inhibitionofhsp90byauy922preferentiallykills mutant kras ... · cancer biology and signal...

Cancer Biology and Signal Transduction

Inhibition of HSP90byAUY922 Preferentially KillsMutantKRASColonCancerCellsbyActivatingBimthrough ER StressChun YanWang1,2, Su Tang Guo1,2, Jia YuWang1, Fen Liu1,Yuan Yuan Zhang3, Hamed Yari1,Xu Guang Yan1, Lei Jin3, Xu Dong Zhang1, and Chen Chen Jiang3

Abstract

Oncogenic mutations of KRAS pose a great challenge in thetreatment of colorectal cancer. Here we report that mutant KRAScolon cancer cells are nevertheless more susceptible to apoptosisinduced by the HSP90 inhibitor AUY922 than those carryingwild-type KRAS. Although AUY922 inhibited HSP90 activity withcomparable potency in colon cancer cells irrespective of theirKRASmutational statuses, those withmutant KRASweremarked-ly more sensitive to AUY922-induced apoptosis. This was asso-ciated with upregulation of the BH3-only proteins Bim, Bik, andPUMA.However, onlyBimappeared essential, in that knockdownof Bim abolished, whereas knockdown of Bik or PUMA onlymoderately attenuated apoptosis induced by AUY922. Mechanis-

tic investigations revealed that endoplasmic reticulum (ER) stresswas responsible for AUY922-induced upregulation of Bim, whichwas inhibited by a chemical chaperone or overexpression ofGRP78. Conversely, siRNA knockdown of GRP78 or XBP-1enhanced AUY922-induced apoptosis. Remarkably, AUY922inhibited the growth of mutant KRAS colon cancer xenograftsthrough activation of Bim that was similarly associated withER stress. Taken together, these results suggest that AUY922 isa promising drug in the treatment of mutant KRAS coloncancers, and the agents that enhance the apoptosis-inducingpotential of Bimmaybeuseful to improve the therapeutic efficacy.Mol Cancer Ther; 15(3); 448–59. �2016 AACR.

IntroductionColon cancer is one of the most common and deadly malig-

nancies (1). Despite recent advances in early diagnosis and thedevelopment of molecularly targeted therapy, the overall survivalof patients with metastatic colon cancers remains disappointing(1). This is often associated with resistance of colon cancer cells tosystemic therapies resulting from oncogenic mutations of KRASwhich drive activation of multiple signaling pathways importantfor cell survival and proliferation (2). In fact, activatingmutationsof KRAS are found in up to 50% of colon cancers that forecastinherited resistance to antibodies against the EGFR (2, 3).

HSP90 is the most abundant molecular chaperone and isessential for folding, stabilization, and activation of a largenumber of proteins (4). In particular, many mutant and over-

expressed oncoproteins such as EGFR, mutant BRAF, and Aktare clients of HSP90 (4). As such, targeting HSP90 appears apromising approach in the treatment of cancer (4). Intriguing-ly, mutant KRAS-driven cancer cells have been noted to besensitive to HSP90 inhibition (5–7), but the molecularmechanisms involved remain poorly understood. Nevertheless,multiple HSP90 inhibitors are currently in clinical studies forthe treatment of cancer (4).

Induction of apoptosis is a common mechanism by whichtherapeutic drugs kill cancer cells (8). This is frequentlymediatedby activation of the mitochondrial apoptotic pathway, which isregulated by the balance between proapoptotic and antiapopto-tic Bcl-2 family proteins (8). Of note, multiple Bcl-2 familyproteins are responsive to inhibition of HSP90 in a cell-typeand context-dependent manner (9–12). In particular, p53-dependent induction of the BH3-only protein PUMA has beenshown to be responsible for apoptosis of colon cancer cellsinduced by the HSP90 inhibitor 17-AAG (10). Moreover, theantiapoptotic Bcl-2 family proteins, Bcl-2, Mcl-1, and Bcl-XL,have all been reported to protect cells against HSP90 inhibition–induced apoptosis (9, 11–13).

Another frequently observed consequence of HSP90 inhibi-tion is endoplasmic reticulum (ER) stress, which is characterizedby accumulation of unfolded and/or misfolded proteins in theER lumen. The ER responds to ER stress by activation of a rangeof signaling pathways, collectively called the ER stress responseor the unfolded protein response (UPR; refs. 14, 15). The UPR isinitiated by three ER transmembrane proteins, activating tran-scription factor 6 (ATF6), inositol-requiring enzyme 1 (IRE1),and double-stranded RNA-activated protein kinase-like ERkinase (PERK), and is essentially a cellular protective response.

1School of Biomedical Sciences and Pharmacy, The University ofNewcastle, New South Wales, Australia. 2Department of MolecularBiology, Shanxi Cancer Hospital and Institute, The Affiliated CancerHospital of Shanxi Medical University, Shanxi, China. 3School of Med-icine andPublicHealth,TheUniversityofNewcastle,NewSouthWales,Australia.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

Corresponding Authors: Xu Dong Zhang, University of Newcastle, LS3-49,Life Sciences Building, University of Newcastle, University Drive, Callaghan,NSW 2308, Australia. Phone: 612-4921-8906; Fax: 612-4921-7311; E-mail:[email protected]; and Chen Chen Jiang, E-mail:[email protected]

doi: 10.1158/1535-7163.MCT-15-0778

�2016 American Association for Cancer Research.

MolecularCancerTherapeutics

Mol Cancer Ther; 15(3) March 2016448

on June 22, 2020. © 2016 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst February 1, 2016; DOI: 10.1158/1535-7163.MCT-15-0778

http://mct.aacrjournals.org/

However, excessive UPR kills cells primarily by induction ofapoptosis (14–16). Multiple mechanisms such as activation ofthe BH3-only proteins Bim, PUMA, and Noxa, and downregu-

lation of antiapoptotic Bcl-2 family proteins including Bcl-2 andMcl-1 have been implicated in ER stress–induced apoptosis(17–19).

Figure 1.Mutant KRAS colon cancer cells aremore sensitive to killing byAUY922. A,colon cancer cells were treated withAUY922 for 48 hours. Cell viabilitywasquantitated using CellTiter-Gloassays. Data are mean � SE, n ¼ 3.�� , P < 0.01; � , P < 0.05, Student t test.B, comparison of IC50 of AUY922 incolon cancer cell lines treated with theinhibitor for 48 hours. Data are mean� SE, n ¼ 3. C, cells seeded at 2,000cells/well onto 6-well plates weretreated with AUY922 (80 nmol/L;left). Twelve days later, cells werestained crystal violet. Scale bar, 1 cm.Right, quantitation of results ofclonogenic assays as shown in the leftpanel. Data are representative (left) ormean � SE (right), n ¼ 3. � , P < 0.05,Student t test. D, five hundred cellswere seeded into a 96-wellPerfecta3D hanging drop plate. Fivedays later, cells were stained withcalcein AM and ethidium homodimer-1for 24 hours followed by treatmentwith AUY922 (80 nmol/L) for 48hours. Data are representative, n ¼ 3.Scale bars, 25 mm. E, whole cell lysateswere subjected to Western blotanalysis. Data are representative, n ¼3. F, cells transfected with the controlor HSP90 siRNAs were subjected toCellTiter-Glo assays (top) or Westernblot analysis (bottom). Data shownare either representative (bottom) ormean � SE (top), n ¼ 3. ��, P < 0.01,Student t test.

HSP90 Inhibition Kills Mutant KRAS Colon Cancer Cells

www.aacrjournals.org Mol Cancer Ther; 15(3) March 2016 449




Figure 2.AUY922 upregulates Bim, Bik, andPUMA in mutant colon cancer cells.A, cells were treated with z-VAD-fmk(30 mmol/L) for 1 hour before addingAUY922 (80 nmol/L) for 48 hours. Cellviability was quantitated by CellTiter-Glo assays. Data aremean� SE, n¼ 3.�� ,P<0.01, Student t test. B,whole celllysates from cells treated withAUY922 (80 nmol/L) for 48 hourswere subjected to Western blotanalysis. Data are representative,n ¼ 3. C, whole cell lysates from cellstransiently transfectedwith the vectoraloneor Bcl-2 cDNAwere subjected toWestern blot analysis (top). Cellstransiently transfectedwith the vectoralone or Bcl-2 cDNAwere treatedwithAUY922 (80 nmol/L) for 48 hoursbefore measurement of apoptosis bythe propidium iodide (PI) method(bottom). Data are representative(top) or mean � SE (bottom), n ¼ 3.� , P <0.05, Student t test. D, whole celllysates from cells transfected with thecontrol or Bax siRNAs were subjectedto Western blot analysis (top). Cellstransiently transfected with thecontrol or Bax siRNAs were treatedwithAUY922 (80 nmol/L) for 48 hours(bottom). Apoptosis wasmeasured ofby the PI method. Data arerepresentative (top) or mean � SE(bottom), n ¼ 3. � , P < 0.05, Studentt test. E, whole cell lysates from cellstreated with AUY922 (80 nmol/L) forthe indicated periods were subjectedto Western blot analysis. Data arerepresentative, n ¼ 3.

Wang et al.

Mol Cancer Ther; 15(3) March 2016 Molecular Cancer Therapeutics450




Wehave examined the potency of theHSP90 inhibitor AUY922in colon cancer cells with different mutational statuses of KRAS.We show here that AUY922 preferentially induces apoptosis inmutant compared with wild-type KRAS colon cancer cells, andthat activation of Bim through ER stress is responsible for apo-ptosis triggered by AUY922. In addition, we demonstrate thatAUY922 inhibits the growth of mutant KRAS colon cancer xeno-grafts similarly throughBim-mediated apoptosis that is associatedwith ER stress.

Materials and MethodsCell culture

Human colon cancer cell lines provided by Prof. GordonBurns (Faculty of Health and Medicine, University of New-castle, New South Wales, Australia) were described previously(20). The normal human colon epithelial cell line FHC (ATCC

CRL-1831) was from ATCC, and cultured as described previ-ously (20). Individual cell line authentication was regularlyconfirmed every 6 months using the AmpFISTR Identifier PCRAmplification Kit from Applied Biosystems and GeneMarkerV1.91 software (SoftGenetics LLC). The last test was done inMay 2015.

Three-dimensional cultureThree-dimensional (3D) culture was performed using the

hanging drop technique as described previously (21). Briefly,500 cells were seeded into the Perfecta3D hanging drop plate(3D Biomatrix), and monitored with the Axiovert and Axioplanmicroscope (Carl Zeiss) for at least 5 days. Cells were then stainedwith calcein AM and ethidium homodimer-1 (Life Technologies)for 24 hours followed by treatment. Spheroids were harvestedonto slides and examined with a fluorescence microscope (CarlZeiss).

Figure 3.Bim is essential for AUY922-induced apoptosis in mutant KRAS colon cancer cells. A–C, whole cell lysates from cells transfected with the control or Bim (A),Bik (B), or PUMA (C) siRNAs were subjected to Western blot analysis. Data are representative, n ¼ 3. D, HCT116 (top) and SW620 (bottom) cells transfectedwith the control or Bim, Bik, or PUMA siRNAs were treated with AUY922 (80 nmol/L) for 48 hours. Apoptosis was measured by the PI method. Data aremean � SE, n ¼ 3. � , P < 0.05, Student t test.






Wang et al.





Antibodies and reagentsAntibodies and reagents used are listed in Supplementary

Tables S1 and S2.

Quantitative real-time PCRqPCR was performed as described previously (17). The relative

abundance of target mRNA in control group was arbitrarilydesignated as 1. The primes are forward primers for Bim(GCCCCTACCTCCCTACAGAC), Bcl-2 (CTGCACCTGACGCCCT-TCACC), spliced XBP-1 (GCACCTGAGCCCCGAGGAGA), XBP-1(AGCCAAGGGGAATGAAGTGAG), or b-actin (GGCACCCAGCA-CAATGAAG); reverse primers for Bim (ATGGTGGTGGCCATA-CAAAT), Bcl-2 (CACATGACCCCACCGAACTCAAAGA). SplicedXBP-1 (TCATTCCCCTTGGCTTCCGCC), XBP-1 (CTGCAGAGGTG-CACGTAGTC), or b-actin (GCCGATCCACACGGAGTACT).

Plasmid vector and transfectionThe pCMV6-AC-GFP-Bcl-2 vector was from Origene (Austra-

lian Biosearch). GRP78 cDNA cloned into pcDNA3.1 was pro-vided by Dr. Richard C. Austin (McMaster University and theHamilton Civic Hospitals Research Centre, Hamilton, Ontario,Canada) and described elsewhere (22).

siRNA and shRNAsiRNA constructs are listed in Supplementary Table S3. siRNA

transfection was carried out as described previously (17). MIS-SION human short hairpin RNA (shRNA) lentiviral transductionparticles Bim (SHCLNV-NM_009754) and the control particleswere from Sigma-Aldrich.

Colon cancer xenograft mouse modelColon cancer cells were injected subcutaneously into flanks of

male athymic nude mice (Model Animal Research Centre ofNanjing University, China). Ten days after injection, when xeno-grafts were approximately 100 mm3, mice were randomlyassigned into different groups (n ¼ 8). Mice were treated dailywith AUY922 (50 mg/kg/day in sterile PBS via i.p. injection), orequivalent volumes of the vehicle (DMSO) for 10 days. Mice wereexamined as described previously and sacrificed at 28 days aftertumor cell transplantation (23). Studies on animals wereapproved by the Animal Research Ethics Committee of ShanxiCancer Hospital, China.

Statistical analysis and data presentationStatistical analysis was performed using JMP Statistics Made

Visual software. Student t test was used to assess differencesbetween different groups. A P value less than 0.05 was consideredstatistically significant.

ResultsMutant KRAS colon cancer cells are more susceptible to killingby AUY922

HCT116 (KRASG13D), SW620 (KRASG12V), andWiDr andCaco-2 (wild-type KRAS) cells were treated with AUY922 at increasingconcentrations for 48 hours. Strikingly, HCT116 and SW620 cellsappeared more sensitive than WiDr and Caco-2 cells to AUY922-induced reduction in viability as measured using CellTiter-Gloassays (Fig. 1A), with the half-maximum inhibitory concentration(IC50) values ranging from 76.5 to 82.2 nmol/L in HCT116 andSW620 cells, respectively, to >400 nmol/L in WiDr and Caco-2cells (Fig. 1A and B).Of importance, AUY922 did not significantlyaffect survival of normal colon epithelial cells even when used at400 nmol/L (Supplementary Fig. S1).

The different responses of the colon cancer cells to AUY922were also reflected in clonogenic assays and in cells grown in3D cultures when the inhibitor was used at 80 nmol/L (theapproximate IC50 value in HCT116 and SW620 cells; Fig. 1Cand D). Nevertheless, AUY922 at this concentration inhibitedHSP90 activity similarly in sensitive and resistant cells, as itinduced comparable degrees of downregulation of the HSP90clients CRAF and S-phase kinase-associated protein 2 (SKP2),and upregulation of HSP70 (Fig. 1E). Consistent with previousfindings (24), AUY922 inhibited activation of ERK and Akt,which are downstream of multiple clients of HSP90, incolon cancer cells irrespective of their KRAS mutational status(Fig. 1E).

The increased susceptibility of mutant KRAS colon cancer cellsto AUY922 was confirmed in additional two mutant KRAScell lines [SW480 (KRASG12V) and EB (KRASG12D)] and threewild-type KRAS colon cancer lines (Colo205, Lim1863, andLim1215; Fig. 1B). Of note, sensitivity of colon cancer cells toAUY922 was not associated with the expression levels of HSP90(Supplementary Fig. S2). Nevertheless, knockdown of HSP90aandb, twomajor isoformsofHSP90 that are inhibited byAUY922(25, 26), similarly inhibited survival of HCT116 and SW620 butnot WiDr and Caco-2 cells (Fig. 1F). Collectively, these resultsindicate that, in contrast to resistance to many therapeutic drugs(2, 3), mutant KRAS colon cancer cells are vulnerable to HSP90inhibition.

Killing of mutant KRAS colon cancer cells by AUY922 isassociated with upregulation of Bim, Bik, and PUMA

The general caspase inhibitor z-VAD-fmk efficiently inhibitedAUY922-induced HCT116 and SW620 cell death, indicating thatAUY922 kills these cells by apoptosis (Fig. 2A and SupplementaryFig. S3; ref. 27). In support, AUY922 caused accumulation of sub-

Figure 4.ER stress is responsible for upregulation of Bim by AUY922 in mutant KRAS colon cancer cells. A, whole cell lysates were subjected to Western blot analysis.Data are representative, n ¼ 3. B, total RNA from cells treated with AUY922 (80 nmol/L) was subjected for qPCR analysis of spliced XBP-1 (left) or nativeXBP-1 (right) mRNA. Data are mean� SE, n¼ 3. �� , P < 0.01; � , P < 0.05, Student t test. C, whole cell lysates from cells transfected with the control or CHOP siRNAswere subjected to Western blot analysis (top). HCT116 (middle) and SW620 (bottom) cells transfected with the control or CHOP siRNAs with or withouttreatment with AUY922 (80 nmol/L) for 48 hours were subjected to qPCR analysis. Data are representative (top) or mean � SE (middle and bottom), n ¼ 3.�� , P < 0.01, Student t test. D, HCT116 and SW620 cells were treated with BGP-15 (10 mmol/L) or 4-PBA (1 mmol/L) for 1 hour before the addition of AUY922(80 nmol/L) for further 48 hours. Apoptosis was measured by the PI method. Data are mean� SE, n ¼ 3. � , P < 0.05, Student t test. E, whole cell lysates from cellstreated with AUY922 (80 nmol/L) for 48 hours in the presence or absence of BGP-15 (10 mmol/L) or 4-PBA (1 mmol/L) were subjected to Western blot analysis.Data are representative, n ¼ 3. F, whole cell lysates from cells transiently transfected with the vector alone or GRP78 cDNA were subjected to Western blotanalysis (top). HCT116 and SW620 cells transiently transfected with the vector alone or GRP78 cDNA were subjected to measurement of apoptosis by the PImethod using flow cytometry (bottom). Data are representative (top) or mean � SE (bottom), n ¼ 3. � , P < 0.05, Student t test.






G1 DNA content, exposure of phosphatidylserine onto the cellsurface, activation of caspase-3, and cleavage of its substrate PARP(Fig. 2B and Supplementary Fig. S4). Overexpression of Bcl-2inhibited apoptosis induced by AUY922 (Fig. 2C), indicating thatthe mitochondrial apoptotic pathway plays an essential role.Consistently, knockdown of Bax also diminished apoptosisinduced by AUY922 (Fig. 2D; ref. 10). Moreover, AUY922 trig-gered reduction in the mitochondrial membrane potential,release of cytochrome c and Smac/DIABLO, and activation ofcaspase-9 in HCT116 and SW620 cells (Fig. 2B and Supplemen-tary Fig. S5).

As a client protein of HSP90, Bcl-2 was reduced rapidly inHCT116 and SW620 cells, but not in wild-type KRAS coloncancer cells, upon treatment with AUY922 (Fig. 2E; refs. 9, 28).On the other hand, the expression of the other antiapoptosisBcl-2 family proteins, Mcl-1 and Bcl-XL, was not changed byAUY922 even in HCT116 and SW620 cells (Fig. 2E). Remark-ably, AUY922 upregulated multiple BH3-only proteins, includ-ing Bim, Bik, and PUMA in sensitive but not in resistant coloncancer cells (Fig. 2E). There was no change in the expression ofBax and Bak, nor was there any alteration in phosphorylation(deactivation) of the BH3-only protein Bad, upon AUY922treatment in both mutant and wild-type KRAS colon cancercells (Fig. 2E).

Bim plays an essential role in apoptosis of mutant KRAS coloncancer cells induced by AUY922

We knocked down Bim, Bik, and PUMA using two individualsiRNAs in HCT116 and SW620 cells (Fig. 3A–C). Strikingly,knockdown of Bim abolished cell death induced by AUY922(Fig. 3D), whereas knockdown of Bik also inhibited, albeitpartially, AUY922-induced cell death (Fig. 3D). Consistent withthe lack of upregulation of Bim in wild-type KRAS colon cancercells by AUY922 (Fig. 2E), knockdown of Bim did not altersensitivity of Caco-2 cells to AUY922 (Supplementary Fig. S6).Of interest, although PUMA and p53 have been reported tomediate killing of colon cancer cells by the other HSP90 inhibitor17-AAG (10), knockdown of PUMA or p53 did not impinge onkilling ofHCT116and SW620 cells byAUY922 (Fig. 3CandDandSupplementary Fig. S7). Nevertheless, PUMA or p53 knockdowninhibited cell death induced by the MDM2 inhibitor nutlin-3(Supplementary Fig. S7; ref. 29), verifying the functional efficacyof the PUMA and p53 siRNAs.

AUY922-triggered ER stress is responsible for upregulation ofBim in mutant KRAS colon cancer cells

Upregulation of Bim by AUY922 was associated with eleva-tion in its mRNA levels (Supplementary Fig. S8A). This was dueto a transcriptional increase rather than changes in its stabilityas shown in actinomycin D–chasing assays (Supplementary Fig.S8B and S8C; ref. 17). As Bim transcription is responsive to ERstress (19), we tested whether ER stress was involved in upre-gulation of Bim by AUY922. Indeed, treatment with AUY922activated the ER stress response in mutant but not wild-typeKRAS colon cancer cells (Fig. 4A and B). Noticeably, theexpressions of IRE1 and PERK that have been reported to beHSP90 clients remain unchanged after treatment with AUY922(Fig. 4A).

As CCAAT-enhancer-binding protein homologous protein(CHOP) is responsible for transcriptional upregulation ofBim by ER stress (19), we examined the potential role of

CHOP in Bim upregulation by AUY922 in colon cancer cells.As shown in Fig. 4C, siRNA knockdown of CHOP inhibitedupregulation of Bim, activation of caspase-3, cleavage of PARP,and cell death induced by the inhibitor in HCT116 and SW620cells (Supplementary Fig. S9). In support, the chemical chap-eron BGP-15 or 4-PBA attenuated killing by AUY922 (Fig. 4D;refs. 30, 31). This was associated with reduced induction ofGRP78, spliced XBP-1, CHOP, and Bim (Fig. 4E and Supple-mentary Fig. S10). Similarly, overexpression of GRP78 inhib-ited AUY922-induced upregulation of CHOP and Bim andapoptosis in HCT116 and SW620 cells (Fig. 4F and Supple-mentary Fig. S11).

Inhibition of GRP78 or XBP-1 enhances AUY922-inducedkilling in colon cancer cells

We examined whether inhibition of GRP78 and XBP-1, twomajor prosurvival effectors of the ER stress response (14, 15),affected sensitivity of colon cancer cells to AUY922. Knock-down of either GRP78 or XBP-1 increased apoptosis induced byAUY922 in HCT116 and SW620 cells (Fig. 5A–C). Of note, italso rendered WiDr cells sensitive, albeit moderately, toAUY922-induced killing (Fig. 5A–C), suggesting that resistanceof wild-type KRAS colon cancer cells to AUY922 is, at least inpart, due to better adaptation to ER stress. The effect of XBP-1was further confirmed by treatment with salicylaldehyde thatinhibits the IRE1 endonuclease activity thus blocking splicing(activation) of XBP-1 (Fig. 5D; ref. 32).

Deficiency in Bim blocks the inhibitory effect of AUY922 onmutant KRAS colon cancer xenograft growth

To test the effect of AUY922 on the growth of colon cancers invivo, we transplanted HCT116 and WiDr cells into nu/nu mice.Administration of AUY922 inhibited established HCT116 tumorgrowth, but did not impinge on the growth of WiDr tumors (Fig.6A–C). Inhibition of HCT116 tumor growth by AUY922 wasassociated with activation of caspase-3, upregulation of Bim, andinduction of ER stress (Fig. 6D and E). However, the inhibitoryeffect was diminished in xenografts of HCT116 cells with Bimstably knocked down, although AUY922 triggered ER stress in thetumors (Fig. 6F–H).

DiscussionWe have shown in this study that mutant KRAS colon

cancer cells are more susceptible to apoptosis induced by theHSP90 inhibitor AUY922, consistent with the observations inother types of cancers that HSP90 inhibition has the greatesteffect in tumors addicted to particular driver oncogene pro-ducts, such as HER2 in breast cancer (33), mutant EGFR orALK translocations in non–small cell lung carcinoma (NSCLC;refs. 34, 35), and mutant BRAF in melanoma (36). In par-ticular, inhibition of HSP90 has been shown to have potentantitumor activity in mutant KRAS NSCLC models in vivo (37,38). Moreover, we have demonstrated that activation of Bimthough ER stress plays an essential role in AUY922-inducedapoptosis of mutant KRAS colon cancer cells (SupplementaryFig. S12).

Although HSP90 inhibition has diverse effects on cancer cells(4), AUY922 primarily induced caspase-dependent mitochondri-on-mediated apoptosis in mutant KRAS colon cancer cells. Thisbears important implications, in that the ultimate goal of

Wang et al.





Figure 5.Knockdown of GRP78 or XBP-1 enhances AUY922-induced killing of colon cancer cells. A, whole cell lysates from cells transfected with the control, GRP78 (top),or XBP-1 (bottom) siRNAs were treated with AUY922 (80 nmol/L). Whole cell lysates were subjected to Western blot analysis. Data are representative, n ¼ 3.B, total RNA from cells transfected with the control, GRP78, or XBP-1 siRNAs were subjected to qPCR analysis. Data are mean � SE, n ¼ 3. � , P < 0.05,Student t test. C, cells transfected with the control, GRP78, or XBP-1 siRNAs were treated with AUY922 (80 nmol/L) for 48 hours. Apoptosis was measured bythe PI method. Data are mean � SE, n ¼ 3. �, P < 0.05, Student t test. D, total RNA from cells treated with AUY922 (80 nmol/L) for 48 hours in the presenceor absence of salicylaldehyde (60 mmol/L) were subjected to qPCR analysis (top). Cells treatedwith AUY922 (80 nmol/L) for 48 hours in the presence or absence ofsalicylaldehyde (60 mmol/L) were subjected to the PI method (bottom). Data are mean � SE, n ¼ 3. � , P < 0.05, Student t test.






Figure 6.Mutant KRAS colon cancer xenografts deficient in Bim are resistant to AUY922. A, representative photographs of xenografts of HCT116 and WiDr cells grownin flanks of nu/nu mice (n ¼ 8) treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Mice were euthanized and tumors harvested at 28 daysafter the first treatment, n ¼ 8. Scale bar, 5 mm. B, comparison of growth rates of xenografts of HCT116 (left) and WiDr (right) cells in flanks of nu/nu mice (n ¼ 8)treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Data are mean � SE, n ¼ 8. � , P < 0.05, Student t test. C, comparison of weight ofharvested xenografts of HCT116 and WiDr cells in flanks of nu/nu mice treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Data are mean� SE, n¼ 8.�� , P < 0.01, Student t test. D, crude whole cell lysates from xenografts of HCT116 cells in nu/nu mice treated with the vehicle control (DMSO) or AUY922(50 mg/kg) were subjected to Western blot analysis. Data are representative, n ¼ 3. E, total RNA from xenografts of HCT116 cells in nu/nu treated with thevehicle control (DMSO) or AUY922 (50 mg/kg) was subjected to qPCR analysis of spliced XBP-1 (top) or native XBP-1 (bottom) mRNA. Data are mean �SE, n ¼ 3. �� , P < 0.01, Student t test. F, whole cell lysates from HCT116 cells stably transduced with the control shRNA (shControl) or Bim shRNA (shBim) weresubjected to Western blot analysis. Data are representative, n ¼ 3. G, representative photographs of xenografts of HCT116 stably transduced with shControl orshBim grown in flanks of nu/nu mice (n ¼ 8) treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Mice were euthanized and tumors harvested at28days after thefirst treatment,n¼8. Scale bar, 5mm.H, comparisonof volume (top) orweight (bottom)of xenografts ofHCT116 cells transducedwith the control orBim shRNA treated with the vehicle control (DMSO) or AUY922 (50 mg/kg). Data are mean � SE, n ¼ 8. �� , P < 0.01, Student t test.

Wang et al.





treatment of cancer is to eradicate cancer cells. While our resultsshowing that knockdown of Bax blocked induction of cell deathconsolidated the importance of the mitochondrial apoptoticpathway in AUY922-triggered killing, Bax-deficient colon cancercells have been shown to commit to necrosis upon treatment withthe other HSP90 inhibitor 17-AAG (10, 13, 39). This differencemay be due to the different HSP90 inhibitors used in the indi-vidual studies. Indeed, comparative analyses have shown thatthere are profound differences in biologic consequences of treat-ment of colon cancer cells with 17-AAG and AUY922 (40). Insupport, although p53 and PUMA are required for 17-AAG–induced apoptosis of colon cancer cells (10), they were indis-pensable for killing by AUY922. Regardless, our results clearlydemonstrated that Bim, but not PUMA or the other BH3-onlyprotein Bik, played a fundamental role in AUY922-inducedapoptosis of KRAS-mutant colon cancer cells.

An important finding of this studywas thatmutantKRAS coloncancer cells were more prone to AUY922-induced ER stress.Although ER stress has been found previously to contribute toapoptosis induced by HSP90 inhibition (41), the role of ERstress–induced Bim has not been documented. Consistent withthe previous finding that ER stress activates Bim transcriptionthrough CHOP (19), we found that knockdown of CHOP inhib-ited AUY922-triggered upregulation of Bim. Indeed, chemicalchaperones or overexpression ofGRP78,which alleviates ER stress(30), attenuated upregulation of CHOP and Bim by AUY922. Onthe other hand, siRNA inhibition of GRP78 or XBP-1, two well-established prosurvival effectors of the UPR (14, 15), enhancedupregulation of Bim and apoptosis caused by AUY922. It seemstherefore that other agents that induce ER stress may cooperatewith HSP90 inhibition to induce apoptosis in mutant KRAScolon cancer cells. In support with our findings in mutantKRAS colon cancer, deletion of CHOP in a mouse model ofmutant KRAS-induced lung cancer increases tumor incidence,suggesting that CHOP activity is a barrier to mutant KRAS-drivenmalignancy (42).

As a HSP90 client protein (9), Bcl-2 is reduced, as anticipat-ed, by AUY922. However, this was observed only in mutantKRAS colon cancer cells, suggesting that the chaperone effect ofHSP90 on Bcl-2 is highly selective and is associated with themutational status of KRAS in colon cancer cells. Many cocha-perones are involved in determining the selectivity of HSP90 onits clients (43–45). It is likely that signaling driven by mutantKRAS affects the activity of the cofactor needed for HSP90 tochaperone Bcl-2, thus making Bcl-2 more vulnerable to HSP90inhibition.

How does AUY922 preferentially induce ER stress in mutantKRAS colon cancer cells? It has been reported that killing ofmutant KRAS cancer cells by the HSP90 inhibitor 17-AGG orPU-H71 involves degradation of the serine/threonine kinaseSTK33 (6). However, degradation of STK33 appeared less likelyto be involved in AUY922-induced ER stress–mediated apo-ptosis of mutant KRAS colon cancer cells, as treatment withAUY922 did not cause any significant change in the expressionof STK33 in the cells (Supplementary Fig. S13). On the otherhand, oncogenic activation of KRAS may promote proteinsynthesis as does activating mutations of BRAF (46), whichrepresents an underlying mechanism of chronic ER stress incancer cells by uncoupling the ER protein folding load with theER protein folding capacity (46). In this case, inhibition ofHSP90 conceivably increases the content of proteins that can-

not be properly folded and thus exacerbates the ER stresscondition more markedly in mutant compared with wild-typeKRAS colon cancer cells.

Previous studies have shown that HSP90 inhibition reducesactivation of Akt and ERK, which are downstream of multipleclients of HSP90, contributes to induction of apoptosis(24, 47, 48). In particular, Akt itself is known to be a HSP90client protein (49). However, we found that activation of Aktand ERK was reduced by AUY922 in both mutant and wild-typeKRAS colon cancer cells, whereas the latter were markedly lesssensitive to apoptosis induced by the inhibitor, suggesting thatinhibition of Akt and ERK may not play a major role inAUY922-induced apoptosis in mutant KRAS colon cancer cells.Moreover, our finding that colon cancer cells that harbormutations in both BRAF and PI3K that is responsible foractivation of Akt (WiDr cells) are resistant to apoptosis inducedby AUY922 further highlights the selectivity of AUY922 formutant KRAS colon cancer cells.

The cytotoxic effect of AUY922 on mutant KRAS colon cancercells was mirrored by inhibition of the growth of mutant KRAScolon cancer xenografts, which, in accordance with the findings incolon cancer cell lines, was mediated by Bim and associated withER stress. This suggests that clinical evaluation of the efficacy ofAUY922 in patients with metastatic colon cancers carrying acti-vating mutations of KRAS is warranted, and that agents thatpotentiate the apoptosis-inducing effect of Bim, such as inhibitorsof the prosurvival Bcl-2 family proteins, may be considered forcombination with AUY922 in the treatment colon cancer (50). Asa precedent, although the HSP90 inhibitor ganetespib showedonly modest clinical activity in patients with mutant KRASNSCLC, combinations of the inhibitor and other agents havebeen proposed (37, 38).

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: C.Y. Wang, X.D. Zhang, C.C. JiangDevelopment of methodology: C.Y. Wang, S.T. Guo, X.G. Yan, L. JinAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): C.Y. Wang, S.T. Guo, J.Y. Wang, F. Liu, Y.Y. Zhang,X.G. YanAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): C.Y. Wang, J.Y. Wang, H. Yari, X.G. Yan, L. Jin,X.D. ZhangWriting, review, and/or revision of the manuscript: C.Y. Wang, H. Yari,X.D. Zhang, C.C. JiangAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): C.Y. Wang, X.G. YanStudy supervision: X.D. Zhang, C.C. Jiang

Grant SupportThis study was supported by Cancer Council NSW, Australia (RG 15-08),

which was awarded to X.D. Zhang. C.C. Jiang and L. Jin are recipients of CancerInstitute NSW Fellowships. X.D. Zhang is supported by a Senior ResearchFellowship of NHMRC.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received September 24, 2015; revised December 22, 2015; accepted January4, 2016; published OnlineFirst February 1, 2016.






References1. Hugen N, Brown G, Glynne-Jones R, deWilt JH, Nagtegaal ID. Advances in

the care of patients with mucinous colorectal cancer. Nat Rev Clin Oncol2015;140:1–9.

2. Misale S, Yaeger R, Hobor S, Scala E, Janakiraman M, Liska D, et al.Emergence of KRAS mutations and acquired resistance to anti-EGFRtherapy in colorectal cancer. Nature 2012;486:532–6.

3. Wheeler DL, Dunn EF, Harari PM. Understanding resistance to EGFRinhibitors-impact on future treatment strategies. Nat Rev Clin Oncol2010;7:493–507.

4. Solit DB, Rosen N. Hsp90: a novel target for cancer therapy. Curr Top MedChem 2006;6:1205–14.

5. Qi X, Xie C, Hou S, Li G, Yin N, Dong L, et al. Identification of a ternaryprotein-complex as a therapeutic target for K-Ras-dependent colon cancer.Oncotarget 2014;5:4269–82.

6. Azoitei N, Hoffmann CM, Ellegast JM, Ball CR, Obermayer K,Gossele U, et al. Targeting of KRAS mutant tumors by HSP90inhibitors involves degradation of STK33. J Exp Med 2012;209:697–711.

7. Cercek A, Shia J, GollubM, Chou JF, CapanuM, Raasch P, et al. Ganetespib,a novel Hsp90 inhibitor in patients with KRAS mutated and wild type,refractory metastatic colorectal cancer. Clin Colorectal Cancer 2014;13:207–12.

8. Sellers WR, Fisher DE. Apoptosis and cancer drug targeting. J Clin Invest1999;104:1655–61.

9. Cohen-SaidonC,Carmi I, KerenA, Razin E. Antiapoptotic function of Bcl-2inmast cells is dependent on its associationwithheat shock protein 90beta.Blood 2006;107:1413–20.

10. He K, Zheng X, Zhang L, Yu J. Hsp90 inhibitors promote p53-depen-dent apoptosis through PUMA and Bax. Mol Cancer Ther 2013;12:2559–68.

11. Busacca S, Law EW, Powley IR, Proia DA, Sequeira M, Le Quesne J, et al.Resistance to HSP90 inhibition involving loss of MCL1 addiction. Onco-gene 2015;213:1–10.

12. Lee DH, Sung KS, Bartlett DL, Kwon YT, Lee YJ. HSP90 inhibitor NVP-AUY922 enhances TRAIL-induced apoptosis by suppressing the JAK2-STAT3-Mcl-1 signal transduction pathway in colorectal cancer cells. CellSignal 2015;27:293–305.

13. KimYJ, Lee SA,Myung SC, KimW, LeeCS. Radicicol, an inhibitor ofHsp90,enhances TRAIL-induced apoptosis in human epithelial ovarian carcinomacells by promoting activation of apoptosis-related proteins. Mol CellBiochem 2012;359:33–43.

14. Harding HP, Calfon M, Urano F, Novoa I, Ron D. Transcriptional andtranslational control in the Mammalian unfolded protein response. AnnuRev Cell Dev Biol 2002;18:575–99.

15. Zhang K, Kaufman RJ. Signaling the unfolded protein response from theendoplasmic reticulum. J Biol Chem 2004;279:25935–8.

16. Schroder M, Kaufman RJ. The mammalian unfolded protein response.Annu Rev Biochem 2005;74:739–89.

17. Jiang CC, Lucas K, Avery-Kiejda KA, Wade M, deBock CE, Thorne RF,et al. Up-regulation of Mcl-1 is critical for survival of human mela-noma cells upon endoplasmic reticulum stress. Cancer Res 2008;68:6708–17.

18. Li J, Lee B, Lee AS. Endoplasmic reticulum stress-induced apoptosis:multiple pathways and activation of p53-up-regulated modulatorof apoptosis (PUMA) and NOXA by p53. J Biol Chem 2006;281:7260–70.

19. PuthalakathH,O'Reilly LA, Gunn P, Lee L, Kelly PN, HuntingtonND, et al.ER stress triggers apoptosis by activating BH3-only protein Bim. Cell2007;129:1337–49.

20. Guo ST, Chi MN, Yang RH, Guo XY, Zan LK, Wang CY, et al. INPP4Bis an oncogenic regulator in human colon cancer. Oncogene 2015;361:1–13.

21. Tay KH, Liu X, Chi M, Jin L, Jiang CC, Guo ST, et al. Involvement ofvacuolar H(þ)-ATPase in killing of human melanoma cells by thesphingosine kinase analogue FTY720. Pigment Cell Melanoma Res2015;28:171–83.

22. Werstuck GH, Lentz SR, Dayal S, Hossain GS, Sood SK, Shi YY, et al.Homocysteine-induced endoplasmic reticulum stress causes dysregulationof the cholesterol and triglyceride biosynthetic pathways. J Clin Invest2001;107:1263–73.

23. Lai F, Guo ST, Jin L, Jiang CC, Wang CY, Croft A, et al. Cotargeting histonedeacetylases and oncogenic BRAF synergistically kills human melanomacells by necrosis independently of RIPK1 and RIPK3. Cell Death Dis2013;4:e655.

24. Koga F, Xu W, Karpova TS, McNally JG, Baron R, Neckers L. Hsp90inhibition transiently activates Src kinase and promotes Src-depen-dent Akt and Erk activation. Proc Natl Acad Sci U S A 2006;103:11318–22.

25. Eccles SA, Massey A, Raynaud FI, Sharp SY, Box G, Valenti M, et al. NVP-AUY922: a novel heat shock protein 90 inhibitor active against xeno-graft tumor growth, angiogenesis, and metastasis. Cancer Res 2008;68:2850–60.

26. Garon EB, Finn RS, Hamidi H, Dering J, Pitts S, Kamranpour N, et al. TheHSP90 inhibitorNVP-AUY922potently inhibits non-small cell lung cancergrowth. Mol Cancer Ther 2013;12:890–900.

27. Jiang CC, Chen LH, Gillespie S, Wang YF, Kiejda KA, Zhang XD,et al. Inhibition of MEK sensitizes human melanoma cells toendoplasmic reticulum stress-induced apoptosis. Cancer Res 2007;67:9750–61.

28. Gallerne C, Prola A, Lemaire C. Hsp90 inhibition by PU-H71 inducesapoptosis through endoplasmic reticulum stress and mitochondrial path-way in cancer cells and overcomes the resistance conferred by Bcl-2.Biochim Biophys Acta 2013;1833:1356–66.

29. Tseng HY, Jiang CC, Croft A, Tay KH, Thorne RF, Yang F, et al. Contrastingeffects of nutlin-3 on TRAIL- and docetaxel-induced apoptosis due toupregulation of TRAIL-R2 and Mcl-1 in human melanoma cells. MolCancer Ther 2010;9:3363–74.

30. Wu LL, Russell DL, Wong SL, Chen M, Tsai TS, St John JC, et al. Mito-chondrial dysfunction in oocytes of obese mothers: transmission to off-spring and reversal by pharmacological endoplasmic reticulum stressinhibitors. Development 2015;142:681–91.

31. Asahi J, KamoH, Baba R,Doi Y, Yamashita A,MurakamiD, et al. BisphenolA induces endoplasmic reticulum stress-associated apoptosis in mousenon-parenchymal hepatocytes. Life Sci 2010;87:431–8.

32. VolkmannK, Lucas JL, VugaD,WangX, BrummD,StilesC, et al. Potent andselective inhibitors of the inositol-requiring enzyme 1 endoribonuclease.J Biol Chem 2011;286:12743–55.

33. Desale SS, Raja SM, Kim JO, Mohapatra B, Soni KS, Luan H, et al.Polypeptide-based nanogels co-encapsulating a synergistic combina-tion of doxorubicin with 17-AAG show potent anti-tumor activityin ErbB2-driven breast cancer models. J Control Release 2015;208:59–66.

34. Tanimoto A, Yamada T, Nanjo S, Takeuchi S, Ebi H, Kita K, et al.Receptor ligand-triggered resistance to alectinib and its circumventionby Hsp90 inhibition in EML4-ALK lung cancer cells. Oncotarget 2014;5:4920–8.

35. Hong YS, Jang WJ, Chun KS, Jeong CH. Hsp90 inhibition by WK88-1potently suppresses the growth of gefitinib-resistant H1975 cellsharboring the T790M mutation in EGFR. Oncol Rep 2014;31:2619–24.

36. Smyth T, Paraiso KH, Hearn K, Rodriguez-Lopez AM, Munck JM, HaarbergHE, et al. Inhibition of HSP90 by AT13387 delays the emergence ofresistance to BRAF inhibitors and overcomes resistance to dual BRAFand MEK inhibition in melanoma models. Mol Cancer Ther 2014;13:2793–804.

37. Socinski MA, Goldman J, El-Hariry I, KoczywasM, Vukovic V, Horn L, et al.A multicenter phase II study of ganetespib monotherapy in patients withgenotypically definedadvancednon-small cell lung cancer. ClinCancer Res2013;19:3068–77.

38. Acquaviva J, Smith DL, Sang J, Friedland JC, He S, Sequeira M, et al.Targeting KRAS-mutant non-small cell lung cancer with the Hsp90 inhib-itor ganetespib. Mol Cancer Ther 2012;11:2633–43.

39. Powers MV, Valenti M, Miranda S, Maloney A, Eccles SA, Thomas G, et al.Mode of cell death induced by the HSP90 inhibitor 17-AAG (tanespimy-cin) is dependent on the expression of pro-apoptotic BAX. Oncotarget2013;4:1963–75.

40. Mayor-Lopez L, Tristante E, Carballo-SantanaM, Carrasco-Garcia E, GrassoS, Garcia-Morales P, et al. Comparative study of 17-AAG andNVP-AUY922in pancreatic and colorectal cancer cells: are there commondeterminants ofsensitivity? Transl Oncol 2014;7:590–604.

Wang et al.





41. Davenport EL, Moore HE, Dunlop AS, Sharp SY, Workman P, Morgan GJ,et al. Heat shock protein inhibition is associated with activation of theunfolded protein response pathway in myeloma plasma cells. Blood2007;110:2641–9.

42. Huber AL, Lebeau J, Guillaumot P, Petrilli V,MalekM, Chilloux J, et al. p58(IPK)-mediated attenuation of the proapoptotic PERK-CHOP pathwayallows malignant progression upon low glucose. Mol Cell 2013;49:1049–59.

43. Li J, Soroka J, Buchner J. The Hsp90 chaperonemachinery: conformationaldynamics and regulation by co-chaperones. Biochim Biophys Acta2012;1823:624–35.

44. Li J, Buchner J. Structure, function and regulation of the hsp90 machinery.Biomed J 2013;36:106–17.

45. Walton-Diaz A, Khan S, Bourboulia D, Trepel JB, Neckers L, Molla-pour M. Contributions of co-chaperones and post-translational mod-ifications towards Hsp90 drug sensitivity. Future Med Chem 2013;5:1059–71.

46. Croft A, Tay KH, Boyd SC, Guo ST, Jiang CC, Lai F, et al. Oncogenicactivation of MEK/ERK primes melanoma cells for adaptation to endo-plasmic reticulum stress. J Invest Dermatol 2014;134:488–97.

47. Luo H, Yang Y, Duan J, Wu P, Jiang Q, Xu C. PTEN-regulated AKT/FoxO3a/Bim signaling contributes to reactive oxygen species-mediatedapoptosis in selenite-treated colorectal cancer cells. Cell Death Dis2013;4:e481.

48. Shinjyo T, Kuribara R, Inukai T, Hosoi H, Kinoshita T, Miyajima A, et al.Downregulation of Bim, a proapoptotic relative of Bcl-2, is a pivotal step incytokine-initiated survival signaling inmurine hematopoietic progenitors.Mol Cell Biol 2001;21:854–64.

49. Basso AD, Solit DB, Chiosis G, Giri B, Tsichlis P, Rosen N. Akt forms anintracellular complex with heat shock protein 90 (Hsp90) and Cdc37 andis destabilized by inhibitors of Hsp90 function. J Biol Chem 2002;277:39858–66.

50. Lessene G, Czabotar PE, Colman PM. BCL-2 family antagonists for cancertherapy. Nat Rev Drug Discov 2008;7:989–1000.






2016;15:448-459. Published OnlineFirst February 1, 2016.Mol Cancer Ther Chun Yan Wang, Su Tang Guo, Jia Yu Wang, et al. Colon Cancer Cells by Activating Bim through ER Stress

KRASInhibition of HSP90 by AUY922 Preferentially Kills Mutant

Updated version

10.1158/1535-7163.MCT-15-0778doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2016/01/30/1535-7163.MCT-15-0778.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/15/3/448.full#ref-list-1

This article cites 50 articles, 19 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/15/3/448To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-15-0778

http://mct.aacrjournals.org/content/suppl/2016/01/30/1535-7163.MCT-15-0778.DC1

http://mct.aacrjournals.org/content/15/3/448.full#ref-list-1

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/15/3/448


inhibitionofhsp90byauy922preferentiallykills mutant kras ... · cancer biology and signal...

Documents