1 cDNA to detect the transgene. Twoindependent transgenic lines were generated and analyzed. Thetwo independent Sca1-ETV6-RUNX1 founder lines had normalgestation and were viable and developed normally and were usedto examine the phenotype further. Upon signs of disease, Sca1-ETV6-RUNX1 mice were sacrificed and subjected to standardnecropsy procedures. All major organs were examined under thedissecting microscope. Tissue samples were taken from homoge-neous portions of the resected organ and fixed immediately afterexcision. Differences in Kaplan–Meier survival plots of transgenicandWTmicewere analyzed using the log-rank (Mantel–Cox) test.

FACS analysisNucleated cells were obtained from total mouse bone marrow

(BM; flushing from the long bones), peripheral blood (PB),thymus, or spleen. In order to prepare cells for flow cytometry,

contaminating red blood cells were lysed with RCLB lysis bufferand the remaining cells were then washed in PBS with 1% FCS.After staining, all cells were washed once in PBS and wereresuspended in PBSwith 1% FCS containing 2mg/mL propidiumiodide (PI) to allow dead cells to be excluded from both analysesand sortingprocedures. The samples and thedatawere acquired inanAccuriC6 FlowCytometer and analyzed using FlowJo software.Specific fluorescence of FITC, PE, PI, and APC excited at 488 nm(0.4 W) and 633 nm (30 mW), respectively, as well as knownforward and orthogonal light scattering properties of mouse cellswere used to establish gates. Nonspecific antibody binding wassuppressed by preincubation of cells with CD16/CD32 Fc-blocksolution (BD Biosciences). For each analysis, a total of at least50,000 viable (PI�) cells were assessed.

The following antibodies were used for flow cytometry: anti-B220 (RA3-6B2), CD3e (145-2C11), CD4 (RM4-5, 1:500), CD8a(53-6.7, 1:500), CD11b/Mac1 (M1/70, 1:200), CD19 (1D3),CD117/c-Kit (2B8, 1:200), CD127/IL-7Ra (A7R34, 1:50), Ly-6G/Gr1 (RB6-8C5), IgM (R6-60.2), Sca1/Ly-6A/E (E13-161.7,1:50), CD25 (PC61), CD48 (HM48-1) and CD150 (TC15-12F12.2) antibodies. Unspecific antibody binding was sup-pressed by preincubation with CD16/CD32 (2.4G2) Fc-blocksolution (PharMingen). FACS definition of B-cell developmentalstageswas performed according toKwon and colleagues (16)withminor modifications. Briefly, BM proB cells (CD19þc-Kitþ), BMpre-B cells (B220þCD25þIgM�), BM immature B cells(B220þIgMhiIgD�), BM recirculating B cells (B220þIgDhi),peripheral transitional B cells (B220þIgMhiIgDhi), peripheralmature B cells (B220þIgMloIgDhi), marginal zone (MZ) B cells(B220þCD21hiCD23lo), and follicular (FO) B cells(B220þCD21intCD23hi). All antibodies were purchased from BDBiosciences. All antibodies were used at a 1:100 dilution unlessotherwise indicated.

HistologyAnimals were sacrificed by cervical dislocation; tissue samples

were formalin-fixed and included in paraffin. Pathology assess-ment was performed on hematoxylin–eosin-stained sectionsunder the supervision of Dr. Oscar Blanco, an expert pathologistat the Salamanca University Hospital.

V(D)J recombinationImmunoglobulin rearrangements were amplified by PCR using

the primers in Table 1. Cycling conditions consisted of an initialheat-activation at 95�C followed by 31 to 37 cycles of denatur-ation for 1 minute at 95�C, annealing for 1 minute at 65�C, andelongation for 1minute 45 seconds at 72�C. This was followed bya final elongation for 10 minutes at 72�C. To determine the DNAsequences of individual V(D)J rearrangements, the PCR fragmentswere isolated from the agarose gel and cloned into the pGEM-TEasy vector (Promega).

Mouse exome library preparation and next-generationsequencingSample acquisition. The AllPrep DNA/RNAMini Kit (Qiagen) wasused to purify DNA according to the manufacturer's instructions.

Exome library preparation and next-generation sequencing. Exomelibrary preparation was performed using the Agilent SureSelectXTMouse All Exon kit with modifications adapted from Fisher andcolleagues (17). Briefly, we added SPRI beads to the original

Rodríguez-Hern�andez et al.

Cancer Res; 77(16) August 15, 2017 Cancer Research4366




protocol and reduced the size of the reaction to 0.5 mL in order tobe able to use PCR tubes for subsequent steps. Furthermore, wereduced the volume for washing. We minimized sample loss andoptimized sample processing by reducing sample handling. Wetherefore just added freshly prepared 20% PEG/2.5 mol/L NaCl(Sigma) instead of elution of samples from the SPRI beads forlibrary preparation. Targeted capture by hybridization to an RNAlibrary was performed according to the manufacturer's protocol.Purification and enrichment of the captured library was achievedby binding to MyOne Streptavidin T1 Dynabeads (Life Technol-ogies) and off-bead PCR amplification in the linear range.Sequencing (2 � 100 bp) with a 6 bp index read was performedusing the TruSeq SBS Kit v3 on the HiSeq 2500 (Illumina).

Data analysis. Fastq files were generated by using BcltoFastq 1.8.4(Illumina). BWA version 0.7.4. (18) was used to align sequencedata to the mouse reference genome (GRCm38.71). Conversionsteps were carried out using Samtools (19, 20) followed byremoval of duplicate reads (http://broadinstitute.github.io/picard). Local realignment around indels, SNP-calling, annota-tion, and recalibration was facilitated by GATK 2.4.9 (21). MousedbSNP138 and dbSNP for the used mouse strains were used astraining datasets for recalibration. Resulting variation calls wereannotated by Variant Effect Predictor (22) using the Ensembldatabase (v70) and imported into an in-house MySQL databaseto facilitate automatic and manual annotation, reconciliation,and data analysis by complex database queries. Loss-of-functionprediction scores for PolyPhen2 (23) and SIFT (24)were extractedfrom this Ensemble release.

Only entries with at least 9% difference in allele frequencybetween tumor and normalwere kept for further analysis. Cancer-related genes were determined by translating the cancer geneconsensus from COSMIC (25) using ENSEMBL's biomart.

SequencingMutations were validated using Sanger sequencing and specific

primers (Table 1) on a 3130 Genetic Analyzer (AppliedBiosystems).

ProB cell cultureIscove's modified Dulbecco's medium supplemented with 50

mmol/L b-mercaptoethanol, 1 mmol/L L-glutamine, 2% heat-

inactivated fetal calf serum, 1 mmol/L penicillin–streptomycin(BioWhittaker), and 0.03%(w/v) primatone RL (Sigma)was usedfor proB cell-culture experiments. ProB cells isolated by MACSsorting for B220þ (Milteny Biotec) from BM were cultured onMitomycin C–treated ST2 cells in IMDMmedium containing IL7(R&D Systems). IL7-independent tumor proB cells were grown inthe same medium without IL7.

Apoptosis assaysThe extent of IL7-withdrawal apoptosis was evaluated by

Annexin V–FITC/PI staining. Aliquots (200 mL) containing 106

cells in 10mmol/L Hepes/NaOH pH 7.4, 140mmol/L NaCl, and2.5 mmol/L CaCl2 were incubated with Annexin V–FITC (BDBiosciences) to a final concentration of 1 mg/mL for 10minutes, atroom temperature in the dark, and then labeled with propidiumiodide to a final concentration of 2 mg/mL (PI in binding buffer).Flow cytometry was performed within an hour of labeling, anddatawere analyzed using FlowJo software. The difference betweenexperimental variables was determined using the Student t test.

Microarray data analysisTotal RNA was isolated in two steps using TRIzol (Life Tech-

nologies) followed by RNeasy Mini-Kit (Qiagen) purificationfollowing the manufacturer's RNA Clean-up protocol with theoptional On-column DNase treatment. The integrity and thequality of the RNA were verified by electrophoresis and itsconcentrationmeasured. Sampleswere analyzed using AffymetrixMouse Gene 1.0 ST arrays.

Briefly, the robust microarray analysis (RMA) algorithm wasused for background correction, intra- and inter-microarray nor-malization, and expression signal calculation (26–28). Once theabsolute expression signal for each gene (i.e., the signal value foreachprobe set)was calculated in eachmicroarray, amethod calledsignificance analysis of microarray (SAM; ref. 29) was applied tocalculate significant differential expression and find the geneprobe sets that characterized the BM pro/preB cells from preleu-kemic ETV6-RUNX1 mice compared BM pro/preB cells from WTmice. The method uses permutations to provide robust statisticalinference of the most significant genes and provides P valuesadjusted to multiple testing using false discovery rate (FDR;ref. 30). A cutoff of FDR < 0.1 was used for the differentialexpression calculations. We applied all these methods using R(31) and Bioconductor (32).

The data discussed in this publication have been deposited inNCBI's Gene Expression Omnibus (33) and are accessiblethrough GEO Series accession number GSE70492 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc¼GSE70492).

Enrichment analysisDifferentially expressed genes were tested for enrichment using

GSEA enrichment analysis from MSigDB (ref. 34; http://www.broad.mit.edu/gsea/). We carried out one enrichment analysis forthe Lysine(K)-specific demethylases gene signature described inHUGO gene nomenclature committee.

Transplantation experimentsIn order to determine the nature of the leukemogenic cell, BM

transplantation experiments were performed. Sca1-ETV6-RUNX1proB cells were injected intravenously into sublethally irradiated(4 Gy) secondary recipient 12-week-old male syngenic mice(C57BL/6 � CBA). Disease development in the recipient mice

Table 1. Primers used to determine the V(D)J recombination status (first 10primers) and to validate mutations by Sanger sequencing (last eight primers)

Primer Sequence [50–30]VHJ558-f CGAGCTCTCCARCACAGCCTWCATGCARCTCARCVHJ558-r GTCTAGATTCTCACAAGAGTCCGATAGACCCTGGVH7183-f CGGTACCAAGAASAMCCTGTWCCTGCAAATGASCVH7183-r GTCTAGATTCTCACAAGAGTCCGATAGACCCTGGVHQ52-f CGGTACCAGACTGARCATCASCAAGGACAAYTCCVHQ52-r GTCTAGATTCTCACAAGAGTCCGATAGACCCTGGDH-f TTCAAAGCACAATGCCTGGCTDH-r GTCTAGATTCTCACAAGAGTCCGATAGACCCTGGCm-f TGGCCATGGGCTGCCTAGCCCGGGACTTCm-r GCCTGACTGAGCTCACACAAGGAGGAKDM5C-f CTTCTCCCTCCCTACCCCTTATKDM5C-r ATTTACCAGCCTCCAGAACTCCEbf1-f GTCGTGGTGTCTACCACAGEbf1-r ATGATTCGCCTACCATGTTCCKdm5c-f AGGTTAGAGGGACTCTTCAGKdm5c-r CCTCACATCAACATACCCAGKdm2b-f CCTGCCAAGCGGAGAAGTGAGTGKdm2b-r CCAGGCCTTCCCAGTTCGTACTC

KDM Family Drives ETV6-RUNX1 pB-ALL Progression

www.aacrjournals.org Cancer Res; 77(16) August 15, 2017 4367



http://broadinstitute.github.io/picard

http://broadinstitute.github.io/picard

http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE70492



http://www.broad.mit.edu/gsea/

http://www.broad.mit.edu/gsea/


Figure 1.

Modeling the first hit function of ETV6-RUNX1 in mice. A, Mouse model mimicking human disease. ETV6-RUNX1 is expressed in HSC but not in terminaldifferentiated B cells in the Sca1-ETV6-RUNX1 mouse model mimicking the preleukemic stage of human ETV6-RUNX1 pB-ALL disease. B, ETV6-RUNX1 pB-ALLexpression in Sca1-ETV6-RUNX1 mice. (Continued on the following page.)






was monitored by periodic PB analysis until blast cells weredetected. Then, they were sacrificed and assessed for pB-ALLdevelopment.

CRISPR-mediated gene editingKnockout of the KDM5C gene was done by CRISPR/Cas9-

mediated knock-in of a selection cassette following the doublenicking strategy by Ran and colleagues (35). A pair of guide RNAstargeting exon 1 of KDM5C adjacent to its transcription start sitewas designed with the help of the CRISPR design tool (http://crispr.mit.edu/; ref. 36). Expression cassettes for Cas9D10A (Casn)and the guide RNAs were taken from pX335 (Addgene #42335;ref. 37) and transferred to a smaller pUC19 backbone via PCR-based cloning. The knock-in was achieved by offering a repairtemplate addressing the homologous recombination repair path-way: the coding sequence for the truncated human low-affinitynerve growth factor receptor (LNGFR, taken frompMACS LNGFR,Miltenyi Biotech) followed by a Poly A from SV40 was beddedbetween 0.9 and 1 kb homologous sequence for KDM5C flankingthe expected nicking sites. All four plasmids (Casn, 2� gRNA, andrepair template) were nucleofected in NALM-6 cells (Kit V, T-001,Lonza)—the repair template was also circularized to diminishrandom integration. Selection of positive cells was done by threesequential rounds of enrichment by using the MACSelect LNGFRSystem (Miltenyi).

Coimmunoprecipitation and immunoblotting analysesWild-type (WT) and KDM5C�NALM-6 cells were nucleofected

(Lonza) with c-myc-tagged-RAG2 plasmid. After 48 hours, co-immunoprecipitation was performed with Anti–c-myc microbe-ads following the manufacturer's guidelines (Miltenyi), and laterprecipitated proteins were immunoblotted with anti-RAG2(Abcam) and anti-H3K4me3 (Merck Millipore) antibodies.

ResultsDevelopment of amousemodel for preleukemic hematopoieticcell precursors expressing ETV6-RUNX1

The ETV6-RUNX1 transcript expression is not detected inprogenitor B cells of healthy children carrying the preleukemicclone (4, 38). We generated a murine strain that mimicked thisscenario by expressing ETV6-RUNX1 specifically within hemato-poietic stem/progenitor cells (HSPC) through placing a humanETV6-RUNX1 cDNA under control of the Sca1 promoter (Fig. 1Aand Supplementary Fig. S2A and S2B). This system ensures theexpression of ETV6-RUNX1 into HSPC (39–41). In accord withthe known capacity of Sca1 regulatory elements to drive transgeneexpression in Sca1þ cells, Sca1-ETV6-RUNX1 transgene expres-sion was detected in HSPCs but not in proB cells or later stagesof B-cell development (Fig. 1B). Therefore, this limited expression

of ETV6-RUNX1 during early hematopoietic developmentmimicked human ETV6-RUNX1 preleukemic biology (4, 38) andprovided a preclinical model to evaluate environmental factors,which act synergistically in ETV6-RUNX1 pB-ALL development.

Sca1-ETV6-RUNX1 mice do not develop pB-ALL under specificpathogen-free conditions

To determine if ETV6-RUNX1 expression inHSPCs predisposesto leukemia as implicit in its assignment as the initiating hit inchildhood pB-ALL, we monitored cohorts of Sca1-ETV6-RUNX1mice and controlWTmice born and kept in the specific pathogen-free (SPF) environment during their lifespan (n¼ 37; observed for2 years; Fig. 1C). To comprehensively study the long-term impactof ETV6-RUNX1 on BM lymphopoiesis, we characterized thedifferent stages of B-cell development. The different cell popula-tions were analyzed by flow cytometry in BM, spleen, and PB of 4-month-old Sca1-ETV6-RUNX1 transgenicmice compared with anage-matched WT control. At 4 to 5 months of age, an increase ofthe BM pro/preB cells and immature B cells could not be detected(Supplementary Fig. S2C). In contrast, BMpro/preB cells were notgradually lost in Sca1-ETV6-RUNX1 mice (Fig. 1D and Supple-mentary Fig. S2D). These data suggest that ETV6-RUNX1 fusionfavors the maintenance of a B-cell precursor compartment in theBM, although the differentiation to mature PB B cells is notimpaired (Fig. 1E). However, in the absence of oncogenic envir-onments, this is not sufficient to produce leukemia, because Sca1-ETV6-RUNX1 mice remained without evidence of disease.

Infection exposure induces pB-ALL in Sca1-ETV6-RUNX1 miceThus, we next asked if we could provoke pB-ALL development

in the Sca1-ETV6-RUNX1 mice by exposing them to oncogenicenvironments relevant to human disease. Infection exposure wasthe first suggested cause for childhood ETV6-RUNX1 pB-ALL andremains one of the strongest candidates (3). Moreover, in vitroinflammatory and infection stimuli are known to increase RAGexpression, which is relevant for the clonal evolution of humanETV6-RUNX1 pB-ALL (42–44). However, the role of infection inthe conversion of the ETV6-RUNX1 preleukemic clone intopB-ALL remains unknown. To test this hypothesis, we monitoredcohorts of Sca1-ETV6-RUNX1 mice and control WT mice bornand kept in the SPF environment until exposed to commoninfectious environment (Fig. 1F; murine norovirus, murine hep-atitis virus, helicobacter species, and Trichomonas muris; Supple-mentary Table S2). Under this scenario, specific pB-ALL develop-ment was observed only in Sca1-ETV6-RUNX1 mice exposed tocommon infectious environment (10.75%; 10out of 93). The lowpenetrance of pB-ALL in the murine model closely resembled thelow penetrance of pB-ALL development in children carrying thepreleukemic ETV6-RUNX1 clone (3, 5). Due to the low incidenceof the pB-ALL disease, the overall survival of Sca1-ETV6-RUNX1

(Continued.) BM HSC, BM proB, and preB cells and PB CD19þ cells from Sca1-ETV6-RUNX1mice and total BM fromWTmice were tested for ETV6-RUNX1 expression.ETV6-RUNX1 is only expressed in BM HSC. Shown is one representative experiment out of two biological replicates. C, Experimental set-up. Mice wereborn and followed up in SPF conditions until they were sacrificed. D, Percentage of BM proB and preB cells (B220low IgM�) in 24-month-old Sca1-ETV6-RUNX1mice(n ¼ 10) versus young (4–5 months old) mice compared with age-matched control littermate WT mice (n ¼ 6). Error bars, SD. The Mann–Whitney U test wasused and P value is indicated. All the mice were housed in SPF facility. E, Percentage of PB B cells in 24-month-old Sca1-ETV6-RUNX1mice (n¼ 10) compared withage-matched control littermate WT mice (n ¼ 6). Error bars, SD. The Mann–Whitney U test was used and P value is indicated. All the mice were housed inSPF facility. F, Experimental set-up. Mice were born under SPF conditions and were moved to a non-SPF facility where they were exposed to common infectiouspathogens 1 month after birth. G, Kaplan–Meier survival curve of Sca1-ETV6-RUNX1 mice (right) and specific pB-ALL survival curve of Sca1-ETV6-RUNX1mice (left). Overall survival of Sca1-ETV6-RUNX1 mice (blue; n ¼ 93) compared with WT control mice (red; n ¼ 23). Log-rank (Mantel–Cox) P ¼ 0.9352 (right).Leukemia incidence of Sca1-ETV6-RUNX1 mice (blue; n ¼ 93) compared with WT control mice (red; n ¼ 23). Log-rank (Mantel–Cox) P ¼ 0.0855 (left).





http://crispr.mit.edu/

http://crispr.mit.edu/


mice was not significantly reduced compared with WT mice(P ¼ 0.9352; Fig. 1G). The appearance of leukemia in Sca1-ETV6-RUNX1mice manifested with splenomegaly, disruption ofsplenic architecture due to blast infiltration, and appearanceof blast cells in PB (Fig. 2A–D). Sca1-ETV6-RUNX1 pB-ALLsdisplayed clonal immature BCR rearrangement (SupplementaryFig. S3A). FACS analysis revealed a cell surface phenotypeCD19þB220þIgM� for tumor cells that extended through BM,PB, and spleen (Supplementary Fig. S3B–S3D). Consistently,tumor proB cells grew independent of IL7 (Fig. 2E and F), andthese cells were able to propagate the disease when transplantedinto sublethally irradiated syngeneic recipient mice (Fig. 2G).These results provide evidence that the Sca1-ETV6-RUNX1modelclosely reproduces the human disease, as the presence of thefusion gene is only associated with pB-ALL, and it confers a lowrisk of developing pB-ALL (3, 5). Overall, these results representthe first proof that infection exposure can induce human-likepB-ALL in mice carrying an ETV6-RUNX1 preleukemic clone.

ETV6-RUNX1 impairs B-cell development under exposure toinfection

We next aimed to explain the mechanism why the susceptiblepreleukemic ETV6-RUNX1 clone progresses to pB-ALL underexposure to infections. To this end, the different hematopoieticcompartments were studied using flow cytometry in young WTand preleukemic Sca1-ETV6-RUNX1 littermates of the samebreeding after delayed exposure to infection. No abnormalitieswere detected, neither in the myeloid nor in the T-lymphoidcompartments (as determined by Gr1, Mac1 or CD4, and CD8staining) in the BM, PB, thymus, and spleen (Supplementary Fig.S3E–S3G). However, the analysis of the different B-cell develop-mental stages showed a significant and specific increase of pro/preB cells (B220low IgM�) and immatureB cells (B220low IgMþ) inSca1-ETV6-RUNX1 mice compared with age-matched WT litter-mates but not in recirculating B cells (B220þþIgMþ; Fig. 3A;Supplementary Table S3). However, this increase of pro/preBcells (B220low IgM�) was not observed in 24-month-old leuke-mia-free Sca1-ETV6-RUNX1 mice compared with age-matchedWTmice under exposure to infection conditions (SupplementaryFig. S3H). These data suggest that the specific and temporalincrease of BM pro/preB cells was induced by the exposure tocommon pathogens as a similar increase was not observed inSca1-ETV6-RUNX1mice housed in an SPF environment (Supple-mentary Fig. S2C). In contrast, ETV6-RUNX1 expression didnot result in striking alterations in Lin�Sca1þcKitþ (LSK) cells,

long-term hematopoietic stem cells (LT-HSC), short-termhematopoietic stem cells (ST-HSC), lineage-restricted progenitor(LRP) cells, and common lymphoid progenitors (CLP) withinSca1-ETV6-RUNX1 mice compared to WT mice (Fig. 3B). Thesedata therefore suggest that ETV6-RUNX1 fusion favors the appear-ance of an aberrant B-cell precursor compartment in the BM ofyoung Sca1-ETV6-RUNX1mice only under exposure to commonpathogens, although the differentiation tomature PB B cells is notimpaired. These observations are in agreement with reports ofpreleukemic activity in mice bearing pB-ALL-associated onco-genes and/or inherited susceptibility genes (3, 45). In agreementwith these findings, expression array analysis of preleukemicETV6-RUNX1 pro/preB cells derived from mice housed in con-ventional facility (CF; n ¼ 4, ID: K206-K209) shows a distinctexpression pattern compared with healthy age-matched WT mice(n ¼ 4, ID: WT-4–WT-7; Fig. 3C; Supplementary Table S4). Theanalysis of the differential expressed genes revealed significanthigher Rag1 and Rag2 expression (Fig. 3D), which is a hallmark inhuman translocation t(12;21)-positive leukemia (MILE study;http://r2.amc.nl). Preleukemic ETV6-RUNX1 pro/preB cellsshowed differential regulation of epigenetic regulator genes ofthe KDM family, including KDM2A, KDM3A/B, KDM4A/C,KDM5A/B/C, andKDM6A/B (Table 2), but not of other epigeneticregulator gene families, including HDAC or PMT. However, wedid not find this high proportion of differentially regulatedepigenetic regulator genes in a related Pax5þ/� model of pB-ALL(Table 2 and Supplementary Table S5; ref. 46). These data indicatethat ETV6-RUNX1 specifically regulates transcription of histonemodifying genes of the KDM family and support a specific role ofhistone modification in preleukemic ETV6-RUNX1 cells (Supple-mentary Table S5).

Genomic analysis identified themechanismof clonal evolutionin infection-driving murine pB-ALL

In order to elucidate how infection exposure causes pB-ALL inthe context of aberrant histone modification and elevated Rag1expression in a preleukemic ETV6-RUNX1 clone, we next per-formed whole exome and whole genome sequencing of six Sca1-ETV6-RUNX1 tumors and corresponding germline on a HiSeq2500 (Illumina) platform for the detection of structural aberra-tions (n¼ 3) as well as of SNVs (n ¼ 6; Supplementary Fig. S4A).Sca1-ETV6-RUNX1 tumor cells were derived from BM of diseasedmice. We did not observe aberrations of the Etv6 locus, which aredescribed inup to 70%ofhumanETV6-RUNX1patients (6),mostlikely because both Etv6 alleles are intact in the transgenic mice.

Figure 2.pB-ALL development in Sca1-ETV6-RUNX1. A, Flow cytometric analysis of hematopoietic subsets in diseased Sca1-ETV6-RUNX1 mice. Representative plotsof cell subsets from the PB, BM, and spleen are shown. These show accumulation of blast B cells in Sca1-ETV6-RUNX1 mice (n ¼ 10) compared with age-matchedcontrol littermate WT mice (n ¼ 23). B, Hematoxylin and eosin staining of spleen sections from WT and tumor-bearing Sca1-ETV6-RUNX1 mice showdisruption of normal spleen architecture due to tumor-infiltrating cells. Scale bar, 100 mm(�400) and 200 mm(�200; n¼ 10).C, Splenomegaly observed in diseasedSca1-ETV6-RUNX1 mice. WT mouse spleen is shown for reference (representative of n ¼ 10). D, Blood smear from WT and tumor-bearing Sca1-ETV6-RUNX1mice showing the presence of blast cells in the PB of diseasedmice. Scale bar, 100 mm (�400) and 50 mm (�400; n¼ 4). E, Immunophenotype of tumor Sca1-ETV6-RUNX1 proB cells. Sorted B220þ cells from BM of the diseased Sca1-ETV6-RUNX1 mouse were cultured under conditions to allow the isolation and expansionof a pure population of proB cells. These tumor proB cells grow in the absence of IL7. F, WT, preleukemic Sca1-ETV6-RUNX1 and leukemic Sca1-ETV6-RUNX1primary proB cellswere cultured inmediawithout IL7 and their proliferationmeasured every dayusing Trypan blue. Values represent themean out of three replicateswith essentially identical datasets. G, Sca1-ETV6-RUNX1 pB-ALL is transplantable to secondary recipients. Experimental set-up. One hundred thousandleukemic Sca1-ETV6-RUNX1 proB cells were injected into sublethaly irradiated WT syngeneic mice. Regular bleedings were performed in order to monitorthe development of the pB-ALL. Representative flow cytometric analysis of four mice injected with leukemic Sca1-ETV6-RUNX1 proB cells. Cytometricanalyses at different time points show that leukemic pB-ALL cells (B220lowIgM�cKitþCD19þ) were able to grow in secondary recipients. Representativeflow cytometric analysis of four mice injected with leukemic Sca1-ETV6-RUNX1 proB cells shows the accumulation of pB-ALL cells (B220lowIgM�KitþCD19þ) in BM.





http://r2.amc.nl


However, we identified secondary genomic alterations in genesknown to be relevant for human ETV6-RUNX1 pathogenesis, butwith a very heterogeneous pattern in the single tumors, which is acommon feature of human ETV6-RUNX1 pB-ALL (Table 3).Amongothers,we identified adeletion in the B-cell differentiationfactor gene Ebf1 leading to the loss of three amino acids, which isassociated with human ETV6-RUNX1 leukemia (SupplementaryFig. S4B; ref. 6).

Infection-drivenmurine pB-ALL andhumanETV6-RUNX1þpB-ALL share critical secondary genetic events affecting histonemodification regulators

ETV6-RUNX1 pB-ALL cases commonly exhibit a high burden ofDNA copy-number alterations, but lack a known unifying genetic

second hit. Thus, we next compared the genomic alterationsfound in the infection-driven murine pB-ALL to the publishedgenomic data of pediatric ETV6-RUNX1 pB-ALL (6, 7) and iden-tifiedmultiple CNVs that are shared between the infection-drivenmurine and human ETV6-RUNX1 pB-ALL (Table 3; ref. 7). In oneof our six index mice (no J408), we found an SNV in Kdm5c,causing a premature stop, leading to loss of function (Fig. 4A). Asignificant number of genes implicated in histone modificationare simultaneouslymutated in the human ETV6-RUNX1–positivepB-ALL cohort of Papaemanulli and colleagues, includingKDM3B,KDM4C/D/E, KDM5A/C, andKDM6A/B (SupplementaryTable S6; ref. 7). We next validated the new finding of recurrenthistone modification in an independent human ETV6-RUNX1cohort of 11 patients. We subjected matched leukemic (initial

Figure 3.

B-cell development in young Sca1-ETV6-RUNX1 mice housed in conventional facility. A, Percentage of BM B cell compartments in 7-month-old leukemia-freeSca1-ETV6-RUNX1 mice. Sca1-ETV6-RUNX1 mice (n ¼ 6) show a significant increase in preB and proB cells (B220low IgM�) and immature B cells (B220low IgMþ)compared with age-matched control littermate WT mice (n ¼ 4) but not in recirculating B cells (B220þþIgMþ). B, Flow cytometric analysis of hematopoieticprecursor subsets in 4-month-old tumor-free mice. No differences can be seen in Lin�Sca1þcKitþ (LSK) cells, long-term hematopoietic stem cells (LT-HSC),short-term hematopoietic stem cells (ST-HSC), lineage-restricted progenitor (LRP) cells, and common lymphoid progenitors (CLP) within Sca1-ETV6-RUNX1 mice(n ¼ 4) compared with age-matched control littermate WT mice (n ¼ 4–7). The Mann–Whitney U test was used throughout A–B and P value isindicated in each case. Data represent the means � SD. C, Differential gene expression analysis of preleukemic proB and preB cells of four ETV6-RUNX1mice compared with proB and preB cells of four age-matched WT mice from CF shows significant differences. D, Rag expression. Relative expression of Rag1and Rag2 from BM pro/preB cells of ETV6-RUNX1 mice under infection exposure. BM proB/preB cells of WT mice also under infection exposure were usedas a reference. Error bars represent the mean of relative expression � SD of three replicates.






diagnosis and relapse) and remission DNA from 11 children withpB-ALL to WGS and WES (Supplementary Fig. S1 and Supple-mentary Table S1). All patients harbored the translocationt(12;21)(p13;q22) (Supplementary Fig. S1). We identifiedan average of 10 sequence mutations (range, 0–42) per case(Supplementary Tables S7–S9). Missense mutations (63%) werepredicted to be deleterious (Supplementary Table S9), indicating

that many of these variants are involved in leukemogenesis. Ourresults confirmed the rarity of both recurrent coding regionmutations and kinase mutations as published by Papaemmanuiland colleagues (7). However, we observed a high frequency ofsomatic alterations targeting histone-modifying genes in ETV6-RUNX1 pB-ALL. Six out of 11 cases had alterations in genesencoding components of the epigenetic protein families KDM,

Table 2. KDM genes misregulated in ETV6-RUNX1 human pB-ALL and murine ETV6-RUNX1 preleukemic cells

GeneRegulation in preleukemic ETV6-RUNX1

mice vs. WT in SPF (pro/preB)Regulation in preleukemic ETV6-RUNX1

mice vs. WT in CF (pro/preB)MILE

t(12;21)Regulation in leukemic

Pax5þ/� mice (pro/preB)

KDM2A — 1.20 Up �0.69KDM3A — 1.29 � �0.46KDM3B — 1.15 Up �0.69KDM4A — 1.30 Up �0.63KDM4C — 1.15 Up �0.68KDM5A — 1.32 � �0.64KDM5B — 1.45 Up �0.08KDM5C — 1.27 Up �0.69KDM6A — 1.06 � —

KDM6B — 1.54 Down �0.42

NOTE: Numbers indicated in the table correspond to the R-fold.

Table 3. Shared genomic alterations in murine and human ETV6-RUNX1 pB-ALL

Human samples

Chr. Region

Copynumber(mouse)

Affectedmouse

No. of affectedsamples (own

cohort)

Duplicated (dup) ordeleted (del) in

Papaemmanuil et al. (7) Genes in this region

1 1–8.130.000 3 S825 7 dup Lypla1, Tcea1, Atp6v1h, Oprk1, Rb1cc1,Fam150a, St18, Pcmtd1, Xkr4, Rp1,Sox17, Mrpl15, Rgs20

1 109.800.001–117.850.000 3 S825 1 dup Cdh7, Cntnap5a, Cdh19, Dsel2 18.110.001–18.490.000 3 J408 0 dup Mllt10, Dnajc12 22.390.001–22.580.000 1 S825 1 del Myo3a3 8.200.001–8.290.000 4 S825 0 dup3 40.520.001.40.680.000 1 S825 0 del Intu, 1700017G19Rik3 131.340.001–131.500.000 1 S825 0 del Sgms24 89.260.001–89.400.000 1 S825 0 del Cdkn2a, Cdkn2b5 124.660.001–124.710.000 3 J406 2 dup Atp6v0a26 133.550.001–133.940.000 3 S825 0 dup Gm5886, Kap9 24.500.001–24.590.000 3 J408 1 dup Dpy19l1, Dpy19l29 13.280.001–13.440.000 1 S825 1 del Ccdc829 24.500.001–24.590.000 4 S825 1 dup Dpy19l1, Dpy19l29 108.820.001–108.940.000 1 S825 0 del Celsr3, Slc26a6, Tmem89, Uqcrc19 123.840.001–123.930.000 1 S825 0 del Fyco1, Xcr110 7.470.001–7.610.000 1 S825 0 del Lrp11, Ulbp110 100.290.001–100.420.000 4 S825 3 dup11 54.100.001–54.190.000 4 S825 3 dup P4ha2, 4933405E24Rik12 68.890.001–68.990.000 3 S825 0 dup14 14.090.001–14.600.000 4 S825 2 dup Atxn7, Il3ra, Psmd614 88.130.001–97.120.000 3 S825 0 dup 4930474H20Rik, 4921530L21Rik,

Pcdh20, Pcdh9, Klhl115 96.380.001–96.490.000 3 J406 0 dup Arid2, Scaf1115 6.570.001–6.960.000 3 J408 3 dup Fyb, Rictor, Osmr15 12.090.001–12.300.000 3 J408 3 dup Zfr, Mtmr1215 54.970.001–55.320.000 3 J408 0 dup Deptor, Col14a1, Taf2, Dscc1, Gm992015 57.860.001–58.250.000 3 J408 0 dup Tbc1d31, Fam83a, Wdyhv1, Derl1,

9130401M01Rik, Zhx1, Atad2, Fbxo3215 96.140.001–96.500.000 3 J408 0 dup Gm4371, Arid2, 2610037D02Rik, Scaf1115 100.230.001–

100.350.0003 J408 0 dup Atf1, Tmprss12, Mettl7a1, Mettl7a3

15 74.940.001–74.990.000 4 S825 0 dup Ly6e, Ly6i15 103.710.001–104.043.686 3 S825 0 dup Mucl1, Spt116 15.960.001–16.220.000 3 S825 2 dup Pkp2, Spidr16 16.380.001–16.490.000 3 S825 6 dup Fgd4






HDAC, PMT, including sequence mutations in KDM6A, KDM5C,KDM6B, and KDM2B as well as deletions, including related genes(KDM2A/2B, KDM3A, KDM4A, andKDM5B). Eight of these genes(KDM6A/B, KDM5B/C, KDM4A, KDM3A, and KDM2A/B) weredifferentially regulated in ETV6-RUNX1 pre/proB cells (Table 2and Supplementary Table S5). Together, 26 cases (42%) of ETV6-RUNX1 pB-ALL, including our patients (n¼ 11) and the cohort ofPapaemmanuil and colleagues (n ¼ 51), had mutations affect-ing epigenetic regulation, which involved multiple genes in 14cases. In silico prediction tools classify the mutations observedin ETV6-RUNX1 pB-ALL as loss of function. Genes of the KDMfamily were specifically affected in ETV6-RUNX1 relapsedpatients (71.45%) compared with initial diagnosis and othertypes of pB-ALL such as relapsed hyperdiploid pB-ALL (33.33%,n ¼ 6). The most affected histone modifying gene functions inboth cohorts were found in H3K9me3 methylation/demethyl-ation and H3K4me2/3 demethylation. Recurrently affectedgenes, which catalyze demethylation of histone 3 lysine 4(H3K4me3), were KDM2B and KDM5C. Case UKD11 harboreda focal missense mutation of KDM5C (Fig. 4A), and an addi-tional case PD4021a (7) showed deletion of the whole genomiclocus (Supplementary Table S6). Additionally, patient UKD06had a missense mutation in KDM2B and PD4036a and UKD09harbored structural aberrations affecting the same gene. There-

fore, we conclude that the KDM gene family is implicated in theclonal evolution of ETV6-RUNX1 pB-ALL and its disruption isimplicated in the pathogenesis of pB-ALL.

Histone demethylase KDM5C loss of function alters theRag2–H3K4m3 complex

It is known that KDM5C loss of function causes trimethyla-tion of H3K4, which is the necessary requirement for Ragbinding and initiation of recombination activity (47). In sup-port of this mechanism being a rational explanation of Rag-induced clonal evolution of ETV6-RUNX1 pB-ALL, we knockedout KDM5C in a human pB-ALL cell line model using theCRISPR/Cas9 technique. Western blot analysis confirmedstrong diminished KDM5C expression together with elevatedglobal levels of H3K4me3 (Fig. 4B). As predicted (47), higherlevels of H3K4me3 were coprecipitated with RAG2, indicatingthe higher ratio of H3K4me3-bound RAG2 in the KDM5C-deficient environment, laying the basis for RAG1 binding andpotential enhanced off-target cleavage activity (Fig. 4C). Takentogether, these findings suggest that exposure to infection,accompanied by an increase in Rag1/2 expression contributesto the clonal evolution of ETV6-RUNX1 pB-ALL on the basis ofmisregulated histone modification, facilitating Rag recruitmentto cryptic RSS.

Figure 4.

Histone Demethylase KDM5C loss offunction alters the RAG2–H3K4me3complex. A, Mutations in the murine andhuman Kdm5c/KDM5C gene. Left,position of the gained stop mutation inexon 17 of mouse J408 and the result ofthe Sanger sequencing of said mouse.Right, the same for human patient 11 andthe missense mutation in exon 9. B,CRISPR/Cas9-mediated knockout ofKDM5C was carried out in a pB-ALLcell line, NALM-6, and referred to asKDM5C�. Normal NALM-6 andKDM5C� cells were immunoblotted withanti-KDM5C and anti-H3K4me3 Ab. C,Coimmunoprecipitation was performedwith anti–c-myc beads after nucleofectionwith c-myc-tagged-RAG2 plasmid toNALM-6 and KDM5C� cells, followedby immunoblotting with anti-RAG2 andanti-H3K4me3 Ab.






DiscussionUnderstanding the biology underlying ETV6-RUNX1 pB-ALL

has been hampered by the lack of genetically modified mousemodels that develop human-like disease (10–15). Althoughthe striking uniformity of clinical features, immunophenotypetranscriptional profile, and therapeutic response suggests acommon underlying genetic alteration in driving ETV6-RUNX1pB-ALL, the disease appears to be diverse due to the presenceof a remarkable diversity of genetic alterations identified inprevious studies (7). Despite this heterogeneity, our resultsshow the prevalence of loss-of-function mutations in genesinvolving histone modification especially of the KDM family.This suggests a common pathogenesis for the establishment ofthe ETV6-RUNX1 pB-ALL clone and strongly indicates thatdisruption of these genes is a key event in the pathogenesisof this leukemia. The presence of the fusion gene is onlyassociated with pB-ALL, and it seems to confer very lowpenetrance of leukemia (3, 5). The infection-driven pB-ALLsthat developed in Sca1-ETV6-RUNX1 mice closely resemblethe human disease both in low penetrance and in pathologyand genomic lesions. Therefore, the Sca1-ETV6-RUNX1 micemimicked human ETV6-RUNX1 preleukemic biology (4, 38)and provided a means to evaluate the potential for oncogenicenvironments that contribute to pB-ALL development.

We previously proved the infectious hypothesis stated byWard in 1917 in a murine model of Pax5 haploinsufficiency(46), which can now be extended to the commonest subtype ofchildhood leukemia. It is of much broader interest for ourgeneral understanding of leukemia development to know if thevery common ETV6-RUNX1 fusion acts cooperatively withinfection. In this model, exposure to infection causes theoncogenic environment conferring a selection pressure on analtered hematopoietic/B-cell precursor compartment. However,the mechanism is distinct from that observed on the basis ofPax5 haploinsufficiency. Sca1-ETV6-RUNX1 mice show accu-mulation of B cell precursors in BM only when they are exposedto infection but they never show peripheral B-cell deficiency.Interestingly, the ETV6-RUNX1 B-cell precursors are not sensi-tive to IL7 withdrawal (Supplementary Fig. S5). Hence, duringexposure to infection the selection pressure for activating muta-tions of the Jak3/Stat5 signaling pathway is less profound incomparison to what we observed in the Pax5model (46). Thus,the mechanism for tumor cell selection in the ETV6-RUNX1model is different from that in Pax5þ/� mice. We did not findactivating Jak3 mutations in this murine model or mutationsactivating the IL7/IL7R/Jak/STAT signaling pathway. However,we observed shared genomic alterations in human ETV6-RUNX1 pB-ALL and our ETV6-RUNX1 mouse model involvingdeleterious mutations in histone modifying genes (i.e., Kdm5c).These loss-of-function mutations in histone-modifying genesare known to facilitate the chromatin accessibility of Ragmolecules alleviating off target DNA cleavage (47). Thus, theacquisition of secondary mutations in pB-ALL with a significantenrichment in histone modifying genes of the KDM familyconfers the second hit for the conversion of a preleukemic cloneinto the clinically overt ETV6-RUNX1 pB-ALL disease, but themechanism linking KDM loss to oncogenesis remains to beelucidated. As the presence of a precancerous cell is a propertyof many cancers, our approach provides a potentially generalmechanism to identify etiologic factors of cancer.

Disclosure of Potential Conflicts of InterestC. Cobaleda has ownership interest in a patent application and is a consul-

tant/advisory board member for German Bundesamt fuer StrahlenSchutz. Nopotential conflicts of interest were disclosed by the other authors.

Authors' ContributionsConception and design:G. Rodríguez-Hern�andez, J. Hauer, A.Martín-Lorenzo,M. M€uschen, C. Vicente-Due~nas, I. S�anchez-García, A. BorkhardtDevelopment of methodology: G. Rodríguez-Hern�andez, A. Martín-Lorenzo,D. Sch€afer, I. García-Ramírez, F. Auer, I. Gonz�alez-Herrero, S. Bhatia, R.M. Linka,C. Vicente-Due~nas, I. S�anchez-GarcíaAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): G. Rodríguez-Hern�andez, A. Martín-Lorenzo,D. Sch€afer, I. García-Ramírez, F. Auer, L. Ruiz-Roca, M. Gombert, V. Okpanyi,U. Fischer, C. Chen, S. Bhatia, R.M. Linka, M. Garcia-Suquia,M.V. Rasc�on-Trincado, A. Garcia-Sanchez, O. Blanco, M.B. García-Cenador,F.J. García-Criado, C. Vicente-Due~nas, I. S�anchez-GarcíaAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): G. Rodríguez-Hern�andez, J. Hauer,A. Martín-Lorenzo, D. Sch€afer, C. Bartenhagen, F. Auer, M. Gombert, U. Fischer,M. Dugas, S. Bhatia, R.M. Linka, A. Garcia-Sanchez, M.B. García-Cenador,C. Cobaleda, D. Alonso-L�opez, J. De Las Rivas, C. Vicente-Due~nas,I. S�anchez-García, A. BorkhardtWriting, review, and/or revision of the manuscript: G. Rodríguez-Hern�andez,J. Hauer, A. Martín-Lorenzo, D. Sch€afer, F. Auer, M. Dugas, R.M. Linka,M.B. García-Cenador, F.J. García-Criado, C. Cobaleda, J. De Las Rivas,M. M€uschen, C. Vicente-Due~nas, I. S�anchez-García, A. BorkhardtAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): D. Sch€afer, F. Auer, L. Ruiz-Roca, V. Okpanyi,U. Fischer, C. Vicente-Due~nas, I. S�anchez-García, A. BorkhardtStudy supervision: J. Hauer, C. Vicente-Due~nas, I. S�anchez-García, A. Borkhardt

AcknowledgmentsWe are indebted to all members of our groups for useful discussions and for

their critical reading of the manuscript.

Grant SupportJ. Hauer has been supported by the German Children's Cancer Foundation,

DJCLS 02R/2016, KKS A2016/07 and from the "Forschungskommission" of themedical faculty of the Heinrich Heine University. M. M€uschen is an HHMIFaculty Scholar (HHMI-55108547) and supported by NIH/NCI through anOutstanding Investigator Award (R35CA197628) to M. M€uschen, a WellcomeTrust Senior Investigator Award, the Leukemia and Lymphoma Society, theCalifornia Institute for Regenerative Medicine, the William Lawrence andBlanche Hughes Foundation. A. Borkhardt has been supported by the GermanChildren's Cancer Foundation and the Federal Ministry of Education andResearch, Bonn, Germany. Research in I. S�anchez-García's group is partiallysupported by FEDERandbyMINECO(SAF2012-32810, SAF2015-64420-R andRed de Excelencia Consolider OncoBIOSAF2014-57791-REDC), Instituto deSalud Carlos III (PIE14/00066), ISCIII- Plan de Ayudas IBSAL 2015 ProyectosIntegrados (IBY15/00003), by Junta de Castilla y Le�on (BIO/SA51/15,CSI001U14, UIC-017, and CSI001U16), Fundacion Inocente Inocente and bythe ARIMMORA project (European Union's Seventh Framework Programme(FP7/2007-2013) under grant agreement no. 282891). I. S�anchez-García's lab isamember of the EuroSyStemand theDECIDENetwork funded by the EuropeanUnion under the FP7 program. A. Borkhardt and I. S�anchez-García have beensupported by the German Carreras Foundation (DJCLS R13/26). Research in C.Vicente-Due~nas' group is partially supported by a "Miguel Servet" grant (CP14/00082-AES 2013-2016-FEDER) from the Instituto de Salud Carlos III (Minis-terio de Economía y Competitividad) and by the Lady Tata International Awardfor Research in Leukaemia 2016–2017. A. Martín-Lorenzo and G. Rodríguez-Hern�andez were supported by FSE-Conserjería de Educaci�on de la Junta deCastilla y Le�on (CSI001-13 and CSI001-15, respectively).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received March 9, 2017; revised June 2, 2017; accepted June 6, 2017;published OnlineFirst June 19, 2017.






References1. Borkhardt A,CazzanigaG, ViehmannS, ValsecchiMG, LudwigWD, Burci L,

et al. Incidence and clinical relevance of TEL/AML1 fusion genes in childrenwith acute lymphoblastic leukemia enrolled in the German and Italianmulticenter therapy trials. Associazione Italiana Ematologia OncologiaPediatrica and the Berlin-Frankfurt-Munster Study Group. Blood 1997;90:571–7.

2. Pui CH, Relling MV, Downing JR. Acute lymphoblastic leukemia. N Engl JMed 2004;350:1535–48.

3. Ford AM, Palmi C, Bueno C, Hong D, Cardus P, Knight D, et al. The TEL-AML1 leukemia fusion gene dysregulates the TGF-beta pathway in early Blineage progenitor cells. J Clin Invest 2009;119:826–36.

4. Hong D, Gupta R, Ancliff P, Atzberger A, Brown J, Soneji S, et al. Initiatingand cancer-propagating cells in TEL-AML1-associated childhood leukemia.Science 2008;319:336–9.

5. Mori H, Colman SM, Xiao Z, Ford AM, Healy LE, Donaldson C, et al.Chromosome translocations and covert leukemic clones are generatedduring normal fetal development. Proc Natl Acad Sci U S A 2002;99:8242–7.

6. Mullighan CG, Goorha S, Radtke I, Miller CB, Coustan-Smith E, Dalton JD,et al. Genome-wide analysis of genetic alterations in acute lymphoblasticleukaemia. Nature 2007;446:758–64.

7. Papaemmanuil E, Rapado I, Li Y, Potter NE,Wedge DC, Tubio J, et al. RAG-mediated recombination is the predominant driver of oncogenic rear-rangement in ETV6-RUNX1 acute lymphoblastic leukemia. Nat Genet2014;46:116–25.

8. Hauer J, Borkhardt A, Sanchez-Garcia I, Cobaleda C. Genetically engi-neered mouse models of human B-cell precursor leukemias. Cell Cycle2014;13:2836–46.

9. Sloma I, Eaves CJ. TEL me all. Cell Stem Cell 2009;5:5–6.10. Andreasson P, Schwaller J, Anastasiadou E, Aster J, Gilliland DG. The

expression of ETV6/CBFA2 (TEL/AML1) is not sufficient for the transfor-mation of hematopoietic cell lines in vitro or the induction of hematologicdisease in vivo. Cancer Genet Cytogenet 2001;130:93–104.

11. Bernardin F, Yang Y, Cleaves R, Zahurak M, Cheng L, Civin CI, et al. TEL-AML1, expressed from t(12;21) in human acute lymphocytic leukemia,induces acute leukemia in mice. Cancer Res 2002;62:3904–8.

12. Fischer M, Schwieger M, Horn S, Niebuhr B, Ford A, Roscher S, et al.Defining the oncogenic function of the TEL/AML1 (ETV6/RUNX1) fusionprotein in a mouse model. Oncogene 2005;24:7579–91.

13. Kantner HP,WarschW, Delogu A, Bauer E, Esterbauer H, Casanova E, et al.ETV6/RUNX1 induces reactive oxygen species and drives the accumulationof DNA damage in B cells. Neoplasia 2013;15:1292–300.

14. Morrow M, Horton S, Kioussis D, Brady HJ, Williams O. TEL-AML1promotes development of specific hematopoietic lineages consistent withpreleukemic activity. Blood 2004;103:3890–6.

15. Schindler JW, Van Buren D, Foudi A, Krejci O, Qin J, Orkin SH, et al. TEL-AML1 corrupts hematopoietic stem cells to persist in the bonemarrow andinitiate leukemia. Cell Stem Cell 2009;5:43–53.

16. Kwon K,Hutter C, SunQ, Bilic I, Cobaleda C,Malin S, et al. Instructive roleof the transcription factor E2A in early B lymphopoiesis and germinalcenter B cell development. Immunity 2008;28:751–62.

17. Fisher S, Barry A, Abreu J, Minie B, Nolan J, Delorey TM, et al. A scalable,fully automated process for construction of sequence-ready human exometargeted capture libraries. Genome Biol 2011;12:R1.

18. Li H, Durbin R. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 2010;26:589–95.

19. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics (Oxford, England) 2009;25:1754–60.

20. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. TheSequence Alignment/Map format and SAMtools. Bioinformatics (Oxford,England) 2009;25:2078–9.

21. DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, et al. Aframework for variation discovery and genotyping using next-generationDNA sequencing data. Nat Genet 2011;43:491–8.

22. McLarenW, Pritchard B, Rios D, Chen Y, Flicek P, Cunningham F. Derivingthe consequences of genomic variantswith the Ensembl API and SNPEffectPredictor. Bioinformatics (Oxford, England) 2010;26:2069–70.

23. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P,et al. A method and server for predicting damaging missense mutations.Nat Methods 2010;7:248–9.

24. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synon-ymous variants on protein function using the SIFT algorithm. Nat Protoc2009;4:1073–81.

25. Forbes SA, Beare D, Gunasekaran P, Leung K, Bindal N, Boutselakis H,et al. COSMIC: exploring the world's knowledge of somatic mutationsin human cancer. Nucleic Acids Res 2015;43(Database issue):D805–11.

26. Bolstad BM, Irizarry RA, Astrand M, Speed TP. A comparison of normal-ization methods for high density oligonucleotide array data based onvariance and bias. Bioinformatics 2003;19:185–93.

27. Irizarry RA, Bolstad BM,Collin F, Cope LM,Hobbs B, Speed TP. Summariesof Affymetrix GeneChip probe level data. Nucleic Acids Res. 2003;31:e15.

28. Irizarry RA,Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U,et al. Exploration, normalization, and summaries of high densityoligonucleotide array probe level data. Biostatistics 2003;4:249–64.

29. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarraysapplied to the ionizing radiation response. Proc Natl Acad Sci U S A2001;98:5116–21.

30. Benjamini YaYH.Controlling the false discovery rate: a practical andpowerful approach to multiple testing. In J Roy Stat Soc (Ser B)1995:289–300.

31. Team RDC. A language and environment for statistical computing. RFoundation for Statistical Computing, Vienna, AustriaISBN 3-900051-07-0, URL https://www.r-project.org/. 2010.

32. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, et al.Bioconductor: open software development for computational biology andbioinformatics. Genome Biol 2004;5:R80.

33. Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI geneexpression and hybridization array data repository. Nucleic Acids Res2002;30:207–10.

34. SubramanianA, TamayoP,Mootha VK,Mukherjee S, Ebert BL,GilletteMA,et al. Gene set enrichment analysis: a knowledge-based approach forinterpreting genome-wide expression profiles. Proc Natl Acad Sci U S A2005;102:15545–50.

35. Ran FA, Hsu PD, Lin CY, Gootenberg JS, Konermann S, Trevino AE, et al.Double nicking byRNA-guidedCRISPRCas9 for enhanced genome editingspecificity. Cell 2013;154:1380–9.

36. Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, et al.DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol2013;31:827–32.

37. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplexgenome engineering using CRISPR/Cas systems. Science 2013;339:819–23.

38. Lausten-Thomsen U, Madsen HO, Vestergaard TR, Hjalgrim H, Nersting J,Schmiegelow K. Prevalence of t(12;21)[ETV6-RUNX1]-positive cells inhealthy neonates. Blood 2011;117:186–9.

39. Perez-Caro M, Cobaleda C, Gonzalez-Herrero I, Vicente-Duenas C, Ber-mejo-Rodriguez C, Sanchez-Beato M, et al. Cancer induction by restrictionof oncogene expression to the stem cell compartment. EMBO J 2009;28:8–20.

40. Vicente-Duenas C, Hauer J, Ruiz-Roca L, Ingenhag D, Rodriguez-Meira A,Auer F, et al. Tumoral stem cell reprogramming as a driver of cancer: theory,biological models, implications in cancer therapy. Semin Cancer Biol2015;32:3–9.

41. Vicente-Duenas C, Romero-Camarero I, Cobaleda C, Sanchez-Garcia I.Function of oncogenes in cancer development: a changing paradigm.EMBO J 2013;32:1502–13.

42. Kumar S, Wuerffel R, Achour I, Lajoie B, Sen R, Dekker J, et al. Flexibleorderingof antibody class switch andV(D)J joining during B-cell ontogeny.Genes Dev 2013;27:2439–44.

43. Swaminathan S, Klemm L, Park E, Papaemmanuil E, Ford A, Kweon SM,et al. Mechanisms of clonal evolution in childhood acute lymphoblasticleukemia. Nat Immunol 2015;16:766–74.





https://www.r-project.org/


44. Yu W, Nagaoka H, Jankovic M, Misulovin Z, Suh H, Rolink A, et al.Continued RAG expression in late stages of B cell developmentand no apparent re-induction after immunization. Nature 1999;400:682–7.

45. Tsuzuki S, Seto M, Greaves M, Enver T. Modeling first-hit functionsof the t(12;21) TEL-AML1 translocation in mice. Proc Natl Acad SciU S A 2004;101:8443–8.

46. Martin-Lorenzo A, Hauer J, Vicente-Duenas C, Auer F, Gonzalez-Herrero I,Garcia-Ramirez I, et al. Infection exposure is a causal factor in B-precursoracute lymphoblastic leukemia as a result of Pax5 inherited susceptibility.Cancer Discov 2015;5:1328–43.

47. Matthews AG, Kuo AJ, Ramon-Maiques S, Han S, Champagne KS, IvanovD, et al. RAG2 PHD finger couples histone H3 lysine 4 trimethylation withV(D)J recombination. Nature 2007;450:1106–10.






2017;77:4365-4377. Published OnlineFirst June 19, 2017.Cancer Res Guillermo Rodríguez-Hernández, Julia Hauer, Alberto Martín-Lorenzo, et al. Leukemia via Impaired H3K4 Demethylases

Precursor B-cellETV6-RUNX1Infection Exposure Promotes

Updated version

10.1158/0008-5472.CAN-17-0701doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2017/06/17/0008-5472.CAN-17-0701.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/77/16/4365.full#ref-list-1

This article cites 45 articles, 14 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/77/16/4365.full#related-urls

This article has been cited by 4 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/77/16/4365To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-17-0701

http://cancerres.aacrjournals.org/content/suppl/2017/06/17/0008-5472.CAN-17-0701.DC1

http://cancerres.aacrjournals.org/content/77/16/4365.full#ref-list-1

http://cancerres.aacrjournals.org/content/77/16/4365.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/77/16/4365


infection exposure promotes etv6-runx1 precursor b-cell ... · tumor and stem cell biology...

Documents