Department of Microbiology and Infectious Diseases

Faculty of Veterinary Science

Szent István University

Comparison of putative, virulence-associated genetic markersof West Nile virus strains

Written by:

Majid Al-Qasimi

Supervisor:

Tamás Bakonyi, DVM, PhD

Budapest

2009

1

CONTENTS

List of abbreviations 3

I. INTRODUCTION 4

Historical background 4

Etiology 4

Distribution 5

Epizootiology 6

Pathogenesis 7

Clinical signs 7

Lesions 8

Differential Diagnosis 9

West Nile virus in Hungary 9

Pathogenicity markers of WNV 11

II. MATERIALS AND METHODS 14

Samples 14

RNA extraction, RT-PCR, sequencing and genetic comparison 15

III. RESULTS AND DISCUSSION 18

V. REFERENCES 23

VI. SUMMARY 28

VII. ÖSSZEFOGLALÁS 29

2

List of abbreviations

aa: amino acid

ALFV: Alfuy virus

BLAST: Basic local alignment search tool

CNS: Central nervous system

CPCV: Cacipacore virus

JEV: Japanese encephalitis virus

KOUV: Koutango virus

MVEV: Murray valley encephalitis virus

RER: Rough endoplasmic reticulum

RNA: Ribonucleic acid

RT-PCR: Reverse transcription polymerase chain reaction

SLEV: St. Louis encephalitis virus

USUV: Usutu virus

WNF: West Nile fever

WNV: West Nile virus

YAOV: Yaounde virus

3

I. INTRODUCTION

West Nile virus (WNV) a member of the family Flaviviridae, genus Flavivirus, is

currently widespread over Africa, Eurasia, Australia and North America (Zeller and

Schuffnecker, 2004). This arbovirus is the causative agent for West Nile fever

(WNF), a disease characterized by fever, general symptoms, and encephalitis in

different vertebrate hosts (Heinz et al., 2000).

WNV is naturally found to infect and circulate in wild bird populations, and

transmitted via haematophagous arthropods, mainly mosquitoes. Certain bird species

are reservoir hosts of the virus, while infections of other hosts, such as other bird

species and mammals (predominantly horses and humans), may lead to development

of clinical symptoms, and even fatal central nervous system (CNS) disease.

Mosquitoes play a central role of the infection of incidental hosts, acting as bridge

vectors between them and the reservoir birds.

Due to the emergence of WNV infections in the United States and the economic

losses caused to horse and geese populations, as well as the zoonotic danger to

humans, emphasis on the research into WNV characteristics has been conducted over

the last few years. (Hayes et al., 2005 a and b)

HISTORICAL BACKGROUND

WNV was first identified in the West Nile district of Uganda in 1937. Blood collected

from an African woman suffering, mild fever revealed a virus that was later called

West Nile virus (Smithburn et al., 1940). Although antibodies against WNV are

commonly found in Africa, association with human disease was not apparent at first.

The same virus was later (1951) isolated in Egypt from healthy children, wild birds,

mosquitoes and from the brain of a horse with encephalitis (Melnick et al., 1951).

Cross-neutralization experiments demonstrated that the virus was serologically related

to Japanese encephalitis virus (JEV) (Smithburn, 1942).

ETIOLOGY

The virus:

Flaviviruses are single stranded RNA viruses. They are spherical and enveloped

measuring 40 to 60 nm in diameter. The virion structure is made up of three structural

4

proteins, the capsid (C), membrane (M), and the envelope (E) proteins and carries

~11kb single-stranded, positive-sense RNA genome. The genomic RNA contains a 5’

cap structure, however lacks a polyadenylated tail. Upon translation of the genomic

RNA, it acts as a single open reading frame encoding viral polyproteins that are post-

transitionally processed by cellular and viral proteases yielding a minimum of 10

separate products. Moving from the N terminal the encoding follows as such:

structural proteins C, pre-M, and E, then the non-structural proteins NS1, NS2A and

NS2B, NS3, NS4A and NS4B, and NS5 (Rice, 1985 and 1986).

Based on cross-neutralization studies employing polyclonal antisera, flaviviruses have

been divided into eight antigenic complexes; several viruses, however, could not be

assigned to any group (Calisher et al., 1989). A comprehensive phylogenetic analysis

involving 68 flaviviruses was carried out on partial nucleotide sequences of the NS5

coding- and 3' noncoding regions (Kuno et al., 1998). According to the sequence

identities and phylogenetic trees, the genus Flavivirus segregated into 14 clades

belonging to three clusters.

Hemaglutination inhibition and cross neutralization data have demonstrated that

WNV is a member of the JE virus serocomplex. Other members of the JEV group

flaviviruses are Cacipacore virus (CPCV), Koutango virus (KOUV), St. Louis

encephalitis virus (SLEV), Murray Valley encephalitis virus (MVEV), Alfuy virus

(ALFV), Usutu virus (USUV), and Yaounde virus (YAOV) (Heinz et al., 2000).

Strains:

The WNV has many strains that show relatively high nucleotide and amino acid

sequence diversity. Of the studies conducted on their phylogenetic relatedness, it was

revealed that the WNV could be grouped into two main lineages (Berhet et al., 1997;

Lanciotti et al., 2002; Charrel et al., 2003). Lineage 1 holds the WNV strains from

different regions and so, is divided into three clades. Clade “a” contains strains from

Europe, Africa, Near East and America. Clade “b” represents Australian (Kunjin)

strains and Clade “c” has strains of Indian isolates. Lineage 2 viruses are endemic to

Africa and Madagascar as well as the B956 prototype strain. Recent work done in

isolation of new genotypes found in Central Europe, in Russia and in India, suggest

the existence of further genetic lineages of WNV (Bakonyi et al., 2005; Bondre, 2007)

DISTRIBUTION

5

West Nile virus was first isolated in Uganda 1937. Later it has been identified as the

causative agent of endemics and epidemics of viral encephalitis in Europe, Africa,

Asia, and has resulted in an epidemic outbreak in the United States in 1999 (Hubálek

and Halouzka, 1999). The epidemic in America occurred in the late summer, in the

north eastern states, causing an outbreak of human encephalitis as well as concurrent

widespread mortality in crows and exotic birds of a zoological park (Anderson et al.,

1999). The WNV has since spread west across to Canadian provinces and Mexico

(Blitvich et al., 2003). After its emergence, within six years WNV caused >17 000

human infections and >670 deaths (CDC, 2005).

The spread of West Nile virus across continents has been attributed to migratory birds

belonging to the Palearctic-African migration system or wintering in the

Mediterranean area, playing a central role, and are presumably responsible for

periodic introductions of African or Middle Eastern WNV into Europe (Hubálek,

2000). The strain, which emerged in the USA is presumably originated from Israel,

however the route of introduction remained unclear (Giladi et al., 2001).

EPIZOOTIOLOGY

The WNV natural cycle involves the main vertebrate hosts (avian species) and

arthropod vectors, which feed on the hosts. Vectors responsible for the spread of

WNV are mosquitoes of various genera, with Culex being the predominant one

(Komar et al., 2003). When a female mosquito takes a blood meal from an infected

host (bird) they become infective after 10-14 days of incubation. After this they are

capable of transmitting the WNV through a second blood meal. Birds involved in this

enzootic cycle do not develop disease, and hence act as reservoirs. The more

susceptible species, avian and mammalian, are infected when a “bridge-vector” feeds

on both an infected host and then, after an extrinsic incubation time, on the

susceptible species. This is thought to be the method of transmission of WNV to

humans, horses and other species (Taylor et al., 1956).

Host to host transmission has been described possible if bird secretions (oral or

cloacal) contaminate water and food (Banet-Noach et al., 2003).

There may be a direct bird to bird transmission, but the cause is unknown. Research

has also shown that the virus may be passed to raptors by eating infected birds

(Garmendia et al., 2000). Ticks in Asia and Africa, infected with the virus have been

found, but there are no verified reports of ticks spreading the virus and their role in

6

transmission has not been determined, the most likely route of transmission still being

the mosquito (Hayes, 1989).

PATHOGENESIS

When WNV is inoculated into the skin via a mosquito bite, a local replication starts

which then spreads to the regional lymph nodes. The virus is then carried via the

lymphatic system to the thoracic duct to then enter the systemic circulation. The

viraemia level is affected by the rate of clearance of macrophages and ends when

humoral antibodies appear, one week post infection.

Viral penetration of the CNS appears to follow stimulation of toll-like receptors and

increased levels of tumor necrosis factor-, which increases permeability of the

blood-brain barrier (Wang et al. 2004). WNV directly infects neurons in grey matter

and deep nuclei of the CNS. Simultaneous destruction of bystander nerve cells may

contribute to symptoms of paralysis. It is also believed the immune mediated tissue

damage also contributes to pathological consequences.

There are 3 degrees of pathogenesis: 1) Early viraemia and large-scale extraneural

replication resulting in fatal encephalitis. 2) Low viraemia with and late established

brain infection resulting in subclinical encephalitis. 3) Trace viraemia and limited

extraneural replication, with no neural invasion evident (Ceccaldi et al, 2004).

CLINICAL SIGNS

Most WNV infections are mild and subclinical, however approximately 20 % of the

infections result in symptoms ranging from mild fever to fatal encephalitis both in

humans, horses, free-flying and captured birds (Banet-Noach et al., 2003.).

Clinical signs of WNF in humans are usually mild and include fever, headache, body

aches and, in some cases, skin rash and swollen lymph glands (Watson et al., 2004).

Severe infections include high fever, neck stiffness, muscle weakness, convulsions

and paralysis. Death rates associated with severe infection range from 3% to 15% and

are highest among the elderly. In horses the most common sign is weakness in the

hindquarters, indicated by a widened stance, stumbling, leaning, and toe dragging. In

extreme cases, paralysis develops. Sometimes other symptoms, such as fever,

depression and fearfulness, can follow. Approximately 33% of cases of WNV

encephalitis in horses proved fatal during the 2001 outbreak in the United States

(Porter et al., 2003).

7

In several wild bird species the disease is not systematic, making them good

reservoirs that mobilise the virus along their migration paths. In contrast, most corvids

infected with WNV die within 3 weeks of infection (Komar et al., 2003). Clinical

signs are generalized and may include incoordinated walking, weakness, lethargy,

tremors, and abnormal head posture. Wild birds infected with WNV are most often

found dead; therefore, descriptions of clinical signs in these cases are not readily

available. Domestic birds such as chicken do not seem to develop the disease;

however ducks and pigeons develop similar signs to those observed in wild birds

(Kramer and Bernard, 2001). Clinical signs associated with WNV infection in dogs,

cats, domestic rabbits and other small mammalians have not been well described. It

appears that, although they may be infected, many members of these latter species

rarely develop clinical signs of disease. However if clinical signs do develop, they

include fever, listlessness, stumbling, lack of coordination, ataxia, partial paralysis

and death (Austgen et al., 2004).

LESIONS

WNV shows no pathonomic lesions. Observed changes in humans and experimental

animals with WNV encephalitis include neuronal and glial damage caused directly by

viral injury and characterized by central chromatolysis, cytoplasmic eosinophilia, cell

shrinkage, and neuronophagia; inflammation, including perivascular infiltration of

small lymphocytes, plasma cells, and macrophages; cellular nodule formation

composed of activated microglia and mononuclear cells; and cerebral interstitial

edema (Sampson et al., 2000). Infection of neurons is characterized by marked

proliferation and hypertrophy of rough endoplasmic reticulum (RER), accumulation

of vesicular structures derived from the RER and containing virus particles, and

progressive degeneration of the RER and Golgi apparatus. It is suggested the neurone

dysfunction is responsible for fatality in the host, as apposed to neuronal destruction.

Residual changes and disturbances have been noted to persist after recovery from

acute encephalitis. In experimental animals, changes in behaviour and learning ability

have been documented (Austgen et al., 2004).

In birds, necropsy usually shows no pathological signs indicative of WNV infection,

but histologically the signs of encephalitis are visible (Komar et al., 2003). In horses,

no gross pathologic lesions have been detected. Histologically, animals exhibit slight

to moderate nonsuppurative encephalomyelitis, primarily in the spinal cord and lower

8

brainstem, in both grey and white matter. The most severe lesions are usually in the

thoracic and lumbar spinal cord (Castillo-Olivares and Wood, 2004).

DIFFERENTIAL DIAGNOSIS

Since most infections of WNV are subclinical, they can be diagnosed only on the

basis of the detection of the virus or specific anti-viral antibodies. Cases that do

manifest clinical signs, are of the neurological type, and must therefore be

differentiated from other neurological disorder causing diseases.

In birds WNV must be differentiated from Newcastle disease, Avian

encephalomyelitis, Avian influenza, Marek’s disease, Eastern encephalitis and non

viral causes of neurological disorders as avian encephalomalacia (vitamin E

deficiency), vitamin B1 or B2 deficiency, and encephalitis caused by bacteria, fungi

(i.e. aspergillosis), or mycoplasmas.

In horses, differential diagnostic includes Equine protozoal myeloencephalitis,

Cervical vertebral myelopathy, Equine herpesvirus 1 infection, Equine degenerative

myelopathy, Western-, Eastern- and Venezuelan equine encephalitis, Japanese

encephalitis, Borna disease or botulism. Considering the ascending paralysis,

mentation changes, and hyperesthesia in some cases, all horses that die or are

euthanized should be sent for rabies diagnostics.

WEST NILE VIRUS IN HUNGARY

WNV has been present in Hungary a long time. Seroprevalence in humans has been

reported in 1969 (Koller et al.), and the virus was isolated from rodents (bank vole,

Clethrionomys glareolus, 1972, and yellow-necked mouse, Apodemus flavicollis,

1976) (Molnár, 1982). However, clinical symptoms were never prevalent until 2003,

when enzootic encephalitis emerged in a Hungarian goose flock resulting in a 14%

mortality rate of 6 weeks-old geese (Anser anser domesticus). Based on the

histopathological alterations, serological investigations and nucleic acid detection by

RT-PCR, WNV was diagnosed as the causative agent of the disease (Glávits et al.,

2005). At the same time, an endemic of WNV was observed also in humans in

Hungary, which involved 14 reported cases of mild encephalitis and meningitis

(Ferenczi et al., 2005).

One year later, in September 2004, a goshawk (Accipiter gentilis) showed CNS

symptoms and died in a national park at the south-eastern part of Hungary. Clinical

9

signs were sudden in onset and comprised ataxia, head tremors and, in the terminal

phase, seizures. On post-mortem, macroscopic lesions were found to be non-specific,

showing only the congestion of internal organs in cases. Examination of hematoxylin-

eosin stained histological sections of the central nervous system revealed multi-focal,

lymphocytic panencephalitis with marked gliosis, and neuronal degeneration

comprising chromatolysis, necrosis and neuronocytophagia. Additionally,

demyelination of the cerebellar white matter and lymphocytic meningitis were

detected, and mild, focal mononuclear infiltration was present in peripheral nerves of

the sciatic plexus. Spleen displayed multi-focal proliferation of reticulocytes and

lymphoid depletion. Multi-focal lympho-histiocytic myocarditis was detected in the

heart. Multi-focal interstitial lympho-histiocytic nephritis was detected, lungs were

congested, and mild lymphocytic enteritis and proventriculitis was present in the bird

(Erdélyi et al., 2007). Using histopathological methods and RT-PCR, WNV antigen

and nucleic acid were detected in the organs of the bird (Erdélyi et al., 2007).

The virus isolated in 2003 was indicated as belonging to lineage 1. The virus in 2004

was traced to a lineage 2 West Nile virus, thereafter establishing itself in Hungary.

Sporadic cases were detected in the next year in birds of prey (goshawk, sparrow-

hawk [Accipiter nisus]) and the virus was also isolated from the brain of a sheep,

which died in encephalitis in 2005 (Erdélyi et al., 2007, Kecskeméti et al., 2007) In

2007 WNV was detected in an encephalitic horse, and further outbreaks in wild and

domestic birds were diagnosed in the eastern part of Hungary. In 2008 significant

geographic spread of the virus strain was observed. WNV was detected in 22 wild

birds, in 17 horses (3 direct and 14 indirect diagnoses) and 14 human cases were also

diagnosed in the enzootic season (between August and October). The cases were

detected in the central and western regions of Hungary too, and the strain emerged in

Austria. In 2009, 15 wild bird, 4 horse (1 lethal) and 4 human WNV cases were

diagnosed in Hungary. Since 2004, in all diagnosed Hungarian WNV cases, the

lineage 2 strain was demonstrated in the samples. It indicates that the virus established

a successful infection cycle, became resident in the country, and was able to cause

neurological diseases.

PATHOGENICITY MARKERS OF WNV

It has been suggested that the most important amplifying hosts of WNV are birds, in

particular Passeriformes (song birds), Charadriiformes (shorebirds), Strigifromes

10

(owls) and Falconiformes (hawks) (Hayes et al, 2005a). After amplification of the

virus, the incidence of human populations being infected by this zoonosis can lead to

severe consequences. The work by Hayes (2005b) indicated the neuroinvasive

damage lasting up to 12 months post illness in only 37% with 9% fatalities and the

rest having permanent neuromotor deficits with little improvement. Hence the

importance of understanding the way WNV becomes or elicits this neuroinvasive

character has focussed research to this field.

It was suggested that the difference between the lineages 1 and 2 showed differences

in virulence. Earlier work involved comparisons of different strains from the two

different lineages to be able to establish differences that could be explained by

genotype basis. Experimental infection of mice compared the neuroinvasive

phenotype by inoculating directly into the nervous system and outside the brain

barrier to establish the capability of neuroinvasiveness, and then comparing results

between a representative set of data from both lineages (Beasley et al., 2002). A

similar set of experiments aimed to investigate the variance of virulence of a smaller

set of WNV in the American Crow (Brault et al., 2004), and house sparrows

(Langevin et al., 2005), hoping to illustrate some correlation between the genotype

and phenotype. A recent paper by Botha et al. (2008) however has attempted to make

a full comparison of different WNV strains and cloned strains with focus on the

genome and the lineage background. The paper indicates that difference occur within

the lineages resulting in different virulence within lineage 2 strains. From this

conclusion many loci were identified as possible sites of consequence to virulence and

neuroinvasive phenotype of these strains, as well as indicate certain positions on the

genome that could relate to neuroinvasive phenotype of the virulent strains.

The results of the studies of Chambers et al. (1998) indicated that the envelope protein

contains the important regions which translated into the virus ability to be

neuroinvasive as well as indicate a possible primary locus that, if mutated, attenuated

the virus. A secondary locus was also indicated by Chambers et al., (1998) but has not

been further investigated. This led to work by other groups to investigate this

proposal, leading to support of this theory by Shirato et al. (2004) and Beasley et al.

(2005) indicating the importance of the primary locus on the envelope protein coding

region at amino acid positions 154-156. Investigations into other regions showed

11

importance of the NS2A coding region (Liu et al., 2006) and the NS3 helicase coding

region (Brault et al., 2007). These regions have been summarised in Table 1.

Table 1.: Identified genetic markers influencing the neuroinvasiveness and virulence

of lineage 1. WNV strains.

Source virus strain Test species Location on genome Effect on phenotype Reference

New York strains:

NY99-6922 from

mosquitoes and BC787

from a horse

Mouse

(suckling) and

cell culture

154 - 156 of the E-

protein (nt 1432-1433)Altered glycosylation

Beasley et

al., 2002

New York strain

(NY99), Old world

Lineage 1

An4766(ETH76a)

Mouse

Full genome

comparison (154 of E-

protein)

Altered glycosylationBeasley et

al., 2005

WNI , WNI-568, WNI-

567, WNI-25, WNI-

25A, WNI-25R

MouseE-68, E-154 to E-157,

E-307Altered glycosylation

Shitaro et al.,

2005

WNV Kunjin strain

(Australia)Mouse NS2A (A30P mutation)

Reduced ability to

inhibit alpha/beta

interferon induction

Liu et al.,

2004 and

2006

NY99 and KN3829 American crowamino acid residue 249

on the NS3 helicase

Thermosensitivity,

virulence to birds

Brault et al.,

2007

The virus strain which emerged in Hungary has shown to cause multiple pathologic

lesions in the CNS with fatalities in wild birds and in mammals (Erdélyi et al., 2007;

Kecskeméti et al., 2007), therefore it exhibits neuroinvasive and neurovirulent

phenotype. The aim of the present study was to compare the nucleotide sequences of

Hungarian, lineage 2 WNV strains (goshawk, 2004 and horse 2007) with a

neuroinvasive lineage 1 virus (New York 1999), at those loci, which were identified

as possible genetic markers for neuro-invasiveness in hosts with neurological

pathology. The complete genome sequence of the goshawk 2004 strain was

12

determined in previous studies. Within this work, partial nucleotide sequences of the

horse 2007 strain were determined and compared to the previously-mentioned viruses.

13

II. MATERIALS AND METHODS

SAMPLE

The examined virus was detected in the CNS of a horse, which died after showing

symptoms of encephalitis. The five-year-old Frisian warmblood mare was admitted to

the Large Animal Clinic of the Faculty of Veterinary Science, Szent István

University, in Üllő on the 3rd of September in 2007. The horse was admitted to the

clinic because of showing non-typical colic symptoms for 24 hours. The mare showed

general depression, muscle rigidity and tremors, stiff movement mainly on the rear

limbs, was periodically shifting weight from the rear to the hind limbs, and was

sweating. The horse had decreased anal reflex and tail tone, and was generally

hyporeflexic with some areas of hyperreflexion behind the last rib. The neurological

condition of the horse deteriorated rapidly. Within hours it became more ataxic both

on the rear and hind quarters and showed propioceptive deficits on all four limbs.

Within 24 hours it had abnormal mentation, teeth-grinding, became completely

recumbent and was unable to stand even with the help of slings. Finally, in terminal

phase, it had seizures, and was euthanized due to animal welfare reasons.

The horse was submitted to necropsy at the Pathology of the Large Animal Clinic,

and tissue samples were collected for histopathological and microbiological

investigations. Native samples were stored at -20°C.

Approximately 2 g of brain and spinal chord tissue samples were pooled and

homogenized with the help of sterile quartz sand in a ceramic mortar, and the

homogenate was suspended in 2 ml RNase-free distilled water.

14

RNA EXTRACTION, RT-PCR, SEQUENCING AND GENETIC COMPARISONS

Viral RNA samples were obtained by extraction from the supernatant of the brain

homogenate, after centrifugation at 4,500 ×g for 10 min. RNA was extracted from

140 l of the supernatant with the QIAamp viral RNA Mini kit (Qiagen, Hilden,

Germany) according to manufacturer’s instructions.

In diagnostic submission, viral RNA was amplified by using universal JEV-group

specific oligonucleotide primer pair, designed on the NS5 and 3’-UTR regions of

WNV (Weissenböck et al, 2002), in a continuous RT-PCR system, using the

QIAGEN OneStep RT-PCR kit (Qiagen, Hilden, Germany). Every 25 l reaction

mixture contained: 5 l of 5 × buffer (MgCl2 2.5mM), 0.4 mM of each

deoxynucleoside triphosphate (dNTP), 10 U RNasin RNase Inhibitor (Promega,

USA), 0.8 µM genomic and reverse primers, 1 l of enzyme mix (containing

Omniscript and Sensiscript reverse transcriptases and HotStarTaq DNA

polymerase) and 2.5 l of template RNA. The reverse transcription was carried out

for 30 minutes at 50oC, followed by a denaturing step at 95oC for 15 minutes. The

cDNA was amplified in 40 cycles (heat denaturation at 94oC for 40s, primer annealing

at 57oC for 50s, and DNA extension at 72oC for 1 min), and the reaction was

completed by final extension for 7 min at 72oC. These reactions were performed in a

GeneAmp PCR System 2700 thermocycler (Applied Biosystems, USA).

For the genetic characterization of the virus, further selected genomic regions were

amplified, using WNV lineage 2 specific oligonucleotide primerpairs (Bakonyi et al.,

2006). Primers are shown in Table 2.

15

Table 2.: Oligonucleotide primers used for the amplification and sequencing of

selected genomic regions of the WNV strain Horse-Hungary-2007.

*Numbers refer to nucleic acid positions at the 5’-end, according to the complete

genomic sequence of the closely related WNV strain B956 (NC_001563). f: forward

(genomic) primer, r: reverse (complementary) primer.

Name* Sequence 5' to 3' Product length (bp)

WNVII 870f CCTCGTTGCAGCTGTCATTG761

WNVII 1630r TCCATGGCAGGTTCAGATCC

WNVII 1584f CTTCCTGGTTCACCGAGAAT908

WNVII 2491r CTTGCCTGCCAATGTCAATG

WNVII 3027f CAACATGGCTGTGCATAGTG673

WNVII 3699r GCCGACGAGAATGACATATC

WNVII 3861f GGCTTACTATGACGCCAAGA594

WNVII 4454r CCATCATCATCCAGCCTAAC

WNVII 5294f TTGCTGCTGAGATGTCTGAG324

WNVII 5617r TGTCCGAGATAGGAGCATTG

Electrophoresis followed amplifications using 10 l of the PCR products in 1.5% Tris

acetate-EDTA-agarose gels at 5V/cm for 80 min. Stained with ethidium bromide the

bands were visualized under UV light and photographed with a Kodak DS

Electrophoresis Documentation and Analysis system using the Kodak Digital Science

1D software program. A reference ladder (100-bp DNA ladder by Promega, USA)

was used to determine the product sizes.

Where clear PCR products of the previously calculated sizes were observed, the

fragments were excised from the gel, and DNA was extracted using the QIAquick Gel

Extraction Kit (Qiagen, Germany). Fluorescence- based direct sequencing was

performed in both directions on the PCR products. Sequencing of the PCR products

was carried out using the ABI Prism 310 Genetic Analyzer automated sequencing

system (Applied Biosystems). The nucleotide sequence identification was done using

the BLAST search against gene bank databases

(http://www.ncbi.nlm.nih.gov/BLAST/). Nucleotide sequences were aligned with

other WNV sequences deposited in the GenBank database; putative amino acid

sequences were translated, and processed using the Align Plus 4 (Scientific and

16

Educational software) and ClustalX (Thompson et al., 1997) softwares. The

nucleotide sequences of the New York-horse-1999 strain (AF260967) and the

Hungary-goshawk-2004 strain (DQ116961) was downloaded from the GenBank

database (http://www.ncbi.nlm.nih.gov).

17

III. RESULTS AND DISCUSSION

In this study, partial nucleotide sequences of the lineage 2 WNV strain Horse -

Hungary - 2007 were determined at the E protein coding region between nucleotide

positions 870-2491, at the NS2A and NS3 protein coding regions between nucleotide

positions 3027-3699 and 3861-4454, and at the NS3 protein coding region between

nucleotide positions 5294-5617. The putative amino acid sequences were deduced

from the nucleotide sequences. These sequences were aligned and compared with the

corresponding regions of the lineage 1 WNV strain Horse - New York - 1999 and the

lineage 2 strain Goshawk - Hungary - 2004. The lineage 1 and lineage 2 strains

showed 78% nucleotide and 88% amino acid identity values at the investigated

regions. Amino acid substitutions between the three strains are shown in Table 3. The

nucleotide mutations in the background of these amino acid changes are summarized

in Table 4.

Particular attention was devoted to the loci, which might play a role in the

neuroinvasive and neurovirulet character of the virus. The data collected has shown

the envelope protein differed between the lineage 1 and 2 strains by 5 % (25 amino

acids of 514), while the nucleotide sequences showed 79% similarities (1287 of 1622

nucleotides). The glycosilation motif at position 154-156 (N-Y-S/T) as indicated by

Chambers et al (1998), Shitaro et al (2005) and Beasley et al (2005) as a determinant

for the neuroinvasivenes of NY99 is intact in the Hungarian, lineage 2 strains.

Chambers et al (1998) mentioned the possibility of another position that could result

in attenuation at the position 68, however all strains carry leucine and so is concurrent

with the original hypothesis. This finding supports the idea that the glycosilation

motif confers the phenotypic neuroinvasiveness, with the other mutations present not

hindering the neuroinvasive phenotype.

18

Table 3.: Alignments of partial, putative amino acid sequences of the envelope, NS2A and NS3 strains of WNV strains Horse-New York-1999 (Horse NY99), Goshawk-Hungary-2004 (Goshawk Hu04) and Horse-Hungary-2007 (Horse Hu07). Amino acid positions refer to the sequence of the putative precursor polypeptide of the virus. Only the differences are indicated. Amino acid positions, where the Hungarian sequences differ from each other are highlighted underlined in the Horse Hu07 sequence. Putative virulence markers are indicated in bold.

Envelope Protein

Amino acid position 34

5

354

361

373

378

383

412

416

418

419

421

449

462

489

495

498

500

522

543

602

659

703

732

773

Horse NY99 E T K D P R S I R T L V A N T T T V I L A K V LGoshawk

Hu04D S R E S K T T W I G I S S S A S T V A S R I M

Horse Hu07 D S R E P K T T W I G I S S S A S T V A S R I M

NS2A Protein

Amino acid position 11

44

1177

1181

1182

1211

1233

1247

1255

1262

1265

1266

1267

1269

1272

1280

1290

1293

1310

1326

1331

1336

1344

1346

1355

1366

Horse NY99 Y M L I S M R V H R Q I L I A T T R I R A S L L IGoshawk

Hu04H I M L A L S A Y K N V S V S S N K V K S C I V M

Horse Hu07 Y I M L A L S A Y K N V S V S S N K V K S C I V M

NS3 Protein

Amino acid position 15

16

1597

1635

1677

1680

1708

1720

1738

1754

1758

1788

1807

1836

1841

1852

1861

1889

1941

1944

1955

2011

2014

2042

2061

2067

2102

2115

Horse NY99 K Q F D I R R A P N V S S L S T V T E V I F L V R I AGoshawk

Hu04R H Y E A K K S H S I A A M T V I E D I V L F I K A S

Horse Hu07 R H Y E A K K S H S I A A M T V I E D I V L F I K A S

Table 4.: Alignments of partial nucleotide sequences of the envelope, NS2A and NS3 strains of WNV strains Horse-New York-1999 (Horse NY99), Goshawk-Hungary-2004 (Goshawk Hu04) and Horse-Hungary-2007 (Horse Hu07). Nucleotide positions refer to the

complete genome sequence of the virus. Only the differences resulting amino acid changes (shown in Table 3) are indicated. Nucleotide positions, where the Hungarian sequences differ from each other are highlighted in bold underlined in the Horse Hu07 sequence.

Envelope Region

Nucleotide position 10

35

1060

1062

1082

1119

1132

1134

1148

1149

1234

1236

1247

1248

1252

1254

1256

1261

1262

1344

1346

1383

1465

1466

1483

1485

1492

1494

1498

1500

1564

1565

1627

1629

1804

1805

1975

1977

2108

2194

2196

2317

2319

Horse-NY99 G A C A C C A G A T T T A A A C T T G T G A T A T A A A G G T A A C G G T A G C C CGoshawk-

Hu04T T G G G T C A G A A C T T G T C A A A T G C T A G G T C A C G G G A T G G A A A G

Horse-Hu07 T T G G G C C A G A A C T T G T C A A A T G C T A G G T C A C G G G A T G G A A A G

NS2A Region

Nucleotide Position 34

30

3432

3531

3541

3544

3631

3633

3697

3740

3741

3764

3784

3786

3793

3794

3795

3796

3798

3799

3805

3806

3807

3814

3816

3838

3840

3869

3870

3878

3879

3929

3976

3978

3992

3993

4006

4008

4030

4032

4036

4038

4063

4065

4098

Horse-NY99 T T G C A T T A A C T C C C G C C A A C T C A C G G C A C G G A A G G G A A T C A C T TGoshawk-

Hu04C C T A C G A C G T C T T A A G A T G T C A G G T C G C A C A G T A A T T T C A C G G G

Horse-Hu07 T C T A C G A C G T C T T A A G A T G T C A G G T C G C A C A G T A A T T T C A T G G G

NS3 Region

Nucleotide Position 45

46

4790

4904

4905

5031

5038

5039

5040

5123

5136

5212

5261

5273

5362

5364

5419

5421

5506

5508

5521

5523

5554

5581

5582

5583

5685

5821

5822

5823

5832

5863

5865

6031

6033

6040

6042

6124

6126

6181

6183

6200

6304

6305

6306

6343

6345

Horse-NY99 A G T C T A T C G G G C A G G T C T A T A T A C C G A C A A G G A C T C C G G G G A T T G GGoshawk-

Hu04G T A T A G C A A A T A G A A G A G T A G A G T T A G A G T A C G G C A T C A A A G A G T C

Horse-Hu07 G T A T A G C A A A T A G A A G A G T A G A G T T A G A G T A C G G C A T C A A A G A G T C

20

20

The NS2A protein differed between the lineage 1 and 2 strains by 10.8% (25 of 231 amino acids),

while the nucleotide sequences showed 78% similarities (540 of 693 nucleotides). At position 30

of the NS2A the Hungarian, lineage 2 strains contains the same alanine, as in the NY99 strain.

This supports the investigation by Liu et al. (2006), with the other mutations having no obvious

consequence on the neuroinvasiveness.

The NS3 protein having a difference of 4.4% between the lineage 1 and 2 strains (27 of 619

amino acids) while the nucleotide sequences showed 81% similarities (1504 of 1857 nucleotides).

The data shows a mutation resulting in a substitution of the proline to histidine in the Hungarian

strain at position 249 (aa 1754 of the putative precursor polypeptide), and the substitution of

threonine to valine at position 356 (aa 1861 of the putative precursor polypeptide), this does not

support the findings by Beasley et al (2005) or Brault (2007) regarding the role of NS3 in the

virulence.

Within the investigated region the Hungarian goshawk and horse strains’ amino acid sequences

differed in two amino acids (E protein, aa position 378 S and P; NS2 protein, aa position 1144 H

and Y); in these loci the two horse strains were identical.

The results of this study support the possible role of the E protein gylcosylation sites and the

NS2A region mutations in the background of the neuroinvasiveness of WNV. The NS3 specific

loci (249, 356) were identified as genetic markers connected to thermosensitivity and virulence of

the American lineage 1 strain in American crow (Brault et al, 2007). The effects of the mutations

were tested by reverse genetic methods (site-specific mutagenesis) and animal experiments in the

bird host. The authors compared neuroinvasive and non-neuroinvasive lineage 1 WNV strains in

their experiments, and found that neuroinvasive lineage 1 strains have proline at the aa site 249,

while non-neuroinvasive strains exhibit threonine. The authors compared the sequence of the

prototype lineage 2 strain (Uganda, human 1937), which is a non-neurovirulent strain. This virus

contains histidine, therefore the authors concluded that histidine in this locus also result in non-

neuroinvasive character. Our investigations indicate, that in the case of lineage 2 viruses the

NS3 249 locus is presumably not influencing the neuroinvasiveness, because both neuroinvasive

and non-neuroinvasive strains have the same amino acid in this position. Recent comparisons

with further, neuroinvasive and non-neuroinvasive lineage 2 strains (Botha et al., 2008),

supported our findings (data not shown). The role of the NS3 249 locus was investigated in bird

model. The lineage 2 strain, which emerged in Hungary, caused encephalitis both in birds and in

mammals, and at the aa 249 locus they did not differ from each other. Further studies are

necessary to clarify the exact role of the aa 249 site in the virulence of WNV. On one hand, the

neuroinvasive character of mutant strains of the lineage 1 with histidine at the 249 position

should be investigated in animal models. On the other hand, site-specific mutagenesis studies

involving full-length clones of lineage 2 strains could clarify further possible genetic markers for

the virulence of WNV. The study of Botha et al. (2008) suggest several potential regions

(including NS5), however, specific loci were not identified yet.

Recent serological studies revealed that the since 2008 the lineage 2 WNV strain causes

widespread infections in the Hungarian horse populations (10 to 70% seropositivity in different

studs), although most of the infections did not manifest in CNS symptoms. Specific antibodies

were also find is several wild bird species, without apparent mortality. These observations

indicate that besides the neuroinvasive and neurovirulent character of the virus, so-far

unidentified individual or species-specific factors of hosts also contribute the clinical outcome of

the disease. Immune suppression due to other infectious diseases or parasitic infection could

result in a state of vulnerability allowing neuroinvasion. Further studies on the pathogenesis of

the virus would be necessary to assess the risk of different WNV strains to the health of humans,

domestic and wild animals in WNV endemic regions.

22

22

V. REFERENCES

Anderson JF, Andreadis TG, Vossbrink CR, Tirrell S, Wakem EM, French RA, Garmendia AE,

van Kruiningen HJ. Isolation of West Nile virus from mosquitoes, crows, and a Cooper’s

hawk in Connecticut. Science. 1999; 286:2331-3.

Austgen LE, Bowen RA, Bunning ML, Davis BS, Mitchell CJ, Chang GJ. Experimental infection

of cats and dogs with West Nile virus. Emerg. Infect. Dis. 2004; 10:82-6.

Bakonyi T, Hubalek Z, Rudolf I, Nowotny N. Novel flavivirus or new lineage of West Nile virus,

central Europe. Emerg. Infect. Dis. 2005; 11:225-31.

Bakonyi T, Ivanics E, Erdelyi K, Ursu K, Ferenczi E, Weissenbock H, Nowotny N. Lineage 1

and 2 strains of encephalitic West Nile virus, central Europe. Emerg Infect Dis 2006; 12:618-

23.

Banet-Noach C, Simanov L, Malkinson M. Direct (non-vector) transmission of West Nile virus

in geese. Avian Pathol. 2003; 32:489-94.

Beasley DW, Li L, Suderman MT, Barrett AD. Mouse neuroinvasive phenotype of West Nile

virus strains varies depending upon virus genotype. Virology. 2002; 296:17-23.

Beasley DWC, Whiteman MC, Zhang S, Huang CYH, Scheider BS, Smith DR, Gromowski GD,

Higgs S, Kinney RM, Barret ADT. Journal of Virology, 2005; 79:8339-47

Berthet FX, Zeller HG, Drouet MT, Rauzier J, Digoutte JP, Deubel V. Extensive nucleotide

changes and deletions within the envelope glycoprotein gene of Euro-African West Nile

viruses. J. Gen. Virol. 1997; 78:2293-7.

Blitvich BJ, Fernandez-Salas I, Contreras-Cordero JF, Marlenee NL, Gonzalez-Rojas JI, Komar

N, Gubler DJ, Calisher CH, Beaty BJ. Serologic evidence of West Nile virus infection in

horses, Coahuila State, Mexico. Emerg. Infect. Dis. 2003; 9:853-6.

Bondre VP, Jadi RS, Mishra AC, Yergolkar PN, Arankalle VA. West Nile virus isolates from

India: evidence for a distinct genetic lineage. J Gen Virol. 2007 Mar;88(Pt 3):875-84.

Botha EM, Markotter W, Wolfaardt M, Paweska JT, Swanepoel R, Palascios G, Nel LH, Venter

M. Genetic Determinants of Virulence in Pathogenic Lineage 2 West Nile Virus Strains.

Emerging Infectious Diseases 2008 Vol. 14, No. 2, 222-30.

23

23

Brault AC, Huang CYH, Langevin SA, Kinney RM, Bowen RA, Ramey WN, Panella NA,

Holmes EC, Powers AM, Miller BR. A single positively selected West Nile viral mutation

confers increased virogenesis in American crows. http://www.nature.com/naturegenetics

2007

Brault AC, Langevin SA, Bowen RA, Panella NA, Biggerstaff BJ, Miller BR, Komar N.

Differential Virulence of West Nile Strains for American Crows. Emerging Infectious

Diseases 2004 Vol.10, No.12

Calisher CH, Karabatos N, Dalrymple JM, Shope RE, Porterfield JS, Westerway EG, Brandt WE.

Antigenic relationships between flaviviruses as determined by cross-neutralisation tests

with polyclonal antisera. J. Gen. Virol. 1989; 70:37-43.

Castillo-Olivares J, Wood J. West Nile virus infection of horses. Vet. Res. 2004; 35:467-83.

Ceccaldi PE, Lucas M, Despres P. New insights on the neuropathology of West Nile virus. FEMS

Microbiol. Lett. 2004; 233:1-6.

Centers for Disease Control and Prevention (CDC). West Nile virus activity--United States, 2005.

MMWR Morb Mortal Wkly Rep. 2005; 54:678-9.

Chambers TJ, Havely M, Nestorowicz A, Rice CM, Lustig S. West Nile virus envelope proteins:

nuleotide sequence analysis of strains differing in mouse neuroinvasivness. Journal of

General Virology, 1998; 79:2375-80

Charrel RN, Brault AC, Gallian P, Lemasson JJ, Murgue B, Murri S, Pastorino B, Zeller H, de

Chesse R, de Micco P, de Lamballerie X. Evolutionary relationship between Old World

West Nile virus strains. Evidence for viral gene flow between Africa, the Middle East, and

Europe. Virology. 2003; 315:381-8.

Erdélyi K, Ursu K, Ferenczi E, Szeredi L, Rátz F, Skáre J, Bakonyi T. Clinical and pathologic

features of lineage 2 West Nile virus infections in birds of prey in Hungary. Vector Borne

Zoonotic Dis 2007; 7:181-188.

Ferenczi E, Rácz G, Faludi G, Czeglédi A, Mezey I, Berencsi Gy. Natural foci of viral zoonoses

in Hungary. NATO Science Series. 2005.

24

24

Garmendia AE, van Kruiningen HJ, French RA, Anderson JF, Andreadis TG, Kumar A, West

AB. Recovery and identification of West Nile virus from a hawk in winter. J Clin

Microbiol. 2000; 38:3110-1.

Giladi M, Metzkor-Cotter E, Martin DA, Siegman-Igra Y, Korczyn AD, Rosso R, Berger SA,

Campbell GL, Lanciotti RS. West Nile encephalitis in Israel, 1999: the New York

connection. Emerg. Infect. Dis. 2001; 7:654-8.

Glávits R, Ferenczi E, Ivanics É, Bakonyi T, Mató T, Zarka P, Palya V. Occurrence of West Nile

Fever in a circovirus infected goose flock in Hungary. Avian Pathol. 2005; 43:408-14.

Hayes CG. West Nile fever. In: Monath TP (ed) The arboviruses: epidemiology and ecology, vol.

V. 1989; CRC Press, Boca Raton, FL, pp 59–88.

Hayes EB, Komar N, Nasci RS, Montgomery SP, O’leary DR, Campbell GL. Epidemiology and

Transmission Dynamics of West Nile Virus Disease. Emerging Infectious Diseases 2005a

Vol. 11, No. 8, 1167-73

Hayes EB, Sejvar JJ, Zaki SR, Lanciotti RS, Bode AV, Campbell GL. Virology, Pathology, and

Clinical Manifestations of West Nile Virus Disease. Emerging Infectious Diseases 2005b

Vol. 11, No. 8, 1174-79

Heinz FX, Collett MS, Purcell RH, Gould EA, Howard CR, Houghton M, Moormann RJ, Rice

CM, Thiel HJ. Family Flaviviridae In: van Regenmortel MHV, Faquet, CM, Bishop, DHL

editors. Virus Taxonomy, Seventh International Committee for the Taxonomy of Viruses.

San Diego: Academic Press; 2000. p. 859–78.

Hubálek Z, Halouzka J. West Nile fever--a reemerging mosquito-borne viral disease in Europe.

Emerg. Infect. Dis. 1999; 5:643-50.

Hubálek Z. European experience with the West Nile virus ecology and epidemiology: could it be

relevant for the New World? Viral. Immunol. 2000; 13:415-26.

Koller M, Gresikova M, Berencsi Gy, Schablik M. Hemagglutination inhibition antibodies to

arboviruses in the population of Hajdú-Bihar district, Hungary. Folia Parasitologica. 1969;

16:75-9.

Komar N. West Nile virus: epidemiology and ecology in North America. Adv Virus Res.

2003;61:185-234.

25

25

Komar N, Langevin S, Hinten S, Nemeth N, Edwards E, Hettler D, Davis B, Bowen R, Bunning

M. Experimental infection of North American birds with the New York 1999 strain of West

Nile virus. Emerg. Infect. Dis. 2003; 9:311-22.

Kramer LD, Bernard KA. West Nile virus infection in birds and mammals. Ann. N. Y. Acad. Sci.

2001; 951:84-93.

Kuno G, Chang GJ, Tsuchiya KR, Karabatsos N, Cropp CB. Phylogeny of the genus Flavivirus.

J. Virol. 1998; 72:73-83.

Lanciotti RS, Ebel GD, Deubel V, Kerst AJ, Murri S, Meyer R, Bowen M, McKinney N, Morrill

WE, Crabtree MB, Kramer LD, Roehrig JT. Complete genome sequences and phylogenetic

analysis of West Nile virus strains isolated from the United States, Europe, and the Middle

East. Virology. 2002; 298:96-105.

Langevin SA, Brault AC, Panella NA, Bowen RA, Komar N. Variation in Virulence of West Nile

virus strains for house sparrows (Passer domesticus) Am. J. Trop. Med Hyg., 2005, 72(1),

99-102

Liu WJ, Wang XJ, Clark DC, Lobigs M, Lobigs M, Hall RA, Khromykh AA. A Single Amino

Acid Sunstitution in the West Nile Virus Nonstructural Protein NS2A Disables its ability to

Onhibit Alpha/Beta Interferon Induction and Attenuates Virus Virulence in Mice. American

Society of Microbiology. 2006, Vol. 80, No. 5, 2396- 2404.

Melnick JL, Paul JR, Riordan JT, Barnett VH, Goldblum N, Zabin E. Isolation from human sera

in Egypt of a virus apparently identical to West Nile virus. Proc. Soc. Exp. Biol. Med. 1951;

77:661-665.

Molnár E. Occurence of tick-borne encephalitis and other arboviruses in Hungary. Geographia

Medica. 1982; 12:78-120.

Porter MB, Long MT, Getman LM, Giguere S, MacKay RJ, Lester GD, Alleman AR, Wamsley

HL, Franklin RP, Jacks S, Buergelt CD, Detrisac CJ. West Nile virus encephalomyelitis in

horses: 46 cases (2001). J. Am. Vet. Med. Assoc. 2003; 222:1241-7.

Rice CM, Lenches EM, Eddy SR, Shin SJ, Sheets RL, Strauss JH. Nucleotide sequence of yellow

fever virus: Implications for flavivirus gene expression and evolution. Science. 1985;

229:726–33.

26

26

Rice CM, Strauss EG, Strauss JH. Structure of the flavivirus genome. In: Schlesinger, S.,

Schlesinger, M.J. (Eds.), The Togaviridae and Flaviviridae. 1986; Plenum Press, New York,

pp. 279–326.

Sampson BA, Ambrosi C, Charlot A, Reiber K, Veress JF, Armbrustmacher V. The pathology of

human West Nile Virus infection. Hum. Pathol. 2000; 31:527-31.

Shirato K, Miyoshi H, Goto M, Ako Y, Ueki T, Kariwa H, Takashima I. Viral evelope protein

glycosylation is a molecular determinant of the neuroinvasiveness of the New York strain

of West Nile virus. Journal of General Virology 2004; 85:3637-45

Smithburn KC, Hughes TP, Burke AW, Paul JH. A neurotropic virus isolated from the blood of a

native of Uganda. Am. J. Trop. Med. Hyg. 1940; 20:471

Smithburn KC. Differentiation of West Nile virus from the viruses of Saint Louis encephalitis

and Japanese B encephalitis. J. Immunol. 1942; 42:25-31.

Taylor RM, Work TH, Hurlbut HS, Rizk F. A study of the ecology of West Nile virus in Egypt.

Am. J. Trop. Med. Hyg. 1956; 5:579-620.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows

interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Res. 1997; 25:4876-82.

Wang T, Town T, Alexopoulou L, Anderson JF, Fikrig E, Flavell RA. Toll-like receptor 3

mediates West Nile virus entr into the brain causing lethal encephalitis. Nat Med.

2004;10:1366-73

Watson JT, Pertel PE, Jones RC, Siston AM, Paul WS, Austin CC, Gerber SI. Clinical

characteristics and functional outcomes of West Nile Fever. Ann. Intern. Med. 2004;

141:360-5.

Weissenböck H, Kolodziejek J, Url A, Lussy H, Rebel-Bauder B, Nowotny N. Emergence of

Usutu virus, an African mosquito-borne flavivirus of the Japanese encephalitis virus group,

central Europe. Emerg. Infect. Dis. 2002; 8:652-6.

Zeller HG, Schuffenecker I. West Nile virus: an overview of its spread in Europe and the

Mediterranean basin in contrast to its spread in the Americas. Eur. J. Clin. Microbiol. Infect.

Dis. 2004; 23:147-56.

27

27

VI. SUMMARY

West Nile virus (WNV) is a mosquito borne flavivirus, which is widespread over the World.

WNV infections may cause febrile illnesses (West Nile fever), and in several cases neurological

diseases, with symptoms neck stiffness, ataxia, tremor, muscle weakness, convulsions and

paralysis develops. Encephalitic WNV infections are frequently lethal. The natural hosts of WNV

are wild birds, and the infection is mainly transmitted by culicide mosquito vectors. Mammals are

incidental, dead-end hosts; horses and humans show most frequently symptoms, however

neurological disease was also reported in several other species. Two main genetic lineages of

WNV exist. Lineage 1 is widespread, while lineage 2 was previously present only in Africa. In

2004 a lineage 2 WNV strain emerged in Hungary, caused encephalitis in a Goshawk (Accipiter

gentilis). The strain became resident in Hungary and caused encephalitis in birds and in mammals

(sheep, horse, human) in the subsequent years.

Genetic studies on lineage 1 WNV strains identified genetic markers, which may influence the

virulence and the neuroinvasive / neurovirulent phenotype of WNV. The aim of this study was to

determine the partial nucleotide sequence of a Hungarian WNV strain, which was isolated from

an encephalitic horse case in 2007, and to compare the differences of the putative amino acid

sequences of thee strains (lineage 1: Horse - New York -1999; and lineage 2: goshawk - Hungary

- 2004 and horse - Hungary - 2007) at the suspected virulence marker loci.

The study revealed that at the suspected virulence markers of the E protein region (glycosylations

sites) and at the NS2A region the neuroinvasive lineage 1 and 2 strains contain identical amino

acids. At the NS3 region, however, the amino acids differ at the suggested virulence-associated

loci; therefore in lineage 2 viruses these markers are not influencing the neuroinvasiveness.

28

28

VII. ÖSSZEFOGLALÁS

A Nyugat-nílusi vírus (West Nile virus, WNV) egy szúnyogok által terjesztett flavivírus, amely

világszerte előfordul. WNV fertőzés hatására lázas betegség alakulhat ki (Nyugat-nílusi láz), és

bizonyos esetekben idegrendszeri tünetek (tarkómerevség, ataxia, remegés, izomgyengeség,

görcsök, kóma) is megjelennek. A WNV okozta agyvelőgyulladásos esetek jelentős része halálos

kimenetelű. A vírus természetes gazdái vadmadarak, a terjesztésében főként Culex nemzetségbe

tartozó szúnyogok vesznek részt. Az emlősök alkalmi gazdák, nem terjesztői a vírusnak.

Leggyakrabban lovak és emberek mutatnak tüneteket, de számos más fajban is leírtak már WNV

okozta agyvelőgyulladást. A vírusnak két fő genetikai vonala van. Az 1-es vonalhoz világszerte

előforduló vírusok tartoznak, 2-es genetikai vonalhoz tartozó vírust viszont korábban csak

Afrikában találtak. Egy 2-es vonalhoz tartozó törzs bukkant fel 2004-ben Magyarországon és

okozott agyvelőgyulladást héjában (Accipiter gentilis). Következő években a vírus megtelepedett

az országban és agyvelőgyulladásos eseteket okozott madarakban és emlősökben (juhban, lóban,

emberben).

A vírus neuroinvazív tulajdonságát 1-es vonalba tartozó törzseknél vizsgálták és genetikai

markereket írtak le. Jelen vizsgálatok célja az volt, hogy a 2007-es hazai ló agyvelőgyulladásos

esetből kimutatott és a 2004-ben héjában felbukkant vírustörzsek származtatott nukleotid és

aminosav szekvenciáit összehasonlítsuk az 1999-ben New Yorkban lóból izolált víruséval a

feltételezett virulencia-markerek területén. A vizsgálatok eredményei alátámasztják az E fehérje

glikolizációs helyeinek és az NS2A fehérje egyes lókuszainak feltételezett szerepét, viszont az

NS3 régióban tapasztaltak eltérnek a különböző genetikai vonalú WNV törzsek esetén.

29

29