nadila haryani bt osman_3130198_a comparison between using

A COMPARISON BETWEEN USING PERIPHERAL WHOLE

BLOOD AND BUCCAL SWAB FOR RED CELL GENOTYPING

AMONGST MULTIPLY-TRANSFUSED THALASSAEMIA

PATIENTS

Nadila Haryani Binti Osman

UNIVERSITI SAINS ISLAM MALAYSIA

A COMPARISON BETWEEN USING PERIPHERAL WHOLE

BLOOD AND BUCCAL SWAB FOR RED CELL GENOTYPING

AMONGST MULTIPLY-TRANSFUSED THALASSAEMIA

PATIENTS


(Matric No. 3130198)

Thesis submitted in fulfilment for the degree of

MASTER OF SCIENCE

Faculty of Medicine and Health Sciences

UNIVERSITI SAINS ISLAM MALAYSIA

Nilai

May 2016

AUTHOR DECLARATION

I hereby declare that the work in this thesis is my own except for quotations and

summaries which have been duly acknowledged.

Date: 17th

May 2016 Signature:

Name: Nadila Haryani Bt Osman

Matric No: 3130198

Address: No. 40, Jalan Mawar 3,

Taman Air Mawang,

73100 Johol,

Negeri Sembilan Darul Khusus.

ii

BIODATA OF AUTHOR

Nadila Haryani Bt Osman (3130198) was born on the 17th

May 1987. She previously

was a student of Management and Science University (MSU) and obtained the

Diploma in Medical Laboratory Technology and the Bachelor in Biomedical Science

(Hons) from the Faculty of Health and Life Sciences. After earning her first degree,

she worked as a Temporary Research Assistant at the Institute of Public Health, Kuala

Lumpur and then as a Temporary Research Officer at the Department of

Haematology, Ampang Hospital in Selangor. She is at present a master student of

Universiti Sains Islam Malaysia (USIM) under the Faculty of Medicine & Health

Sciences.

iii

ACKNOWLEDGEMENTS

Alhamdulillah, all praise to Allah S.W.T who is the most Gracious, most

Compassionate for giving me the strength, wisdom and perseverance to endure all

problems encountered during my Masters journey. This thesis may have never seen

the light without the help of many generous people.

My sincerest appreciation must go to my supervisor, Dr. Asral Wirda Binti Ahmad

Asnawi, who bravely took the risk of supervising me as her first master student who

has always given her problems from the first day of being under her supervision until

the end of my Masters journey. Many thanks for her brilliance, guidance, advice,

patience and constant care; which I am grateful to have received from her and it will

be a priceless experience that I will never forget. We faced many obstacles at the

beginning and today, we managed to solve it all, together. Surely I will miss all of the

moments.

Special thanks to my respected co-supervisors, Prof. Datuk Dr. Ainoon Binti Othman

and Assoc. Prof. Dr. Noor Fadzilah Binti Zulkifli for their guidance, help and

constructive comments during the conduct of my study. It was a great and valuable

experience having you that are knowledgeable and have a lot of experience in the

research field.

My thanks is also extended to the co-researchers, Assoc. Prof Dr. Leong Choi Fun &

Assoc. Prof Dr. Raja Zahratul Azma Binti Raja Sabudin from the Pathology

Department, Faculty of Medicine, UKMMC and Dr. Jameela Binti Sathar from the

Haematology Department, Hospital Ampang for giving me permission to conduct this

study that involved their patients and using the facilities at the designated venue of

study. Thank you also to all staffs at the Blood Bank and Thalassaemia Clinic of

Hospital Ampang and also staffs at the Molecular Unit, UKMMC in helping me to

collect the samples and guiding me in doing the lab works. I am also thankful to all

the study participants and volunteers that were involved in this study. Without their

willingness, this study would be meaningless.

To the Ministry of Higher Education (MOHE) Malaysia, thank you for the scholarship

and project funding. Without these two financial sources, I would have never been

able to finish my Masters course on time. To FPSK USIM‟s staff, especially to the lab

staffs and other lecturers who have always helped and motivated me during my time

of need, thank you very much.

My utmost thanks is also dedicated to all my fellow colleagues especially to my best

“partners-in-crime” in the research lab, Atikah, Zahidah and Syahida and my one and

only senior, Asmalita for the bond of friendship, the wholesome working environment

and assistance throughout my toughest days in USIM. Thank you all for being great

companions and friends in need.

iv

Finally yet importantly, I would like to convey my deepest thanks to my family for

their love, support and never-ending prayers.

Now it‟s time for me to move on and think about my future. Being amongst the

pioneer batch of postgraduate study of the faculty is quite challenging and the

experience while studying here taught me the meaning of life. I really hope that this

thesis is not just being evaluated as a thesis only but actually as something valuable

that can give benefit in the future. Last but not least, to those who have made

contributions directly or indirectly and cannot all be named, thank you very much.

May Allah S.W.T bless your life. I love you all.

Sincerely,


17th

May 2016.

v

ABSTRAK

Darah sentiasa menjadi sampel utama dalam penentuan pelbagai jenis kumpulan

darah. Walau bagaimanapun, pada pesakit yang berulang kali menjalani transfusi,

penentuan sel darah merah yang tepat daripada kaedah serologi menjadi masalah yang

berterusan disebabkan oleh pendedahan kepada darah penderma di dalam badan

pesakit yang membuatkan keputusan tidak boleh dipercayai. Untuk mengatasi masalah

ini, sumber dan teknik lain diperlukan dalam penentuan jenis darah. Tujuan utama

kajian ini adalah untuk mengkaji genotip sel darah untuk RH (C, c, E, e), KEL (Kell,

Celano), Kidd (JKA, JKB) dan Duffy (FYA, FYB) dengan menggunakan calitan sel

pipi dan darah periferi di kalangan pesakit talasemia yang berulang kali transfusi.

Enam puluh tiga pesakit talasemia yang berulang kali transfusi dari Klinik Talasemia

Hospital Ampang dan Pusat Perubatan Universiti Kebangsaan Malaysia telah

mengambil bahagian di dalam kajian ini. Sampel berpasangan yang terdiri daripada

darah periferi dan calitan sel pipi telah dikumpulkan sebelum pemindahan darah yang

telah dijadualkan dan pada hari ke 7 selepas pemindahan darah. Sampel darah

tertakluk kepada serologi fenotip dengan kaedah tiub dan DNA genotip manakala

calitan sel pipi adalah tertakluk kepada DNA genotip sahaja. Genotip darah dilakukan

dengan menggunakan kaedah cerakinan TaqMan® polimorfisme nucleotida tunggal

tindak balas berantai polimerase masa sebenar (SNP RT-PCR) untuk sistem kumpulan

darah RhEe, RHCc, KEL, Kidd dan Duffy. Data yang lengkap hanya diperolehi

daripada 33 pesakit sahaja. Perbezaan keputusan didapati di antara keputusan fenotip

dan genotip untuk semua kumpulan darah yang diuji di dalam kedua-dua jenis sampel

sebelum dan selepas transfusi. Walau bagaimanapun, keputusan genotip di antara

sampel sebelum dan selepas transfusi didapati sepadan. Apabila membandingkan

keputusan genotip daripada kaedah persampelan yang berbeza, didapati keputusan

daripada sampel darah dan sampel calitan pipi adalah sepadan. Penentuan profil

antigen sel darah yang tepat adalah penting untuk pesakit yang memerlukan transfusi

yang kerap. Platform SNP RT-PCR adalah alternatif kepada kaedah konvensional

yang boleh dipercayai. Sampel calitan sel pipi menawarkan alternatif kepada kaedah

pengumpulan yang mudah dan murah yang boleh digunakan untuk menentukan

kumpulan darah yang tepat apabila sampel darah tidak menyediakannya.

vi

ABSTRACT

Blood has always been the main sample in determining the different blood group

types. However, in multiply-transfused patients, accurate red cell antigen typing by

serology is a constant problem due to the exposure to donor‟s blood in patient‟s

circulation making results unreliable. To overcome these problems, another source

and technique for blood typing is needed. The main aim of this study was to

investigate the genotype of red cells for RH (C, c, E, e), KEL (Kell, Celano), Kidd

(JKA, JKB) and Duffy (FYA, FYB) using buccal swab and peripheral whole blood

amongst multiply-transfused thalassaemia patients. Sixty-three of multiply-transfused

thalassaemia patients from the Thalassaemia Clinic of Ampang Hospital and

Universiti Kebangsaan Malaysia Medical Centre participated in this study. Paired

samples consisting of peripheral whole blood and buccal swab samples were collected

prior to the scheduled blood transfusion and on day 7 after the transfusion. Blood

samples were subjected to serological phenotyping by tube method and DNA

genotyping while buccal swab was subjected to DNA genotyping only. Blood

genotyping was performed using TaqMan® Single Nucleotide Polymorphism Real

Time Polymerase Chain Reaction (SNP RT-PCR) assays for RHEe, RHCc, Kidd,

KEL and Duffy blood group systems. Complete data was available in 33 patients only.

Discrepancies were found between the phenotype and genotype results for all blood

groups tested in both pre- and post-transfusion samples. However, a full concordance

of genotyping result between pre- and post-transfusion samples was observed. When

comparing the genotyping results between different sampling methods, blood and

buccal swab samples showed concordant results. Accurate red blood cell antigen

profiling is important for patients requiring multiple transfusions. The SNP RT-PCR

platform is a reliable alternative to the conventional method. Buccal samples offer a

simple and inexpensive alternative collection method that may be used for accurate

blood group genotyping when blood samples are unavailable.

vii

ثملخص البح

ؼتبش اذ اؼ اشئست استخذت فى تحذذ فصائ اذ اختفت، غ ره فتحذذ

اجس اعاد خالا اذ احشاء ػ غشك االصاي فى اشظى از ؼا

ره بسبب اتؼشض ذ اشخص اتبشع م اذ اتىشس شىت دائت ،

حممت، تغب ػى ز اشىت البذ اتائج غشفى اذسة اذت ا جؼ

اذف اشئس اذساست تمت جذذة تحذذ فصائ اذ. صذس آخش

اتؼشف ػى اشوب اساث ؼا اشصس خالا اذ احشاء باستخذا اسحت

ػت . م اتىشس ذاشذلت ػاث اذ شظى اثالسا از ؼا ا

( حا شظى اثالسا از ؼا م اذ 36اذساست ثالثت ست )

اتىشس )ت تجغ احاالث اؼاداث اتخصصت ف ستشفى االباك اشوض

ػت ,اطب جاؼت ااض اغت( حث ت تجغ ػت و شط

لب ػت م اذ تىشاس ره بؼذ ػت ام ,اسحت اشذلت اذ ػت

ت تح اػ اظاشي ؼاث اذ باطشمت االببت وا ت اتح بسبؼت اا.

اساث حط اي. باسبت ؼاث ات ت أخزا ػ غشك اسحت اشذلت

وا ت اجشاء اتح اساث ؼاث اذ ت اتح اساث حط اي فمػ ،

SNP RT-PCR) (TaqManباستخذا ®

) (RHEeRHCc)) فحص

( Kidd) ( KEL)جػت اذ Duffy) ( ةت تجغ ابااث ؼذد الث ث

ون الث باءا ػى اتائج وا ان تفاث ب تائج اتح حات فمػ. (66) وث

اساث تح اػ اظاشي جغ فصائ اذ ات ت تحا لب بؼذ ام.

ى وا ان تافك ف تائج اتح اساث ؼاث لب بؼذ ام. ػذ ماست

ا اذ ػاث اسح اشذلت تائج اتح اساث ب اؼاث ات ت جؼ

وا ان تافك ف اتائج. اتحذذ اذلك عاداث خالا اذ احشاء ظشسي

( ؼتبش بذ (SNP RT-PCR. شظى از حتاج م اذ بصفت تىشسة

اسحت اشذلت تؼتبش غشمت ست سخصت ى ,ثق طشق اتمذت

تحذذ اساث اذلك فصائ اذ ػذا ال تتفش ػاث د.استخذاا

viii

CONTENT PAGE

Contents Page

AUTHOR DECLARATION i

BIODATA OF AUTHOR ii

ACKNOWLEDGEMENTS iii

ABSTRAK v

ABSTRACT vi

MULAKHKHAS AL-BAHTH vii

CONTENT PAGE viii

LIST OF TABLES xiv

LIST OF FIGURES xvi

LIST OF APPENDICES xvii

ABBREVIATION xviii

CHAPTER I: INTRODUCTION 20

1.1 BACKGROUND OF THE STUDY 20

1.2 OBJECTIVES OF THE STUDY 24

1.2.1 General objective 24

1.2.2 Specific objectives 24

1.3 RESEARCH HYPOTHESES 25

CHAPTER II: LITERATURE REVIEW 26

2.1 BLOOD GROUPS 26

2.1.1 Rhesus blood group 28

2.1.1.1 Antigens and antibodies 29

2.1.1.2 Genetics and biochemistry 33

2.1.2 KEL blood group 35



2.1.3 Kidd blood group 39



2.1.4 Duffy blood group 42


ix


2.2 THALASSAEMIA: DEFINITIONS AND BACKGROUND 47

2.3 RBC IMMUNIZATION IN THALASSAEMIA 49

2.4 DETERMINATION OF BLOOD GROUP ANTIGENS 51

2.4.1 The haemagglutination technique 51

2.4.2 Red blood cell genotyping by molecular analysis 54

2.4.2.1 Assays based on conventional PCR (low-throughput) 55

2.4.2.2 Medium to high-throughput PCR 57

2.4.2.2.1 Single Nucleotide Polymorphisms Real-

Time Polymerase Chain Reaction (SNP RT-

PCR) 57

2.5 BUCCAL CELLS AS AN ALTERNATIVE SAMPLE SOURCE FOR

GENETIC STUDIES 61

CHAPTER III: RESEARCH METHODOLOGY 65

3.1 STUDY DESIGN 65

3.2 POPULATIONS STUDY 66

3.2.1 Study subjects 66

3.2.1.1 Subjects selection 66

3.2.1.2 Inclusion criteria 66

3.2.1.3 Exclusion criteria 67

3.2.1.4 Sample size calculation 67

3.2.2 Control group 68

3.2.2.1 Control selection 68

3.2.2.2 Inclusion criteria 68

3.2.2.3 Exclusion criteria 68

3.2.2.4 Sample size calculation 69

3.3 ETHICAL CONSIDERATION AND FUNDING 69

3.4 SAMPLING METHODS 69

3.4.1 Preparation before sampling 69

3.4.1.1 Blood sample collection 69

3.4.1.2 Buccal swab sample collection 70

3.4.2 Sampling on study subjects 70

3.4.2.1 Day 0 sampling: before transfusion 70

3.4.2.2 Day 7 sampling: 1 week post-transfusion 70

3.4.3 Sampling on control group 71

3.5 LABORATORY METHODS 72

3.5.1 Serological test using peripheral whole blood 72

3.5.1.1 Procedure for wash packed red cells 73

3.5.1.2 Procedure for preparation of 4% red cell suspension 73

3.5.1.3 Procedure for forward blood group test (tube method) 74

x

3.5.1.4 Procedure for reverse blood group test (tube method) 74

3.5.1.5 Procedure for antibody screening (tube method) 74

3.5.1.6 Procedure of red cell phenotype by Direct Antiglobulin

Test method for Rhesus, Kidd and Kell phenotype 75

3.5.1.7 Procedure of red cell phenotype by Indirect

Antiglobulin Test method for Cellano and Duffy

phenotype 75

3.5.1.8 Procedure for Direct Coombs test 76

3.5.1.8.1 Polyspecific AHG 76

3.5.1.8.2 Monospecific Anti-IgG 76

3.5.1.8.3 Monospecific Anti-C3d 76

3.5.1.9 Test reaction 77

3.5.2 Molecular technique 77

3.5.2.1 DNA extraction 77

3.5.2.1.1 Peripheral whole blood sample 77

3.5.2.1.2 Buccal swab sample 79

3.5.2.1.2.1 Preparation of Phosphate

Buffered Saline (PBS) 10X 79

3.5.2.1.2.2 Preparation of Phosphate

Buffered Saline (PBS) 1X 80

3.5.2.1.2.3 Procedure of DNA extraction

from buccal swab samples 80

3.5.2.2 DNA quantification 82

3.5.2.3 Conventional Polymerase Chain Reaction (PCR)

methodology 82

3.5.2.3.1 Buffers and solutions 82

3.5.2.3.1.1 Tank buffer and gel buffer 82

3.5.2.3.2 2% Agarose gel preparation 82

3.5.2.3.3 BAGene DNA-SSP Kits – Conventional

PCR 83

3.5.2.3.4 PCR cycling program 84

3.5.2.3.5 Gel electrophoresis 85

3.5.2.3.6 Documentation and interpretation of result 85

3.5.2.4 Single Nucleotide Polymorphisms Real Time –

Polymerase Chain Reaction (SNP RT-PCR)

methodology 86

3.5.2.4.1 Selection of suitable assay for SNP RT-PCR

methodology 86

3.5.2.4.2 TaqMan® SNP genotyping assay 88

xi

3.5.2.4.2.1 Custom TaqMan® SNP

genotyping assay – RHCE and

KEL blood group antigens 91

3.5.2.4.2.2 Pre-Designed TaqMan® SNP

genotyping assay – Kidd and

Duffy blood group antigens 93

3.5.2.4.3 TaqMan® GTXpress

™ master mix 94

3.5.2.4.4 PCR reaction mix components 95

3.5.2.4.5 PCR cycling program 95

3.5.2.4.6 Interpretation of results 96

3.5.2.4.7 Sequencing 97

3.6 DATA COLLECTION 98

3.7 DATA ANALYSIS 98

CHAPTER IV: FINDINGS 100

4.1 RESULTS FOR STUDY SUBJECTS 100

4.1.1 Demographic data 100

4.1.2 Frequency of ABO, RHD blood group, antibody screening and

Direct Coombs Test. 101

4.1.3 Frequency of transfusion and types of red blood cell product

transfused 103

4.1.4 Red cell phenotype using peripheral blood: pre- and post-

transfusion samples 105

4.1.5 Blood group genotype by SNP RT-PCR using peripheral blood:

pre- and post-transfusion samples 107

4.1.6 Blood group genotype by SNP RT-PCR using peripheral blood

and buccal swab: pre-transfusion sampling 109

4.1.7 Phenotype-genotype frequencies detected on pre-transfusion

peripheral blood samples 111

4.1.8 Phenotype-genotype frequencies detected on post-transfusion


4.1.9 Correlation of blood group genotype results between peripheral

blood and buccal swab samples: pre-transfusion sampling 114

4.1.10 Correlation between phenotype and genotype results 115

4.1.10.1 Phenotype-genotype discrepancies of pre-transfusion

sampling 115

4.1.10.2 Phenotype-genotype discrepancies of post-transfusion

sampling 117

4.1.11 Prevalence of donor leukocyte contamination in post-transfusion


xii

4.1.12 Comparison of DNA yields and purity between buccal swab and


4.2 RESULTS FOR CONTROL GROUP 121

4.2.1 Demographic data 121

4.2.2 PCR results 122

4.2.2.1 Conventional results 122

4.2.2.2 SNP RT-PCR results 127

4.2.2.2.1 Results for RH C/c blood group system by

using different assay names and IDs 128

4.2.2.2.2 Sequencing results 130

4.2.3 Phenotype-genotype frequencies using peripheral blood samples

133

4.2.4 Blood group genotype frequencies between peripheral blood and

buccal swab samples by conventional PCR and SNP RT-PCR 134

4.2.5 Comparison of DNA yields and quality between buccal swab and


CHAPTER V: ANALYSIS AND DISCUSSIONS 137

5.1 INTRODUCTION 137

5.2 DEMOGRAPHIC DATA 139

5.3 THE IMPORTANCE OF DOING PATIENTS‟ EXTENDED RED CELL

BLOOD GROUP GENOTYPE 142

5.3.1 Primer designation for determination of RHCcEe and KEL blood

group antigens 143

5.3.2 Primer designation for determination of Kidd and Duffy blood

group antigens 144

5.4 CORRELATION BETWEEN PHENOTYPE AND GENOTYPE

RESULTS IN PRE- AND POST-TRANSFUSION SAMPLES 145

5.5 THE USEFULNESS OF SNP MOLECULAR GENOTYPING IN

RESOLUTION OF PHENOTYPE DISCREPANCIES ISSUES 150

5.6 BUCCAL SWAB AS AN ALTERNATIVE SOURCE IN BLOOD

GENOTYPING 153

CHAPTER VI: CONCLUSIONS AND RECOMMENDATIONS 156

6.1 LIMITATIONS 157

6.1.1 Samplings 157

6.1.2 Methodology 157

BIBLIOGRAPHY 159

APPENDIX A: ETHICAL APPROVAL LETTER FROM MEDICAL

RESEARCH ETHICAL COMMITTEE (MREC) 170

xiii

APPENDIX B: ETHICAL APPROVAL LETTER FROM UNIVERSITI

KEBANGSAAN MALAYSIA MEDICAL CENTRE (UKMMC) 171

APPENDIX C: PATIENT INFORMATION SHEET AND CONSENT FORM

172

APPENDIX D: BAGene DNA-SSP KITS WORKSHEET AND EVALUATION

DIAGRAM 175

APPENDIX E: LIST OF PRESENTATIONS 177

APPENDIX F: AWARDS & ACHIEVEMENTS 179

Best Paper Award 179

Young Scientist Award Competition 180

Young Investigator‟s Award 181

APPENDIX G: PROCEEDINGS / PUBLICATIONS 182

Malaysian J Pathol 2015; 37(2): pp. 198 182

Malaysian J Pathol 2014; 36: Supplement A: pp. 63. ISSN 0126-8635 183

Malaysian J Pathol 2014; 36: Supplement A: pp. 102-103. ISSN 0126-8635 184

Journal of Contemporary Issues and Thought, Vol 6, 2016. 186

xiv

LIST OF TABLES

Page

Table 2.1: Blood group systems acknowledged by the International Society of

Blood Transfusion 27

Table 2.2: Frequency of Rh antigens 29

Table 2.3: Possible haplotype arrangements of Rh genes by Fisher-Race

Terminology 30

Table 2.4: Wiener‟s Rh Terminology 31

Table 2.5: Rh types by Three Nomenclatures 32

Table 2.6: Five major Rh antigens in four nomenclatures 33

Table 2.7: KEL blood group system phenotypes and prevalence 37

Table 2.8: Phenotypes and frequencies in the Kidd system 40

Table 2.9: Frequencies of Duffy phenotypes 44

Table 2.10: Frequencies of antibodies amongst repeatedly-transfused thalassaemia

patients of Hospital Ampang, Malaysia 47

Table 2.11: Correlation between fluorescence signals and sequences 59

Table 3.1: Composition of the master mix depending on the number of reaction

mixes 84

Table 3.2: PCR Cycling Program using BAGene DNA-SSP Kits 85

Table 3.3: Specifics of selected genotyping assays 89

Table 3.4: Assay for RHCc blood group antigens (1) 92

Table 3.5: Assay for RHCc blood group antigens (2) 92

Table 3.6: Assay for RHEe blood group antigens 93

Table 3.7: Assay for KEL blood group antigens 93

Table 3.8: Assay for Kidd blood group antigens 94

Table 3.9: Assay for Duffy blood group antigens 94

Table 3.10: PCR reaction mix components 95

Table 3.11: PCR Cycling Program for Applied Biosystems® 7500 Fast Real Time

PCR Systems 96

Table 3.12: Data domains that were collected in this study 98

Table 4.1: Types of thalassaemia according to race 101

Table 4.2: Phenotypic frequencies of blood group in ABO and Rhesus system

according to gender 102

Table 4.3: Antibody screening and DCT results 103

Table 4.4: Frequency of transfusion 104

Table 4.5: Blood group phenotype frequencies on pre- and post-transfusion using


xv

Table 4.6: Blood group genotype frequencies on pre- and post-transfusion of

peripheral blood samples by using SNP RT-PCR method 108

Table 4.7: Blood group genotype frequencies which were determined on

peripheral blood and buccal swab pre-transfusion samples (D0) by

using SNP RT-PCR 110

Table 4.8: Phenotype-genotype frequencies for pre-transfusion peripheral blood

samples 112

Table 4.9: Phenotype-genotype frequencies for post-transfusion peripheral blood

samples 114

Table 4.10: Genotype result between pre-transfusion peripheral blood and buccal

swab samples 115

Table 4.11: Discrepancies of red cell blood group detected between serology and

SNP RT-PCR method for pre-transfusion peripheral blood samples 117


SNP RT-PCR method for post-transfusion peripheral blood samples 119

Table 4.13: Blood genotype result of pre- and post-transfusion peripheral blood

samples 120

Table 4.14: Comparison of DNA yields and purity according to different types of

samples 121

Table 4.15: List of Allele 1 and Allele 2 for RH E/e, Kidd, Duffy and KEL blood

group system 128

Table 4.16: List of Allele 1 and Allele 2 for RH C/c blood group system 130

Table 4.17: List of the blood group results based on the SNP sequences 132

Table 4.18: Phenotype-genotype frequencies using peripheral blood samples 133

Table 4.19: Genotype frequencies between peripheral blood and buccal swab

samples 135

Table 4.20: Comparison of DNA yields and quality between buccal swab and


xvi

LIST OF FIGURES

Page

Figure 2.1: The Rh genes, showing the 10 exons of RHD and RHCE in opposite

orientation on the chromosome, SMP1 in between and Rh boxes

flanking RHD. 34

Figure 2.2: The D and CcEe polypeptides span the membrane 12 times and have

internal N- and C-termini and 6 extracellular loops. The amino acid

substitutions for C/c polymorphism in the second loop and E/e

polymorphism in fourth loop. 35

Figure 2.3: Kell and Kx proteins 38

Figure 2.4: Domain structure of Kidd transporter. 42

Figure 2.5: Domain structure of Duffy protein. 45

Figure 2.6: The complementary TaqMan® probe fluoresces after anneals to the

template and after cleavage by AmpliTaq Gold DNA Polymerase, Ultra

Pure (UP). 60

Figure 3.1: Workflow of the study subjects 71

Figure 3.2: Workflow of the control group 72

Figure 3.3: Information searching from the NCBI website for selection of the

suitable assay 87

Figure 3.4: Workflow of searching the assay type 90

Figure 3.5: Interpretation of the SNP result 97

Figure 4.1: Distribution of the study subjects according to gender and race 101

Figure 4.2: Phenotypic frequencies of blood group in ABO and Rhesus system 102

Figure 4.3: Frequency of transfusion based on types of thalassaemia 104

Figure 4.4: Types of red blood cell product received during transfusion 105

Figure 4.5: Distribution of the control groups according to gender and race 122

Figure 4.6: Conventional result by BAGene DNA SSP-Kits 123

Figure 4.7: SNP RT-PCR allelic plot results 128

Figure 4.8: SNP RT-PCR allelic plot results for RH C/c (rs45493401) 129

Figure 4.9: SNP RT-PCR allelic plot results for RH C/c (rs676785) 129

Figure 4.10: Construct map for the cloning process 130

Figure 4.11: Detailed sequence of the whole construct 131

xvii

LIST OF APPENDICES

Page

A Ethical Approval Letter From Medical Research Ethical

Committee (MREC)

170

B Ethical Approval Letter From Universiti Kebangsaan

Malaysia Medical Centre (UKMMC)

171

C Patient Information Sheet and Consent Form 172

D BAGene DNA-SSP Kits Worksheet and Evaluation Diagram 175

E List of Presentations 177

F Awards & Achievements 179

G Proceedings/Publications 182

xviii

ABBREVIATION

% percent

≥ More than

µl microliter

L Litre

ml millilitre

ng nanogram

nm nanometre oC degree celcius

Tm melting temperature

V volt

V/cm volt per centimetre

α Alpha

β Beta

AABB American Association of Blood Banks

AET 2-aminoethylisothiouronium

AHG Anti Human Globulin

AIHA Autoimmune Haemolytic Anaemia

AS-PCR Allele Specific Polymerase Chain Reaction

BCPPC Buffy-Coat Poor Packed Cells

bp base pair

CCC Coombs Control Cell

DARC Duffy Antigen Receptor for the chemokines

DAT Direct Antiglobulin Test

DCT Direct Coombs Test

DTT Dithiothreitol

DHTR Delayed Haemolytic Transfusion Reaction

DNA Deoxynucleic Acid

ERGS Exploratory Research Grant Scheme

FBC Full Blood Count

FRBC Filtered Red Blood Cells

G6PD Glucose-6-Phosphate Dehydrogenase

gDNA genomic DNA

GVHD Graft-versus-host disease

HDFN Haemolytic Disease of Fetus and Newborn

HLA Human Leukocyte Antigen

HTR Haemolytic Transfusion Reaction

IgG Immunoglobulin G

IgM Immunoglobulin M

IS Intermediate Spin

ISBT International Society of Blood Transfusion

K2EDTA di-potassium ethylenediaminetetraacetic acid

kbp kilobasepair

KCl Potassium Chloride

KH2PO4 Monopotassium Phosphate

xix

LISS Low Ionic Strength Solution

LR Leukocyte Reduced

MALDI-TOF MS Matrix-assisted laser desorption/ionization time-of-flight mass

spectrometry

MC microchimerism

MGB Minor Groove Binder

MNPs Multinucleotide polymorphisms

MOHE Ministry of Higher Education

MREC Medical Research Ethical Committee

Na2HPO4.7H2O Sodium Monohydrogen Phosphate Heptahydrate

NaCl Natrium Chloride

NFQ Non-Fluorescent Quencher

NHFTR Nonhemolytic febrile transfusion reactions

PBS Phosphate Buffered Solution

PC Packed Cell

PCR Polymerase Chain Reaction

PCR-SSP Polymerase Chain Reaction – Sequence Specific Priming

PPUKM Pusat Perubatan Universiti Kebangsaan Malaysia

RBC Red Blood Cell

RFLP Restriction Fragment Length Polymorphism

Rh Rhesus

RM Ringgit Malaysia

rpm revolution per minute

SNP Single Nucleotide Polymorphism

SNP-RT PCR Single Nucleotide Polymorphism- Real Time Polymerase Chain

Reaction

SPSS Statistical Package for the Social Science

TA-MC Transfusion-associated microchimerism

U/µl Unit per microliter

UKMMC Universiti Kebangsaan Malaysia Medical Centre

UP Ultra-Pure

USIM Universiti Sains Islam Malaysia

UV Ultraviolet

WBC White Blood Cell

xg relative centrifugal force

20

CHAPTER I

INTRODUCTION

1.1 BACKGROUND OF THE STUDY

Thalassaemia is a common haemoglobin disorder in Malaysia and is considered a

major public health problem. This disease is caused by the reduction or absent

production of haemoglobin chain and patients suffers from the effects of chronic

anaemia. Life-long red blood cell (RBC) transfusions are the recommended treatment

for thalassaemia. However, repeated exposure to donor RBC provokes the patient‟s

immune system to produce antibodies towards the donor‟s red cell surface antigens

that it does not recognize placing the patients at risk of alloimmunization, a part from

other complications (Sadeghian et al., 2009). Alloimunization is a response by the

body‟s immune system to infusion of donated blood, bone marrow or a transplanted

organ from another individual, where the recipient‟s body will develop antibody, the

proteins that attack and destroy foreign substances that target the donated material.

Alloimmunization to red cell antigens is one of clinical importance in the practice of

transfusion. Because of the large number of polymorphic antigens and the large

number of epitopes on each antigen, every red cell transfusion will introduce many

foreign alloantigens resulting in antibody formation. These antibodies may cause

destruction of red cells. This form of haemolysis is immune-mediated whereby the

transfused donor red cells are attacked by the antibodies formed by the recipient from

21

the previous transfusion (Vamvakas & Blajchman, 2009) and further complicates

management of thalassaemia patients as it limits the availability as well as the safety

of subsequent RBC transfusions (George, 2013). For repeatedly-transfused patients,

supplying blood that matches beyond ABO and RhD type is a necessity (Vamvakas &

Blajchman, 2009). The current practice in hospitals in Malaysia is to supply blood

according to the blood group phenotype A, B, O, AB and according to the presence or

absence of the RHD phenotype. More than 98% of the Malaysian population are RHD

positive. Nevertheless, most hospital blood banks are not capable of providing an

extended phenotype-match of the KEL, Kidd and Duffy blood group antigens on a

routine basis, especially to patients that require repeated red cell transfusions to

survive (Malaysia, 2009).

To date, The International Society of Blood Transfusion (ISBT) has acknowledged 35

blood group systems with more than 300 blood group antigens described on the

surface of the human red cell that are encoded by various alleles (Anstee, 2009;

Transfusion, 2015). More blood group antigens are added from time to time. Some of

these antigens stimulate antibodies of clinical significance by causing haemolytic

transfusion reactions, fetal and neonatal anaemia and in some instances autoimmune

haemolytic anaemia. Blood group antigens that are usually implicated are ABO, RH,

KEL, Duffy and Kidd (Klein & Anstee, 2006; Higgins & Sloan, 2008; Transfusion,

2015). In certain populations, specific antibodies are more often seen due to the

different antigen frequencies observed within the populations. Supplying the accurate

phenotyping of blood group antigen is necessary to prevent alloimmunization from

occurring in susceptible patients.

22

Red cell antigen profile can be determined by serological and molecular methods. For

many years, the agglutination method has been the gold standard for red blood cell

antigen detection. The method relies on the use of monoclonal antibodies designed to

detect specific epitopes of the red cell antigen on its surface. A positive test will result

in agglutination or haemolysis. However, haemagglutination has many limitations.

This is seen in patients that have been recently or multiply-transfused with donor red

cells where the results may not be reliable (Reid et al., 2000; Rožman et al., 2000;

Castilho et al., 2002a; Castilho et al., 2002b; Ribeiro et al., 2009; Guelsin et al., 2010).

Accurate phenotyping of red cells amongst these patients are problematic due to the

presence of transfused donor red cells in the circulation of the recipient (Reid &

Yazdanbakhsh, 1998) unless phenotyping is performed prior to the initiation of

transfusion. Serological determination of red cell genotype is also unreliable in

individuals with a positive Direct Coombs Test (DCT) (Monteiro et al., 2011) due to

in-vivo sensitization. These can be the sign that the conventional serological method

by haemagglutination in determining the presence of blood group phenotype and

hence assuming its genotype is no longer reliable in multiply-transfused individuals.

Thus, RBC genotyping by DNA analysis is the only approach (Anstee, 2009).

Currently, the molecular basis of almost all the major blood group antigens has been

determined. The blood group genotype reflects antigen expression on the red cell,

which is the phenotype. The molecular identification and characterization of blood

group genes has made it possible to predict blood group phenotypes of clinically

important blood group antigens from tests on genomic DNA with a high degree of

accuracy (Westhoff, 2006; Moulds, 2010). Methods for Polymerase Chain Reaction

(PCR) use purified genomic DNA isolated from leukocytes extracted from whole

23

blood samples. However, in patients who are frequently transfused, the presence of

donor leukocytes during sampling cannot be eliminated. The determination of the

gene or allele that is relevant and prevalent in a particular population is also a

challenge. Little is documented on the extended blood group genotypes in transfusion-

dependent patients in Malaysia.

Not much is known regarding the presence or clearance of donor leukocytes in a

recipient after a blood transfusion. A study on the clearance of donor leukocytes in

orthopaedic surgery patients after a blood transfusion found that the concentration of

donor leukocytes in recipient blood increases transiently post-transfusion (Lee et al.,

1995). However, this is in contrast with one study which showed that DNA from the

post-transfusion sample can be used for blood group genotyping without the risk of

detecting microchimerism (Reid et al., 2000). Other study also showed that patients‟

white blood cell (WBC) samples can be used to determine a blood group

polymorphism by Polymerase Chain Reaction (PCR)-based assays even though the

post-transfusion blood samples are used as the source of DNA (Rios et al., 1999; Reid

et al., 2000).

To avoid this potential problem, alternative source of samples to collect the DNA is

needed to determine the blood group genotype. Buccal swab to collect epithelial cells

offers a simple and inexpensive alternative collection method ideal for whole-genome

amplification (Hosono et al., 2003). A study by Rios et al., (1999) compared the

genotyping results from buccal swab and urine sediments in donors with the results of

phenotyping using standard serological techniques by demonstrating

24

haemagglutination performed on red cells. The study concluded that the results were

concordant (Rios et al., 1999).

Development of alternative sampling or testing methods to determine blood group is

not just of academic interest. There are situations in which genotyping is a superior, or

the only approach (Mercier et al., 1990). Although serology may be sufficient for

some blood group typing, genotyping assays offer a good alternative for problems

encountered by serology.

1.2 OBJECTIVES OF THE STUDY

1.2.1 General objective

To determine the phenotype and genotype of red cells for RH (C, c, E, e), KEL (Kell,

Cellano), Kidd (JKA, JKB) and Duffy (FYA, FYB) using buccal swab and peripheral

whole blood in normal healthy donors and multiply-transfused thalassaemia patients.

1.2.2 Specific objectives

1. To establish the Single Nucleotide Polymorphism (SNP) analysis

by TaqMan®

Real-Time PCR method for red blood cell genotype

RH, KEL, Duffy and Kidd.

2. To compare the red cell blood group serological phenotype and

genotyping in normal healthy donors and multiply-transfused

thalassaemia patients.

25

3. To compare the genotype profile of red cells between buccal swab

and peripheral whole blood analysis in multiply-transfused

thalassaemia patients.

1.3 RESEARCH HYPOTHESES

1. There is a discrepancy in the blood group in multiply-transfused

thalassaemia patients between serology and genotype by PCR

method.

2. There is a discrepancy in red cell genotyping of RH (C, c, E, e),

KEL (Kell, Cellano), Kidd (JKA, JKB) and Duffy (FYA, FYB)

between buccal swab and peripheral whole blood analysis in

multiply-transfused thalassaemia patients.

3. SNP analysis by PCR is a useful tool for red cell genotyping.

26

CHAPTER II

LITERATURE REVIEW

2.1 BLOOD GROUPS

Currently, The International Society of Blood Transfusion (ISBT) has acknowledged

35 blood group systems comprising over 300 antigens (Transfusion, 2015) (Table

2.1). ABO was the first blood group system discovered by Karl Landsteiner in 1900

(Landsteiner, 1900) and this marked as the beginning of blood banking and

transfusion medicine.

27

Table 2.1: Blood group systems acknowledged by the International Society of

Blood Transfusion

No. Name (Symbol) Gene name(s) No. of antigens

001 ABO ABO 4

002 MNS GYPA, GYPB 48

003 P1PK A4GALT 3

004 Rh (RH) RHD, RHCE 54

005 Lutheran (LU) LU 21

006 Kell (KEL) KEL 35

007 Lewis (LE) LE (FUT3) 6

008 Duffy (FY) FY (DARC) 5

009 Kidd (JK) JK (SLC14A1, HUT1

1A),

3

010 Diego (DI) DI (SLC4A1, AE1,

EPB3)

22

011 Yt (YT) YT (ACHE) 2

012 Xg (XG) XG (PBDX) 2

013 Scianna (SC) SC (ERMAP) 7

014 Dombrock (DO) DO (ART4) 8

015 Colton (CO) CO (AQP1) 4

016 Landsteiner-Wiener (LW) LW (ICAM4, CD242) 3

017 Chido-Rodgers (CH/RG) CH (C4B), RG (C4A) 9

018 H (H) H (FUT1) 1

019 Kx (XK) XK 1

020 Gerbich (GE) GE (GYPC) 11

021 Cromer (CROM) CROM (DAF) 18

022 Knops (KN) KN (CR1) 9

023 Indian (IN) IN (CD44) 4

024 Ok (OK) OK (BSG, EMPRIN) 3

025 Raph (RAPH) RAPH (CD151) 1

026 John Milton Hagen (JMH) JMH (SEMA7A, CD108,

SEMA-L)

6

027 I (I) I (GCNT2, IGnT) 1

028 Globoside (GLOB) GLOB (B3GALNT1) 2

029 Gill (GIL) GIL (AQP3) 1

030 Rh-associated glycoprotein

(RHAG)

RHAG 4

031 FORS (FORS) FORS (GBGT1,

A3GALNT)

1

032 JR (JR) JR (ABCG2) 1

033 Lan (LAN) LAN (ABCB6) 1

034 Vel (VEL) VEL (SMIM1) 1

035 CD59 CD59 1 Source: ISBT website, 2015

28

In blood transfusion practice, ABO and RH are considered the most important blood

group systems. The other blood group systems were thought to be minor/extended

antigen on the red cell surface. However, nowadays the KEL, Kidd and Duffy are also

considered as some of the most important blood group systems. This is because the

blood group antigens from these blood group systems can produce antibodies which

can cause intravascular and extravascular destruction of transfused red cells, induce

haemolytic disease of fetus and newborn (HDFN) and autoimmune haemolytic

anaemia (AIHA).

2.1.1 Rhesus blood group

Rhesus (Rh) blood group is one of the most complicated and the second most

important human blood group systems after ABO (Dean, 2005) with 54 well-known

antigens (Transfusion, 2015) however, only five of these antigens are considered

important. The Rh antigens are encoded by two genes, RHD and RHCE that are

closely linked and are produced by differences in their protein sequences (Flegel,

2007). Although the Rh system is highly polymorphic and immunogenic, the most

significant polymorphism is due to the presence or absence of the Rh D antigen on the

red cells where the terms “Rh positive” and “Rh negative” are referred. Individuals

who do not produce the D antigen will produce anti-D if they encounter the D antigen

on transfused RBCs which can cause a haemolytic transfusion reaction (HTR) or in

pregnant women, can cause HDFN. Incompatibility of the RHCE antigens can also

cause haemolytic reactions. Currently, the Rh status is routinely determined by

serology in blood donors, blood recipients and in pregnant women after ABO (Carritt

et al., 1997; Dean, 2005).

29

2.1.1.1 Antigens and antibodies

Rh antigens can be detected as early as 8 weeks of gestation and is fully expressed at

birth (Gemke et al., 1986). They are only present on red cells and cannot be detected

on platelets, lymphocytes, monocytes, neutrophils or other tissues (Dunstan et al.,

1984; Dunstan, 1986). As mentioned earlier, five antigens that are considered

important include; C, c, D, E and e (Dean, 2005) (Table 2.2). However, routine blood

grouping protocol involves only Rh D antigen testing and the person is reported or

grouped as Rh positive or negative. Almost 99% of Asian population and about 85%

of Caucasians and 92% of Blacks are D positive (Reid & C, 2004).

Table 2.2: Frequency of Rh antigens

Antigen Caucasians Blacks Asians

D 85% 92% 99%

C 68% 27% 93%

E 29% 22% 39%

c 80% 96% 47%

e 98% 98% 96%

Source: Reid & C, 2004

There are four sets of nomenclatures that have been used to describe the antigens,

proteins and genes in the Rh system: two sets are based on the postulated genetic

mechanisms, one set only describes the presence or absence of the antigens and the

fourth is the traditional terminology recommended by the ISBT committee for

terminology of blood group antigens.

In the early 1940s, Fisher and Race postulated that the antigens in the Rh system were

produced by three closely linked sets of alleles (C/c, D/d and E/e) and each gene was

30

responsible for producing the antigens (C, c, D, E, and e) on the surface of RBC

(Race, 1948). To date, no “d” antigen has been found, so it is considered as an

amorphous gene (silent allele) or the absence of D antigen. There are eight possible

haplotype arrangements of Rh genes (Table 2.3).

Table 2.3: Possible haplotype arrangements of Rh genes by Fisher-Race

Terminology

Frequency (%)

Gene Combination White Black Native American Asian

DCe 42 17 44 70

dce 37 26 11 3

DcE 14 11 34 21

Dce 4 44 2 3

dCe 2 2 2 2

dcE 1 0 6 0

DCE 0 0 6 1

dCE* 0 0 0 0

*Frequency less than 1%, but phenotype has been found

Source: Widmann, 1985

In 1943, Wiener introduced terminologies which are more complex. He believed that

the gene responsible for defining Rh actually produced an agglutinogen; a series of

blood factors that were identified by specific antibodies. He proposed the single locus

and eight allele genes theory (Wiener, 1943) (Table 2.4).

31

Table 2.4: Wiener‟s Rh Terminology

Gene Agglutinogen Blood Factors Shorthand

Designation

Fisher-Race

Antigens

Rh0 Rh0 Rh0hr‟hr‟‟ R0 Dce

Rh1 Rh1 Rh0rh‟hr‟‟ R1 DCe

Rh2 Rh2 Rh0hr‟rh‟‟ R2 DcE

Rhz Rhz Rh0rh‟rh‟‟ Rz DCE

rh rh hr‟hr‟‟ r Dce

rh‟ rh‟ rh‟hr‟‟ r‟ dCe

rh‟‟ rh‟‟ hr‟rh‟‟ r‟‟ dcE

rhy rhy rh‟rh‟‟ r

y dCE

Source: Wiener, 1943

Even though this theory was incorrect, the shorthand designation is used by many

blood bankers for the designation of the phenotype.

In 1960s and 1970s, alpha numerical terminology was proposed by Rosenfield and

colleagues (Rosenfield et al., 1962; Rosenfield et al., 1973; Rosenfield et al., 1979)

and this system was only based on the presence or absence of the antigen on the red

cell and has no genetic basis. Each antigen was given a number that assigned it to the

Rh system and a minus sign was given if the antigen is absence (Table 2.5). The five

major antigens that were assigned are D is RH1, C is RH2, E is RH3, c is RH4 and e

is RH5.

32

Table 2.5: Rh types by Three Nomenclatures

Genotype

Fisher-Race Wiener Rosenfield

Common

genotypes

DCe/dce R1r Rh:1,2,-3,4,5

DCe/DCe R1R1 Rh:1,2,-3,-4,5

dce/dce rr Rh:-1,-2,-3,4,5

DCe/DcE R1R2 Rh:1,2,3,4,5

DcE/dce R2r Rh:1,-2,3,4,5

DcE/DcE R2R2 Rh:1,-2,3,4,-5

Rarer genotypes dCe/dce r‟r Rh:-1,2,-3,4,5

dCe/dCe r‟r‟ Rh:-1,2,-3,-4,5

dcE/dce r”r Rh:-1,-2,3,4,5

dcE/dcE r”r” Rh:-1,-2,3,4,-5

Dce/dce R0r Rh:1,-2,-3,4,5

Dce/Dce R0R0 Rh:1,-2,-3,4,5

dCE/dce ryr Rh:-1,2,3,4,5

Source: Wiler, 1999

As the practice of blood transfusion began expanding and researchers shared their data

with others, ISBT was given a mandate to establish a uniform nomenclature that is

easily readable by machine and human and also in keeping with the genetic basis of

blood group. The ISBT adopted six digit numbers for specific antigen; the first three

numbers represent the blood group system while the last three numbers represent the

antigen specificity. For Rh blood group system, 004 were assigned as the first three

numbers and each antigen in the Rh system was given a unique number to complete

the six digit numbers (Table 2.6).

33

Table 2.6: Five major Rh antigens in four nomenclatures

Fisher-Race Wiener Rosenfield ISBT

D Rh0 Rh1 004001

C rh‟ Rh2 004002

E rh” Rh3 004003

c hr‟ Rh4 004005

e hr” Rh5 004006

Source: Wiler, 1999

Rh antibodies are rarely naturally occurring. The Rh antibodies are mostly the product

of sensitization from the previous transfusion or pregnancy and are clinically

significant as they cause transfusion reactions and HDFN. The majority of Rh

antibodies are IgG type and can cross the placenta but rarely activate complement.

Extravascular haemolysis occurs in the spleen as they bind to RBCs via the Fc portion

of the antibody and mark them up for destruction (Dean, 2005).

2.1.1.2 Genetics and biochemistry

The Rh antigens are encoded by two genes; RHD and RHCE (Flegel, 2007), and are

97% identical (Westhoff, 2004). These genes are closely linked on chromosome 1

(1p34.3-p36.13) (Cherif-Zahar et al., 1991) and each contain 10 coding exons but in

tail-to-tail orientation (3‟RHD5‟-5‟RHCE3‟) with an unrelated gene, the SMP1 that

separates them (Wagner & Flegel, 2000) (Figure 2.1). Both genes encode a

transmembrane protein over 400 residues in length that transverses the RBC

membrane 12 times with the internal termini and 6 loops extending outside the

membrane (Figure 2.2). The RhD and RhCE proteins differ by only 32-35 amino acids

(Avent et al., 1992), which is in contrast to most blood group antigens that are

encoded by single genes with alleles that differ by only one or a few amino acids.

34

Figure 2.1: The Rh genes, showing the 10 exons of RHD and RHCE in opposite

orientation on the chromosome, SMP1 in between and Rh boxes

flanking RHD.

Source: Daniels, 2005

The RhD protein encodes over 30 epitopes of the D antigen. The variations of the D

phenotype arises when these epitopes are only weakly expressed (“weak D

phenotype”) or missing (“partial D phenotype”) (Dean, 2005). Meanwhile, the RhCE

protein encodes the C/c antigen on the 2nd

extracellular loop and the E/e antigen on the

4th

extracellular loop, plus many others such as Cw (RH8), C

x (RH9) and VS (RH20).

There are four amino acid substitutions that are usually associated with C/c

polymorphism , at position 16, 60, 68 and 103, but the Ser103Pro substitution in the

second extracellular loop that is definitive for determining C or c activity (arise from

SNP 307T>C). For RH C antigen, proline will be present and for RH c antigen, serine

will be detected. The E/e polymorphism results from a Pro226Ala substitution in the

fourth extracellular loop (arise from SNP 676C>G). For RH E antigen, proline will be

detected and for RH e antigen, alanine will be present (Mouro et al., 1993; Dean,

2005) (Figure 2.2).

35

Figure 2.2: The D and CcEe polypeptides span the membrane 12 times and have

internal N- and C-termini and 6 extracellular loops. The amino acid

substitutions for C/c polymorphism in the second loop and E/e

polymorphism in fourth loop.

Source: Daniels, 2005

2.1.2 KEL blood group

KEL is one of the most complex blood group systems after ABO and Rhesus blood

group. It contains a lot of highly immunogenic antigens and is described as the third

most polymorphic systems. Antibodies which target the KEL antigens could

potentially cause HTR and HDN and this is found to be similar to the Rhesus blood

group systems.


KEL blood group antigens can be found only on red cell in low density and cannot be

detected on monocytes, granulocytes, lymphocytes or platelets using

immunofluorescent flow cytometry. The antigens are well developed at birth and

cannot be destroyed by enzyme treatment of the red cells (Kormoczi et al., 2009).

There are 35 antigens in the KEL blood group systems which include six pairs or

36

triplets of antithetical antigens (Transfusion, 2015). The K antigen is one of the most

clinically significant antigens. K antigen (KEL1) was first described in 1946 by

Coombs and colleagues (1946) because of an antibody that caused HDFN in the serum

of a woman known as Mrs. Kelleher. It can be detected as early as 10 weeks of

gestation and the phenotype frequency is present in 9% of whites and approximately

2% in blacks (Coombs et al., 1946). Three years later, k antigen (KEL2) was

described by Levin and colleagues (1949) as an antithetical antigen to K. It can be

detected at 7 weeks of gestation and is present on red cells of over 99% of all

individuals (Levine et al., 1949).

Other antithetical antigens of the KEL blood group systems are Kpa (KEL3) which has

low frequency, Kpb (KEL4) which has high frequency and Kp

c (KEL21) which

showed low incidence (Allen & Lewis, 1957; Yamaguchi et al., 1979). Other antigens

that showed low incidence were K17 and K24 (Strange et al., 1974; Lee et al., 1997).

The Jsa (KEL6) occurred approximately 20% in black people while Js

b (KEL7)

showed high incidence (Giblett, 1958; Walker et al., 1963). Other studies also showed

that K11 and K14 have high incidence (Guevin et al., 1976; Lee et al., 1997). The

Kellnull or K0 phenotype was described in 1957 where the red cells lack all of the Kell

antigens (Chown et al., 1957) and McLeod phenotype (individual who lack Kx

protein, essential for the expression of Kell system antigens) have been described as a

phenotype with markedly reduced Kell antigen expression (Allen et al., 1961) (Table

2.7, Figure 2.3).

Anti-K is the most common antibody seen in the blood bank. It is an IgG antibody

type which is reactive in the antiglobulin phase. The K antibody has been implicated

37

in causing HTR which can occasionally be severe in nature and also an important

cause of HDFN and neonatal anaemia (Win et al., 2005). It tends to occur not only in

the mothers that has had a history of blood transfusion, but also in the mothers that

have been sensitized to the Kell antigen during previous pregnancies (Dean, 2005). It

is not difficult to find compatible blood for patients with anti-K because over 90% of

donors are K-. Anti-k occurs less frequently but it has similar clinical and serologic

characteristics with anti-K.

Table 2.7: KEL blood group system phenotypes and prevalence

Prevalence (%)

Phenotype White African American

K-k+ 91 98

K+k+ 8.8 2

K+k- 0.2 Rare

Kp(a+b-) Rare 0

Kp(a-b+) 97.7 100

Kp(a+b+) 2.3 Rare

Kp(a-b-c+) 0.32 (Japanese) 0

Js(a+b-) 0 1

Js(a-b+) 100 80

Js(a+b+) Rare 19

Source: Beth H. Shaz, 2009a

38

Figure 2.3: Kell and Kx proteins

Kell is a single-pass protein while Kx span the red blood cell membrane ten times. Kell and Kx are

linked by a disulfide bond, shown as –S–. The amino acids that are responsible for the more common

Kell antigens are shown. The N-glycosylation sites are shown as Y. The hollow Y represents the N-

glycosylation site that is not present on the K (K1) protein.



KEL gene has been assigned to chromosome 7(q33) and contains 19 exons that span

more than 21 kbp of genomic DNA. The glycoprotein produced by this gene has a

single pass through the red cell membrane (Dean, 2005). The KEL gene is highly

polymorphic and all of these polymorphisms represent SNPs encoding amino acid

substitutions on the Kell glycoprotein.

The k/K polymorphism results from single base mutation, 698C>T SNP in exon 6 of

KEL, encoding a Thr193Met substitution (Lee, 1997; Lee, 1998). When the KEL

gene produces the K antigen, methionine will be present and for the k antigen,

threonine will be detected. The Kpa/Kp

b polymorphism results from an Arg281Trp

39

(arise from SNP 841T>C) and Jsa/Js

b polymorphism results from a Leu597Pro (SNP

1790C>T).

2.1.3 Kidd blood group

Kidd blood group system was discovered by Allen and associates in 1951 with the

identification of an antibody responsible for HDFN (Allen et al., 1951). It is

designated as JK or 009 by ISBT. Kidd blood group system has a special significance

to routine blood banking because of its antibodies which can be difficult to detect and

a common cause of HTR.

The Kidd antigens act as RBC urea transporters and are located in the red cell

membrane. Kidd glycoprotein transports urea in and out of the RBCs rapidly while

maintaining the osmotic stability and the shape of the RBC during the process. Other

than that, it is also expressed on the endothelial cells of vasa recta in the medulla of

human kidney where it enables the kidney to concentrate the urea to produce

concentrated urine. For individuals who do not produce the Kidd glycoprotein, also

known as Jk null individuals, they have a reduced capacity to concentrate their urine

into the maximal concentration and their RBCs are more resistant to lysis by 2 M urea.

However, there is no clinical effect that could lead to other abnormalities, therefore,

they remain healthy and their RBCs would still have a normal shape and lifespan

(Sands et al., 1992; Dean, 2005; Mohandas & Narla, 2005; Beth H. Shaz, 2009a).

40


There are three antigens in the Kidd blood group systems; Jka, Jk

b and Jk

3, but Jk

a and

Jkb are the most common. There are four common phenotypes identified in the Kidd

systems (Table 2.8). The Jk(a-b-) phenotype or null phenotype is also known as Jk3

and is extremely rare, except in some populations of Pacific Island origin, especially

Polynesian and Chinese and as described by Pinkerton and colleagues in 1959

(Pinkerton, 1959).

Table 2.8: Phenotypes and frequencies in the Kidd system

Phenotype Whites (%) Blacks (%) Asians (%)

Jk(a+b-) 26.3 51.1 23.22

Jk(a+b+) 50.3 40.8 49.94

Jk(a-b+) 23.4 8.1 26.84

Jk(a-b-) <0.01 <0.01 0.9 to <0.1 Source: Wilkinson, 2005

Jka antigens can be detected on fetal red cells as early as 11 week of gestation and

even earlier for Jkb antigens at 7 weeks of gestation. Both antigens are well developed

at birth, which contributes to the potential occurrence for HDFN. The antigens cannot

be found on platelets, lymphocytes, monocytes or granulocytes using sensitive

radioimmunoassay or immunofluorescent techniques (Mollison et al., 1997) and also

cannot be destroyed by enzymes, ZZAP, chloroquine diphosphate, AET, DTT or acid

(Calhoun, 1999).

Anti-Jka

is a more common antibody than anti-Jkb. It was found by Allen and

colleagues (1951) in the serum of Mrs. Kidd whose infant had HDFN. Two years

later, anti-Jkb was discovered by Plaut and co-workers (1953) in the serum of a

41

transfusion reaction patient. Both antibodies are IgG type and antiglobulin-reactive

although IgM example has been reported (Mollison et al., 1997).

Anti-Jka and anti-Jk

b antibodies are dangerous antibodies because they can be very

difficult to detect in routine blood cross-matches; they show dosage effect, often weak

and found in combination with other antibodies (Calhoun, 1999; Dean, 2005). They

are a common cause of delayed haemolytic transfusion reaction (DHTR) (Mollison et

al., 1997). Anti-Jk3 (also known as anti-Jk

ab), which is a very rare type of Kidd

antibody produced by Jk(a-b-) individuals, can cause immediate and delayed

haemolytic transfusion reactions. Contrary to its haemolytic reputation in transfusion,

most Kidd antibodies rarely lead to HDFN (Dean, 2005).


The SLC14A1 gene (Solute carrier family 14, member) or also known as JK gene is a

member of urea-transporter gene family. The gene has been assigned to chromosome

18 (18q11-q12) and organized in 11 exons that is distributed across the 30 kbp of

genomic DNA but only starts at exon 4 until exon 11 where the mature Kidd protein is

encoded; the first three exons and part of forth exons are not translated (Dean, 2005).

The product of the JK gene is a urea transporter molecule that spans the red cell

membrane 10 times with both the N terminus and C terminus being intracellular

(Figure 2.4) (Sands, 2002; Dean, 2005).

42

Figure 2.4: Domain structure of Kidd transporter.

Ten transmembrane domain structure of the Kidd transporter were predicted. The polymorphism

responsible for the Kidd antigens and the site for the N glycan as shown.


The Jka/Jk

b polymorphism arise from SNP 838G>A, resulting in a D280N

substitution. For Jka antigen, aspartic acid will be present and for Jk

b antigen,

asparagine is detected. The molecular basis of Jk3 antigen is unknown (Wilkinson,

2005).

2.1.4 Duffy blood group

Duffy was the first blood group mapped to an autosome (chromosome 1) using

cytogenetic studies. Located at the same chromosome as RH blood group, the

antibodies which targeted the Duffy antigens are usually clinically significant and

have been reported to cause HTR and HDFN.

43


There are five antigens in the Duffy blood group system but only two which are most

important; Fya (FY1) and Fy

b (FY2). Both antigens can be identified on fetal red cells

as early as 6 weeks of gestation and are well developed at birth. These antigens, like

most red cell antigens cannot be found on granulocytes, monocytes, lymphocytes or

platelets but they can be identified in other body tissues including brain, colon,

endothelium, lung, spleen, thyroid, thymus and kidney cells (Reid, 1995). There are

also rare individuals with the Fy(a-b-) phenotype or also known as Fy3

who do not

produce Duffy antigens on their RBCs (Dean, 2005). The Fyx

antigen results from

weak expression of Fyb, and can be found in the white people due to a single mutation

in the FYB gene. The Fy(a-b-) is caused by a mutation in the promoter region of FYB,

which disrupts the binding site for the erythroid transcription factor GATA-1 and

results in the loss of Duffy expression on RBCs, but not its expression on

endothelium. Fy(a-b-) individuals who have no Duffy glycoprotein, form anti-Fy3 and

reacts with all RBCs except Fy(a-b-) RBCs (Beth H. Shaz & John D. Roback, 2009).

In contrast to the Kidd antigens, the Fy antigens (except Fy3 antigen) can be destroyed

by enzymes including ficin, papain, bromelin, chymotrypsin and the IgG cleaving

reagent ZZAP (Calhoun, 1999). Denaturation could also occur by formaldehyde or

heating the red cells at 56oC for 10 minutes (Wilkinson, 2005).

In Duffy blood group system, there are four common phenotypes observed (Table

2.9). The disparity in the distribution of Duffy phenotypes in different races is quite

notable.

44

Table 2.9: Frequencies of Duffy phenotypes

Phenotypes Whites (%) Blacks (%) Chinese (%)

Fy(a+b-) 17 9 90.8

Fy(a+b+) 49 1 8.9

Fy(a-b+) 34 22 0.3

Fy(a-b-) Very rare 68 0

Source: Calhoun, 1999

Antibodies against the Duffy antigens have all been implicated as the cause of HTR

and HDFN. Anti-Fya is 20 times more common than anti-Fy

b (Mollison et al., 1997)

which is commonly found in African patients (especially in the Duffy null phenotype)

that have sickle cell anaemia which require multiple blood transfusion (Dean, 2005). It

was discovered in 1950 in a serum of haemophilia patients who had underwent

multiple blood transfusion (Cutbush et al., 1950). A year later, anti-Fyb was

discovered in the serum of a multiparous female (Ikin et al., 1951). It is rare, weakly

reactive and often occurs in combination with other antibodies (Mollison et al., 1997).

Both antibodies are mainly IgG type and react readily with antiglobulin testing using

the indirect antiglobulin technique.


The DARC (Duffy antigen receptor for the chemokines) gene or also known as Duffy

(FY) gene is the first human gene to be assigned to an autosome (a non-sex

chromosome). It is located on the long arm of chromosome 1 (q22-q23) (Donahue et

al., 1968) and consists of two exons that span over 1500 bp of genomic DNA (Dean,

2005) which encode a protein of 337 amino acids (Chaudhuri et al., 1995). The

Duffy‟s antigen protein is a multipass transmembrane glycoprotein with a protruding

glycosylated amino terminal region (Figure 2.5). The antigens show a dosage effect,

45

whereby there are twice as many Fya antigens on RBCs from homozygous individual

of the Fya allele than the heterozygous individual (Beth H. Shaz & John D. Roback,

2009). The Duffy glycoprotein is also a membrane protein which serves as a non-

specific receptor for several chemokines and as a receptor for human malarial

parasites Plasmodium vivax and Plasmodium knowlesi in order to invade erythrocytes

(Hadley & Peiper, 1997). However, in individual‟s RBCs that lack the Fya and Fy

b

antigens (individual who have Fy(a-b-)), they are resistant to infection by these

parasitic organisms (Hamblin & Di Rienzo, 2000; Beth H. Shaz & John D. Roback,

2009).

Figure 2.5: Domain structure of Duffy protein.

Seven transmembrane domain structure of the Duffy protein were predicted. The amino acid change

responsible for Fya/Fy

b polymorphism, the mutation responsible for Fy

x glycosylation sites and the

regions where Fy3 and Fy6 map as shown.

Source: Beth H. Shaz & John D. Roback, 2009

46

Fya and Fy

b antigens are encoded by co-dominant allele group, FYA and FYB, which

differ by a SNP 125G>A resulting in a G42D substitution. For Fya antigen, glycine

will be detected and for Fyb antigen, aspartic acid will be present (Hadley & Peiper,

1997). In individuals who have a homozygous nucleotide change in the 5‟

untranslated region, -46T>C, or also called the GATA-1 box mutation, they do not

express Fya or Fy

b antigens on the surface of their RBCs which is serologically

phenotype as Fy(a-b-) (null phenotype). This phenotype is predominant among West

Africans and Afro-Americans populations (Tournamille et al., 1995a).

The presence of antibodies towards these blood group systems are considered as

unexpected alloantibodies and the corresponding antigen must be avoided. There are

isolated reports of prevalence and frequencies of these antibodies in Malaysia,

observed in different clinical settings (Noor Haslina, 2005; Nadarajan et al., 2012;

Yousuf et al., 2013; Osman et al., 2014). However, the most reported cases involved

patients receiving multiple or repeated blood transfusions, especially thalassaemia.

47

Table 2.10: Frequencies of antibodies amongst repeatedly-transfused thalassaemia

patients of Hospital Ampang, Malaysia

Antibody No. of patient

Anti-E 12

Auto IgG 6

Anti-S 5

Anti-Jkb 4

Anti-c 1

Anti-D 1

Anti-e 1

Anti-Jka 1

Anti-Leb 1

Anti-Mia 1

Anti-P1 1

Anti-Fyb 1

Anti-K 1 Source: Osman, et al., 2014

2.2 THALASSAEMIA: DEFINITIONS AND BACKGROUND

Thalassaemia is defined as a heterogeneous group of inherited blood disorder of

haemoglobin synthesis, a result from the reduction or absent production of one or

more α-globin chains which is located on chromosome 16 or β-globin chains of

haemoglobin which is located on chromosome 11 (George, 2013; Kawthalkar, 2013).

It is the commonest single gene disorder in the world and about 3% of the world

population (150 million) carries the β-thalassaemia genes (Saxena & Phadke, 2002)

and up to 5% are affected with α-thalassaemia (Vichinsky, 2010). The word

„thalassaemia‟ comes from the Greek word „thalassa‟ which means „the sea‟ since it

was thought that this disease only occurred among Mediterranean population and

„emia‟ means „related to blood‟. Thomas Cooley, an American paediatrician was the

first person who described Thalassaemia in 1925 (George, 2013).

48

Thalassaemia is a common haemoglobin disorder in Malaysia and is considered as a

major public health problem. Clinically, thalassaemia are classified into three main

clinical phenotypes; trait, intermedia and major. Thalassaemia minor does not cause

any significant problems apart from the individuals acting as a carrier of the disease

and without his/her awareness in the absence of a blood test for screening (George et

al., 2011). In the early 1990s, the thalassaemia carriers were estimated approximately

5% of the population (George, 2001). However, with the current changes in socio-

demographic and rapid population migration and movement, the carrier status may be

underestimated.

Thalassaemia intermedia and thalassaemia major are generally the severe forms of

thalassaemia and are associated with severe symptomatic anaemia which may require

life-long RBC transfusions. β-thalassaemia major results from severe transfusion-

dependent anaemia and α-thalassaemia major or Hb barts hydrops foetalis which is

incompatible with life (Weatherall & Clegg, 2011). Data from Malaysian

Thalassaemia Registry showed that 3,310 out of 4,541 registered patients are

transfusion-dependent β-thalassaemia major and Hb E-β thalassaemia patients

(Malaysia, 2009). Four hundred and fifty-five patients are thalassaemia intermedia

while 410 individuals are affected with Hb H disease and the other subtypes make up

the rest (Malaysia, 2010). Until 2013, the total numbers of thalassaemia cases reported

in Malaysia has reached 6,031 patients and this number will keep increasing year by

year (Malaysia, 2013).

Similar symptoms may be apparent amongst thalassaemia intermedia and

thalassaemia major patients. Pallor is usually the first symptom accompanied by

49

moderate to massive splenomegaly of various severity, irregular fever and failure to

thrive. Symptoms in thalassaemia intermedia usually develop much later in life.

Regular blood transfusions improve anaemia and reduce skeletal deformity associated

with excessive erythropoiesis. Although blood transfusion is a life-saver for

thalassaemia patients, it is associated with many complications such as iron overload,

platelet alloimmunization and anti-red blood cell immunization in the form of

alloantibodies and autoantibodies (George, 2013; Kawthalkar, 2013).

2.3 RBC IMMUNIZATION IN THALASSAEMIA

RBC alloimmunization is one of the complications of blood transfusion. It is defined

by the development of antibodies that occurs as a consequence of the disparity

between donor and recipient‟s RBC antigens. The rates of alloimmunization among

multitransfused individuals are significantly higher compared to the general

population and transfusion-dependent thalassaemia patients have high risk of

complications. Antibody screening for the unexpected red cell antibodies must be

done appropriately using the patient‟s serum prior to each transfusion procedure so

that compatible blood can be provided and the formation of alloantibody can be

avoided.

The development of anti-RBC antibodies (alloantibodies and/or autoantibodies) can

significantly complicate transfusion therapy. Many factors may influence the rate of

alloimmunization such as antigen immunogenicity, duration of transfusion therapy,

genetic factors and environmental factors (Bauer et al., 2007). Brantly and colleagues

(1988) stated that the higher the quantity of blood transfused to the patient, the higher

50

the rate of alloimmunization while other studies found that RBC alloimmunization

will develop at the early onset of transfusion (age<3 years) or before the 15th

transfusion (Blumberg et al., 1984; Michail-Merianou et al., 1987). When antibodies

against the high frequency antigens have been developed, it is usually very difficult to

find the suitable blood for the patients. Most of the blood transfusion services only

provide the red cell units which are matched with ABO and RhD antigens. However,

for patients with haemoglobinopathies who require life-long transfusion, they should

receive blood that is also matched for the extended blood group antigens such as Rh

C, c, E, e and in the KEL, Kidd, and Duffy systems to prevent alloimmunization

(Blumberg et al., 1984).

The prevalence of alloimmunization has been demonstrated in many different

thalassaemia patient groups. An American research group documented that 22% (14

of 64 patients) of severe thalassaemia patients developed alloantibodies. This

consisted of 19 types of alloantibodies of which 14 of them were clinically significant

(Ameen et al., 2003). Another research group who studied a similar patient group in

Iran found that the frequency rate of alloimmunization in thalassaemia patients in

Northeast Iran was 2.87% (Bhatti et al., 2004). Other studies showed that 8.6% (of

162 patients) in Pakistan, 5.6% (of 162 patients) in India, 17.5% (of 143 patients) in

Thailand and 28.4% (of 95 patients) in Egypt develop alloantibobodies (Saied et al.,

2011; Dhawan et al., 2014; Jansuwan et al., 2015; Zaidi et al., 2015).

Autoantibodies are directed against the individual‟s own red cells. It appears less

frequently but may cause significant clinical haemolysis and difficulty in blood cross-

matching. Patients with autoantibody may have a higher transfusion rate and often

51

require immunosuppressive drugs, a splenectomy, or other alternative treatments

(Singer et al., 2000). Study done by Saied and colleagues (2011) found that 1 in 95

regularly transfused beta thalassaemic patients in Egypt will lead to autoantibodies.

This finding is similar with a study done by Noor Haslina and colleagues (2006) on 58

multiply-transfused Malay thalassaemic patients. In a different study, Singer et al.,

(2000) found that 16 of 64 transfusion-dependent thalassaemia patients of

predominantly Asian descent were diagnosed with autoantibodies. Eleven

autoantibodies were reported as IgG while 5 were identified as IgM. In 7 of these 16

patients, autoantibodies were associated with the presence of alloantibodies (Singer et

al., 2000).

2.4 DETERMINATION OF BLOOD GROUP ANTIGENS

2.4.1 The haemagglutination technique

In most hospital blood banks, determination of blood group antigens is performed by

using serological test. Serological test is regarded as the gold standard method for

blood group typing where the specific antisera is used to detect the specific antigens

on the red blood cells surface. This test was used for the first time by Karl Landsteiner

in 1901 when he discovered the major ABO blood antigens, which was then modified

by Coombs, Mourant and Race when they discovered many other minor blood

antigens (Beth H. Shaz, 2009b). The most common serological test used is the tube

method (also known as “wet” method) and the gel method (also known as “column

agglutination”). Both are based on the detection of visible haemagglutination or the

presence of haemolysis (Beth H. Shaz, 2009b; Krista L. Hillyer, 2009).

52

The agglutination occurs when the antigens on RBCs interact with antibodies in the

plasma. There are two major classes of antibodies to RBC antigens which are IgM and

IgG. Typically, IgM antibody results in visible agglutination during the immediate

spin (IS) phase while IgG antibody results in visible agglutination during the anti-

human globulin (AHG) phase.

IS phase:

The IgM antibody binds to corresponding antigens and directly agglutinates the RBCs

after centrifugation, without additional reagents or extended incubation.

AHG phase:

The IgG antibody does not directly result in agglutination, so, AHG techniques must

be used. The AHG phase is based on the principle that AHGs obtained from

immunized non-human species bind to human globulins such as IgG or complement

attached to RBC antigens. The binding of the AHGs to the sensitized RBCs (RBCs

covered with IgG and/or complement) results in visible agglutination following

centrifugation. AHG techniques require additional reagents (potentiators) and

extended incubation for optimal sensitivity.

AHG reagents:

The AHG reagents can be monoclonal, polyclonal or a mixture of both. The

polyspecific AHG contain anti-IgG and anti-C3d and may contain anti-C3b and other

immunoglobulin and complement antibodies. A negative AHG test must be followed

by a control system of IgG sensitized cells (check cells) to confirm that the result is

not a false negative. If the check cells do not agglutinate, test must be repeated.

53

However, the accuracy of the results is highly dependable on the person who reads or

grades the reactions. A good result should be obtained from a well-trained and

qualified person and the reactions should be examined within a short period of time.

In some cases, the detection of the blood group antigen by this method is not reliable.

This may be due to recent exposure to donor red cell, certain drugs or medications or

other diseases that may alter the red cell membrane. A complete clinical and

transfusion history is very important when interpreting the results obtained.

Many studies have reported difficulties in interpreting the patients‟ blood typing when

performing the blood phenotyping from multiply-transfused patients (Reid et al.,

2000; Rožman et al., 2000; Castilho et al., 2002a; Castilho et al., 2002b; Ribeiro et al.,

2009; Guelsin et al., 2010). The mixed-field reactions (where a positive and negative

result in a single reaction tube) that are observed in more than one antigen typing

could also make the determination of the antigen-matched RBCs for the patients

becomes more complicated.

Even though the serological test is simple, inexpensive and when correctly performed

has a specificity and sensitivity appropriate for the clinical care of the majority of

patients, it also has many limitations. This includes unreliable prediction of a foetus at

risk of HDFN, difficulty to correctly type the RBCs from a recently-transfused patient

or those which are coated with IgG. The technique does not precisely indicate RHD

zygosity in D+ people, and requires the availability of specific and reliable antisera

where some may be limited in volume, weakly reactive or not available at all. The

correct blood antigen typing may only be revealed by using molecular methods when

54

the red cells are an unreliable sample source. The understanding of the molecular basis

associated with many blood group antigens and phenotypes enable us to consider the

identification of blood group antigens and antibodies using molecular approaches

(Reid, 2007).

2.4.2 Red blood cell genotyping by molecular analysis

Molecular genetics industry began in the early 1980s since the development of the

polymerase chain reaction (PCR) by Mullis and Faloona (1987) which allows the

amplification of DNA and analysis of genes. The age of genomics has enabled the

application of DNA-based molecular methods to transfusion medicine. Since the first

discovery of ABO blood group antigens by Yamamoto and colleagues (1990), the

molecular basis of almost all blood group antigens has been determined (Daniels,

2005). The majority of genetically defined blood group antigens are the consequence

of a single-nucleotide polymorphism (SNP), so, it is now possible to predict the blood

group antigen profile of an individual by testing their DNA with a high degree of

accuracy (Westhoff, 2006; Moulds, 2010) which may be used to overcome the

limitations of haemagglutination methods.

There are many molecular methods that can be used for red cell genotyping. It can be

divided according to the predicted workload of sampling; low throughput;

conventional PCR by using gel electrophoresis analysis, medium throughput; real

time, Sanger DNA sequencing and pyrosequencing and high throughput; microarray

technology such as Beadchip array, BloodChip and Genome Lab SNP stream, fluidic

microarray systems, TaqMan® OpenArray, MALDI-TOF MS (matrix-assisted laser

desorption/ionization time-of-flight mass spectrometry) and mini-sequencing. The

55

application of the molecular methods in red cell genotyping has been identified to be

advantageous over haemagglutination technique; antigen typing in patients with recent

blood transfusion and in patients with Direct Antiglobulin Test (DAT) positive that

complicates phenotyping or when antiserum especially for rare antigens is not readily

available for antigen typing, resolution of discrepancies in serotyping and assessment

of risk of HDFN using maternal samples (Reid, 2003; Van der Schoot, 2004).

2.4.2.1 Assays based on conventional PCR (low-throughput)

PCR is used to amplify a specific sequence of DNA and the reaction consists of three

steps: 1) denaturation step at 95oC to separate double-stranded DNA, 2) annealing step

typically at 55oC-65

oC for binding of primer to single-stranded DNA and 3) extension

step at 72oC for the creation of a complementary DNA copy. These steps are repeated

25-35 times, which results in exponential increase in the number of copies (PCR

amplicon) (Monteiro et al., 2011). PCR amplification performance and efficiency is

routinely analysed by electrophoresis through an agarose gel with the fragment bands.

The separation of the fragment, based on the size are visualized by ethidium bromide

staining under ultraviolet (UV) light. Various PCR assays commonly used include

allele-specific (AS-PCR), also known as sequence-specific priming (PCR-SSP), PCR-

restriction fragment length polymorphism (RFLP) and multiplex PCR. All of these

types of PCR are also known as gel-based detection.

PCR-RFLP was based on the introduction or loss of restriction sites by SNP of interest

and the alleles are differentiated after PCR by digestion of the product with a

restriction enzyme before the fragment was visualized by electrophoresis. Restriction

56

enzyme will digest the nucleic acids and then recognize the specific sequences of

nucleotides in a DNA strand.

AS-PCR or PCR-SSP requires two reactions to be set up for each DNA sample and

each reaction tube has one primer that is gene-specific (common to both alleles), and

one primer that is specific for one or two possible alleles present. BAGene DNA-SSP

Kits is one of the commercially available kits that can be used for ABO variants,

RHD/RHCE variants and other blood group genes such as K1/K2, FYA/FYB and

JKA/JKB (Prager, 2007; Kyaw, 2012).

Multiplex PCR allows for simultaneous amplification of many target alleles or regions

of DNA in one reaction by using multiple primer pairs. Even though the method

enables a reduction in the number or different assays performed and save times,

multiplexing has limitations in the number of primer pairs that can be combined in one

reaction and the initial optimization of multiplex assays can be technically challenging

and difficult.

Work with these earlier types of molecular diagnostic methods has proved that

molecular testing can be successfully applied to blood group, platelet and human

leukocyte antigen (HLA) typing, and forensic medicine. Basically, these methods are

easy to set up as they do not require expensive instruments and are particularly well

suited for small laboratories with low workload. However, skilled technical staffs

which are costly in training and the long turnaround time due to the large number of

manual steps involved are required to apply it. These methods may also be costly

57

especially in maintaining quality control and it carries a high risk of post-amplicon

contamination (Wu & Csako, 2006).

While widespread use of molecular testing with traditional methods in clinical settings

has been hindered by these limitations, a new era of molecular genotyping with

advance of fast and/or high throughput methods and platforms has allowed molecular

genotyping to enter areas which were mainly serology-based for more than a century.

2.4.2.2 Medium to high-throughput PCR

In order to meet the demand of routine blood group genotyping of donors or patients

per day, the technologies need to be high throughput and, above all, automated,

accurate and cost effective. Cost effectiveness should not be judged on the raw cost

per test alone. The potential benefits of having a comprehensive genotype of a donor

or patient may minimise transfusion complications as alloimmunisation may be

reduced. The full economic cost of providing complex serological investigations for

such individuals should also be considered (Avent, 2009).

2.4.2.2.1 Single Nucleotide Polymorphisms Real-Time Polymerase Chain

Reaction (SNP RT-PCR)

The past decade has seen that the Real Time Polymerase Chain Reaction (RT-PCR) as

a new technique in molecular genetics which allows quantification of polymorphic

DNA region and genotyping of SNPs in one run. A by-product of RT-PCR is the

opportunity to identify new SNPs in the proximity of gene loci of interest. SNPs are

the most common DNA variants in the human genome, with an approximate

58

frequency of one every kilobase. More or less, 65% of the substitutions are transitions,

equally represented by A/G and C/T mutations, whereas 35% are transversions and all

the A/C, A/T, C/G and G/T variants have the same frequency. As SNPs are thought to

have a promising future in a wide range of applications in human genetics, today it is

widely investigated in several fields including pharmacogenomics, the study of

population evolution, analysis of forensic samples and the identification of

susceptibility genes involved in complex disease (Le Hellard et al., 2002; Martino et

al., 2010).

To date, many RT-PCR-based approaches have been used for SNP-typing in large-

scale studies. One of the most commonly applied is the TaqMan® method. Providing

the largest collection of ready-to-use human SNP assays available, the TaqMan®

genotyping assays have the simplest workflow available and are the quickest way to

generate genotyping data. Based on the 5‟nuclease assay for amplifying and detecting

specific SNP alleles in purified genomic DNA samples and takes place in a single

tube/well, it requires a RT-PCR machine, such as Applied Biosystems® 7900HT

Fast/7500 Fast Real-Time PCR Systems by Applied Biosystems® for the detection of

fluorescence. Each TaqMan® genotyping assay contains two primers for amplifying

the sequence of interest and two TaqMan® MGB probes for detecting alleles. The

presence of two probe pairs in each reaction allows genotyping of the two possible

variant alleles at the SNP site in a DNA target sequence. The genotyping assay

determines the presence or absence of a SNP based on the change in the fluorescence

of the dyes associated with the probes (Technologies, 2014).

59

The TaqMan®

MGB probes consist of target-specific oligonucleotides with:

i. A reporter dye at the 5‟ end of each probe which VIC®

dye is linked to the 5‟

of the Allele 1 probe and 6FAM™

dye is linked to the 5‟ of the Allele 2 probe.

ii. A minor groove binder (MGB), which increases the melting temperature (Tm)

without increasing probe length, thereby allowing the design of shorter probes.

Shorter probes result in greater differences in Tm values between matched and

mismatched probes, resulting in accurate allelic discrimination.

iii. A non-fluorescent quencher (NFQ) at the 3‟ end of the probe.

Table 2.11: Correlation between fluorescence signals and sequences

Fluorescence increase Indication

VIC® dye fluorescence only Homozygosity for Allele 1

6FAM™

dye fluorescence only Homozygosity for Allele 2

Fluorescence signals for both dyes Heterozygosity for Allele 1-Allele 2

Source: TaqMan® Genotyping

Master Mix protocol, 2014

During PCR, genomic DNA is introduced into a reaction mixture consisting of

TaqMan®

Genotyping Master Mix, forward and reverse primers and two TaqMan®

MGB probes and each probe anneals specifically to a complementary sequence, if

present, between the forward and reverse primer sites. When the probe is intact, the

proximity of the quencher dye to the reporter dye suppressed the reporter

fluorescence. Then AmpliTaq Gold DNA Polymerase, UP cleaves the only probes that

are hybridized to the target. Cleavage separates the reporter dye from the quencher

dyes, increasing fluorescence by the reporter. The increase in fluorescence occurs only

if the amplified target sequence is complementary to the probe. Thus, the fluorescence

signal generated by PCR amplification indicates which alleles are in the sample

60

(Figure 2.6). The genotypes are determined by plotting the normalized fluorescence

intensities on a scatter plot and using a clustering algorithm in the data analysis

software (Technologies, 2014).

Figure 2.6: The complementary TaqMan® probe fluoresces after anneals to the

template and after cleavage by AmpliTaq Gold DNA Polymerase, Ultra

Pure (UP).

Source: TaqMan

® Genotyping Master Mix Protocol, 2014

The advantage of this method is that only one simple reaction set up is required

without any processing after it and it is suitable for either 96 or 384 sample reactions –

rapid with medium to high-throughput analyses and less post-amplicon contamination.

61

The determination of the molecular basis of blood group antigens has been intensely

studied, with most clinically significant alleles defined. Most blood group variation is

the result of SNPs in their own corresponding genes (Mouro et al., 1993; Lee, 1998;

Wilkinson, 2005). The ability to identify changes up to the single base pair has

enabled the discovery of diversity and polymorphic nature of a certain phenotype. The

polymorphisms may be universal or may be unique to certain ethnicity and

background. However, SNPs are not the sole genetic mechanism for blood group

polymorphism (Avent et al., 2007). For example, in the ABO system, the hybrid

alleles is due to recombination or gene conversion events that lead to unexpected

phenotypes and erroneous genotyping results (Olsson & Chester, 2001). In D

phenotypes, the RHD gene is deleted (Colin et al., 1991) or an RHD pseudogene

(RHDΨ) (Singleton et al., 2000) or hybrid RHD-RHCE genes can be present (Wagner

et al., 2001). In another example, the genetic basis of the Fy(a-b-) phenotype of

African descent for example is unlike any other blood group polymorphisms and is

caused by a promoter region mutation that disrupts a GATA-1 binding site

(Tournamille et al., 1995b). This mutation abolishes the erythroid expression of the Fy

glycoprotein, whereas it is expressed normally in nonerythroid tissues in the same

individual.

2.5 BUCCAL CELLS AS AN ALTERNATIVE SAMPLE SOURCE

FOR GENETIC STUDIES

In recent years, there has been increasing interest in finding alternative sample for

genetic studies and epidemiological investigations. As the genetic code of an

individual is contained in the DNA of all somatic cells, it is possible to perform DNA

62

analysis from any source and one of it that we think is suitable are buccal cells. Buccal

cells can be collected in different protocols and the best two methods most frequently

used are mouthwash rinses (Lum & Le Marchand, 1998; Aidar & Line, 2007;

KÜChler et al., 2012) and cytobrush sampling of the inner cheeks (Saftlas et al., 2004;

Nedel et al., 2009; Poynter et al., 2013). Few studies have tried successfully to collect

the buccal cells from saliva (Quinque et al., 2006; Bahlo et al., 2010; Abraham et al.,

2012) and using cotton buccal swab (McMichael et al., 2009; Cheng et al., 2010;

Kovacevic-Grujicic et al., 2012). But, not all of these methods are practical for

collection from all types of patients. Mouthwashes procedure for example, is not

suitable for the application in younger age groups such as infants or toddlers, and

vulnerable or dependent individuals such as the elderly or unconscious patient.

Sometimes, patients will feel a burning sensation after sampling due to the presence of

alcohol in the mouthwash solution.

When dealing with the DNA that is not from the blood; the optimal DNA source for a

wide variety of genetic analyses, the most important thing that should be taken into

account is the quantity and quality of the DNA. Even the buccal cells can offer a

simple, non-invasive and less-expensive of alternative sampling method, Livy and

colleagues (2011) did not really suggested using the buccal cells as an alternative

sample to blood. The degradation of DNA from buccal cells sample has affected the

total yield and quality of the buccal DNA when compared with the blood DNA in

microarray based genotyping and it is recommended to use blood DNA for expensive

technique like microarrays than the unpredictable buccal DNA (Livy et al., 2011).

Contamination is an issue that will also rise when DNA is obtained from other sources

(Hansen et al., 2007; Herráez & Stoneking, 2008). Although, it is clearly mentioned in

63

the procedures that the subject should rinse their mouth thoroughly before collecting

buccal cells and restrain from eating anything and smoking, some of them do not

exactly follow the procedures leading to contamination of non-human DNA in buccal

samples and other noise artefacts. Quantitative PCR using human primers can solve

this problems (Quinque et al., 2006) but use of such DNA for large scale genotyping

is time consuming and challenging.

Research scientists are eager to use buccal cell DNA due to easier handling

procedures. The sample may be sent via mail and it is not necessary to have special

qualification to perform the sample collection. A pilot study on the Danish nurse

cohort was done to compare the response rate of blood, saliva and buccal cells

samples and only 31% of the requested participants delivered a blood samples,

whereas the other samples showed higher percentage of the response rate compared

with the blood (Hansen et al., 2007). Collection of buccal cell via cytobrush or cotton

swab and buccal cell on FTA card are the most convenience methods compared to

using saliva and mouthwash if the participants of the study are required to send the

samples by mail. The part where the buccal cell should be extracted also plays a very

important role. Inner cheek is always the area of choice in most studies (McMichael et

al., 2009; Kovacevic-Grujicic et al., 2012; Poynter et al., 2013) but the gutter area

could also be another good source to collect the DNA due to the maximized surface

contact between the cytobrush and mucosa (Saftlas et al., 2004; Nedel et al., 2009).

All types of methods have their own advantages and disadvantages. The most suitable

method must be chosen depending on the requirement and needs of the study.

64

For the current project, the buccal swab collection offers an escape from the

confounding factors of previous exposure to donor blood during transfusion. It is

feasible, does not require special equipment, does not involve painful needle pricks

and is generally safe and easy to perform in these patients. The collection of epithelial

cells from other sources such as menstrual blood (Bauer et al., 1999), urine (Rios et

al., 1999) or spit (saliva) (Nunes et al., 2012) have also been demonstrated. These

methods although appears feasible but may be difficult to collect, limited to certain

patient type and age as well as potentially demeaning and restrictive to some patients.

65

CHAPTER III

RESEARCH METHODOLOGY

3.1 STUDY DESIGN

This cross-sectional comparative study was carried out at the Faculty of Medicine and

Health Sciences Universiti Sains Islam Malaysia (USIM), Hospital Ampang and

Universiti Kebangsaan Malaysia Medical Centre (UKMMC) over a two-year period

from September 2013 until August 2015. The paired samples consisting of buccal

swab and peripheral blood samples were withdrawn before the scheduled blood

transfusion and on day 7 after the blood transfusion.

Day 7 was chosen as there would presumably be a mixture (dual population) of the

transfused donor blood with the patient‟s own blood. It is also the most feasible time

for sampling as these patients would have their regular Full Blood Count (FBC) to

check the haemoglobin status after transfusion.

A phenotype of the red cell by serology and genotyping were performed by using

peripheral whole blood samples. The buccal swabs were processed to harvest the

DNA and were subjected to red cell genotyping only.

66

The results of the red cell genotype which was acquired from the peripheral whole

blood and the buccal swabs were compared before and after transfusion. These results

were also correlated with the red cell phenotype obtained through serological

methods.

3.2 POPULATIONS STUDY

3.2.1 Study subjects

The subjects recruited for this study were adult patients above 18 years of age from

the thalassaemia clinic at Hospital Ampang and UKMMC.

3.2.1.1 Subjects selection

The subjects were given an explanation on the project protocols and its purposes prior

to sample collection. The procedures were stated in the Patient Information Sheet

(Appendix C). Upon obtaining the consent from the subjects, the samples were

collected and preceded for further testing. If the subjects withdrew their consent, the

samples were discarded and no other testing will be performed. The data from the

withdrawn subject will also be excluded from the study.

3.2.1.2 Inclusion criteria

1. Multiply-transfused thalassaemia patients where the interval of

transfusion is minimum 2 weeks apart.

2. Age above 18 years old.

67

3.2.1.3 Exclusion criteria

1. Non multiply-transfused thalassaemia patients.

2. Have any oropharyngeal lesions or infection.

3. Age below 18 years old.

3.2.1.4 Sample size calculation

The sample size for the study subjects was calculated based on the methods from

Daniel (1999). The importance of calculating the sample size is to estimate the

population prevalence with good precision (Daniel, 1999).

n = Z2 x P(1-P)

∆2

n = Sample size

Z = Statistic level of confidence

P = Expected prevalence of proportion

∆ = Precision

The level of confidence was set at 95% and therefore the Z value is 1.96. Prevalence

was determined based on studies that showed a prevalence of 4% alloimmunization

after red cell transfusion (Reid & Yazdanbakhsh, 1998). Data from the 2009

Malaysian Thalassaemia Registry showed that of the 4,541 registered patients, 3,310

are transfusion-dependent (Malaysia, 2009). By using a 95% confidence interval and

using a cut-off point for statistical significance of 0.05, the number of samples

required is 60 patients.

68

By taking into account a 10% of dropouts in patients and data, the total samples that

should be collected are 66 patients but only 63 patients were participated.

3.2.2 Control group

The samples were obtained voluntarily from USIM postgraduate students and staffs as

the control (normal healthy) for this study.

3.2.2.1 Control selection

The control group were also given an explanation on the project protocols and its

purpose similar as the subjects group. The control group was chosen for the

optimization of genotyping method for SNP RT-PCR platform by comparing the

results with the established conventional PCR kit from BAGene Health Care for the

determination of Rh types, KEL, Kidd and Duffy.

3.2.2.2 Inclusion criteria

1. Normal healthy individual.

2. Does not have any blood diseases or transfusion-transmitted

diseases.

3. Does not have any blood transfusion within six months.

4. Did not undergo any treatments related to blood diseases.

3.2.2.3 Exclusion criteria

1. Individual that does not meet the inclusion criteria.

69

2. Have any oropharyngeal lesions or infection.

3.2.2.4 Sample size calculation

There was no sample size calculation for the control group as the samples from this

group were obtained for optimization of the method used for red cell genotyping only

by SNP RT-PCR platform and no prevalence data was derived from them.

3.3 ETHICAL CONSIDERATION AND FUNDING

This study was approved by the Medical Research Ethical Committee (MREC)

(NMRR-12-567-12622) (Appendix A) and Universiti Kebangsaan Malaysia Medical

Centre (UKMMC) (FF-419-2012) (Appendix B). This study was funded by the

Ministry of Higher Education (MOHE) Malaysia from the Exploratory Research

Grant Scheme (ERGS) (ERGS/1/2012/SKK06/USIM/03/1). All of the information

obtained especially from the subjects was confidential.

3.4 SAMPLING METHODS

3.4.1 Preparation before sampling

3.4.1.1 Blood sample collection

There is no special preparation needed to collect the blood sample as it is a random

blood type sampling. Peripheral whole blood was collected in K2EDTA preservative

tubes.

70

3.4.1.2 Buccal swab sample collection

To avoid sample contamination and the collection of foreign substances except the

buccal cells only, the subjects were asked to rinse his/her mouth thoroughly with tap

water before the sample was collected and they were also asked to refrain from

smoking and eating for at least 30 minutes prior to the swabbing (Kovacevic-Grujicic

et al., 2012).

3.4.2 Sampling on study subjects

3.4.2.1 Day 0 sampling: before transfusion

A total of 7 ml of peripheral whole blood was collected in two separate 3.5 ml

K2EDTA tubes. One tube was used for the Direct Coombs Test (DCT) and

Serological Red Cell Phenotype and the other tube was used for the DNA extraction

for the SNP RT-PCR. Samples were kept at temperature ranging from 2oC-8

oC for not

more than 1 week after the collection date.

The buccal swab was collected using two sterile cotton swabs from the left and right

inner cheek by scrapping firmly 15 times. The cells were harvested for DNA

extraction for the SNP RT-PCR. Samples were left at room temperature for not more

than 1 week after the collection date.

3.4.2.2 Day 7 sampling: 1 week post-transfusion

For all of the study subjects, the sampling and testing was done similarly as Day 0.

71

Figure 3.1: Workflow of the study subjects

3.4.3 Sampling on control group

A total of 7 ml of peripheral whole blood was collected in two separate 3.5 ml

K2EDTA tubes. One tube was used for Direct Coombs Test (DCT) and Serological

Red Cell Phenotype and the other tube was used for DNA extraction for conventional

PCR and SNP RT-PCR.

Phenotype

by

serology

Day of blood

transfusion

(D0)

Day 7: Post

transfusion

(D7)

Buccal Swab

AND

7 ml Peripheral

whole blood sample

in 2 K2EDTA tubes

Buccal Swab

AND

7 ml Peripheral

whole blood sample

in 2 K2EDTA tubes

Peripheral

whole

blood

Buccal

swab

Buccal

swab

Peripheral

whole

blood

Genotype by

SNP RT-PCR

Phenotype

by

serology

Genotype by

SNP RT-PCR

MULTIPLY-TRANSFUSED THALASSAEMIA PATIENTS;

REQUIRING ≥2-4 WEEKLY BLOOD TRANSFUSIONS (n=63)

72

The buccal swab was collected using two sterile cotton swabs from the left and right

inner check by scrapping firmly 15 times and the cells were harvested for DNA

extraction for the conventional PCR and SNP RT-PCR.

The samples were stored in similar conditions as with the study subjects‟ samples.

Figure 3.2: Workflow of the control group

3.5 LABORATORY METHODS

3.5.1 Serological test using peripheral whole blood

The blood collection tube which contained the sample was centrifuged to separate the

plasma and the packed red cells. The packed red cells were washed with voluminous

normal saline 0.9% (B. Braun, Germany) and 4% red cell suspension was prepared

from the washed packed red cells for blood grouping test (forward) and phenotype

Buccal Swab

Genotype by PCR

7 ml Peripheral whole blood

sample in 2 K2EDTA tubes

Phenotype

by serology

Genotype by

PCR

Conventional

PCR

SNP RT-

PCR

Conventional

PCR

SNP RT-

PCR

CONTROL GROUP (n=17)

73

tests. The plasma was separated into a clean plastic tube for reverse blood grouping

test and antibody testing.

3.5.1.1 Procedure for wash packed red cells

In preparing the wash packed red cells, 0.5 ml of packed red cells was pipetted into a

clean test tube. Voluminous normal saline 0.9% was added into the test tube and the

test tube was spun at 3,000 rpm for one minute. The supernatant was discarded. This

step was repeated 3-4 times. At the last wash, the supernatant must be clear and

completely removed by pipetting them out of the test tube.

3.5.1.2 Procedure for preparation of 4% red cell suspension

In preparing of 1 ml of a 4% red cell suspension, 0.4 ml of the washed packed red

cells was transferred to a tube with 9.6 ml of normal saline 0.9% (Combs et al., 2005).

The tube was covered or caped with the tube stopper and then was gently inverted for

several times.

To compare the colour and density of the suspension by eye, a volume of the prepared

suspension was transferred to a 10 x 75 mm tube. A similar volume of a known 4%

red cell suspension (e.g. commercial reagent red cell suspension) also was transferred

to another 10 x 75 mm tube. The two tubes were held in front of a light source to

compare them.

74

3.5.1.3 Procedure for forward blood group test (tube method)

Four clean glass tubes 10 x 75 mm were prepared and labelled accordingly with

NOVACLONE™

Antisera Anti-A, Anti-B, Anti-AB and Anti-D. One drop of antisera

was added into each of the tube according to the label. Then, one drop of 4% red cell

suspension was added into each tube. The tubes were spun at 3,000 rpm for 15-20

seconds and the results were read macroscopically. The agglutination was observed

and graded as in Section 3.5.1.9.

3.5.1.4 Procedure for reverse blood group test (tube method)

Three clean glass tubes were prepared and labelled accordingly with A cell, B cell and

O cell. One drop of plasma was added into each tube. Then, one drop of A cell, B cell,

O cell was dropped according to the label. The tubes were spun at 3,000 rpm for 15-20

seconds and the agglutination was graded as stated in Section 3.5.1.9.

3.5.1.5 Procedure for antibody screening (tube method)

Three clean glass tubes were prepared and labelled with screening red cells reagent

(PANOSCREEN® Cell I, Cell II and Cell III). One drop of plasma was added into

each tube. Then, one drop of Cell I, Cell II and Cell III was added into the tubes

respectively. The samples were spun at 3,000 rpm for 20 seconds and the results were

recorded at room temperature. After that, one drop of Low Ionic Strength Solution

(LISS) (Diaclon, Switzerland) was added into each tube and all of the tubes were

incubated at 37oC for 15 minutes. After the incubation period, the tubes were spun at

3,000 rpm for 20 seconds and the results were recorded. Then the samples were

washed 3-4 times with normal saline 0.9% followed by the addition of two drops of

75

Anti Human Globulin (AHG) (Diaclon, Switzerland) into each tube after the last wash

was finished. Then, the tubes were spun again at 3,000 rpm for 20 seconds and the

results were recorded. All of the negative results were tested with one drop of Coombs

Control Cell (CCC) for validity.

3.5.1.6 Procedure of red cell phenotype by Direct Antiglobulin Test

method for Rhesus, Kidd and Kell phenotype

Seven clean glass tubes were prepared and labelled properly with commercially

prepared antisera: Anti-E, Anti-e, Anti-C, Anti-c (Rhesus phenotype), Anti-Jka, Anti-

Jkb (Kidd phenotype) and Anti-K (Kell phenotype) (Diaclon, Switzerland). One drop

of antisera was added into each of the tube respectively and followed with one drop of

4% red cell suspension. Then, the mixture was mixed properly before centrifuged at

3,000 rpm for 20 seconds. The results were read macroscopically and were graded as

stated in Section 3.5.1.9.

3.5.1.7 Procedure of red cell phenotype by Indirect Antiglobulin Test

method for Cellano and Duffy phenotype

Three clean glass tubes were prepared and labelled properly with commercially

prepared antisera: Anti-k (Cellano phenotype), Anti-Fya and Anti-Fy

b (Duffy

phenotype) (Diaclon, Switzerland). One drop of antisera was added into each of the

tube respectively and followed by the addition of one drop of 4% red cell suspension.

The mixtures were mixed properly and were incubated at 37oC for 30 minutes. Then,

the samples were washed at least 3-4 times with normal saline 0.9%. After the

samples were washed, two drops of Anti Human Globulin (AHG) were added into

76

each tube. The tubes were spun again at 3,000 rpm for 20 seconds and the results were

recorded as stated in Section 3.5.1.9. All negative results were tested with one drop of

CCC for validity.

3.5.1.8 Procedure for Direct Coombs test

3.5.1.8.1 Polyspecific AHG

Two drops of AHG reagent were mixed with one drop of 4% red cell suspension in a

clean glass tube. Then, the tube was centrifuged at 3,000 rpm for 20 seconds and the

result was read macroscopically and was recorded as stated in Section 3.5.1.9

3.5.1.8.2 Monospecific Anti-IgG

One drop of Anti-IgG reagent (Diaclon, Switzerland) was mixed with one drop of 4%

red cell suspension in a clean glass tube. Then, the tube was centrifuged at 3,000 rpm

for 20 seconds and the result was read macroscopically and was recorded as stated in

Section 3.5.1.9

3.5.1.8.3 Monospecific Anti-C3d

One drop of Anti-C3d reagent (Diaclon, Switzerland) was mixed with one drop of 4%

red cell suspension in a clean glass tube. The tube was incubated at room temperature

for 5 minutes and then centrifuged at 3,000 rpm for 20 seconds. The result was read

macroscopically and was recorded as stated in Section 3.5.1.9.

77

3.5.1.9 Test reaction

A 4+ reaction is represented by one solid aggregate or clump of cells.

A 3+ reaction is represented by several large aggregates or clump of cells.

A 2+ reaction is represented by small to medium sized aggregates with clear

background.

A 1+ reaction is represented by small aggregates with turbid reddish background.

w+ or +/- reaction is represented by barely visible aggregate with turbid background.

A MF reaction is represented by any degree of agglutination in a sea of unagglutinated

cells.

A Negative reaction (0) is interpreted when no agglutination occur with smooth

reddish background.

Haemolysis is interpreted when the plasma is red in colour.

3.5.2 Molecular technique

3.5.2.1 DNA extraction

3.5.2.1.1 Peripheral whole blood sample

The DNA was extracted using a commercial kit (QIAamp DNA Blood Mini Kit,

Qiagen, Germany) to reduce the contamination and to improve the quality of the

extracted DNA. The kit contained the following components:

78

Protease K

Buffer AL

Buffer AW1

Buffer AW2

Buffer AE

The protocols were carried out according to the kit instructions with some

modifications at certain steps and are as follows:

Three hundred microliters of K2EDTA peripheral whole blood was pipetted into a

sterile 1.5 ml micro centrifuge tube. The tube was centrifuged at 3,000 rpm for 5

minutes. The supernatant was removed and discarded as much as possible to achieve a

total volume of 200 µl without disturbing the buffy coat layer on the top of the red

packed cells. If the sample volume was less than 200 µl, appropriate volume of PBS

pH 7.2 was added.

Twenty microliters of QIAGEN Protease was pipetted into the bottom of the tube. The

tube was mixed thoroughly by vortexing vigorously. Then, 200 µl of Buffer AL was

added into the sample and were mixed thoroughly by vortexing vigorously to obtain a

homogenous solution. After that, the tube was incubated at 56oC for 10 minutes. Two

hundred microliters of absolute ethanol was added into the tube after incubation and

was mixed thoroughly by vortexing vigorously before centrifuged at 6,500 xg for 1

minute.

The mixture was then carefully transferred into the QIAamp Spin-Column in a 2 ml

collection tube without wetting the rim, the cap was closed and was centrifuged at

6,500 xg for 1 minute. The QIAamp Spin-Column was placed in a clean 2 ml

79

collection tube and the tube containing the filtrate was discarded. Then, 500 µl of

Buffer AW1 was added without wetting the rim and the tube was centrifuged at 6,500

xg for 1 minute. The spin column was transferred into the new collection tube and the

tube that containing the filtrate was discarded.

Five hundred microliters of Buffer AW2 was added into the tube without wetting the

rim and the tube was centrifuged at 13,300 xg for 10 minutes. Then, the spin column

was transferred to a new 1.5 ml micro centrifuge tube and the tube containing the

filtrate was discarded. Thirty microliters of Buffer AE was added into the spin column

during the elution step and the spin column was incubated at room temperature (15-

25oC) for 5 minutes. After that, the spin column was centrifuged at 6,500 xg for 1

minute. The elution step was repeated once again and the procedure was carried out as

previously described. Lastly, the genomic DNA was quantified and stored at -20oC

until required. The quantification method was carried out as discussed in Section

3.5.2.2

3.5.2.1.2 Buccal swab sample

3.5.2.1.2.1 Preparation of Phosphate Buffered Saline (PBS) 10X

Two grams of Potassium Chloride (KCl) together with 80 g of Natrium Chloride

(NaCl), 2 g of Monopotassium Phosphate (KH2PO4) and 11.5 g Sodium

Monohydrogen Phosphate Heptahydrate (Na2HPO4.7H2O) were diluted with 1 L of

distilled water. The pH of the solution was measured until it reached pH 7.2. Then, the

solution was filtered using filter paper.

80

3.5.2.1.2.2 Preparation of Phosphate Buffered Saline (PBS) 1X

Hundred millilitres of 10X PBS which was prepared earlier, was diluted in 900 ml

distilled water to make up a 1 L of 1X PBS. The pH was measured until it reached pH

7.2. Then, the solution was sterilized using an autoclave.

3.5.2.1.2.3 Procedure of DNA extraction from buccal swab samples

The same extraction kit with the blood samples were used for the DNA extraction of

the buccal swab samples. The protocols were carried out according to the kit

instructions with some modifications at certain steps and are as follows:

After scrapping the buccal cells from the left and right inner cheek of the subjects with

two different swabs for each side, the swabs were air-dried for about 30 minutes. In

the meantime, a new 1.5 ml micro centrifuge tube was filled with 400 µl of Phosphate

Buffered Solution (PBS) 1X pH 7.2. Then, one swab was placed in the micro

centrifuge tube and the swab was mixed properly with the PBS. Then, the swab was

separated from the stick using a pair of scissors. The tube was capped and vortexed

vigorously (while vortexing, the swab still remains in the tube). The swab was then

removed by pressing it against the wall of the tube. Then, the second swab was placed

in the same micro centrifuge tube and the same steps were repeated similar as the first

swab. Then, the tube was centrifuged at 6,500 xg for 1 minute. The supernatant was

removed while the sediment (pellet) was left intact in the tube.

Twenty microliters of QIAGEN Protease and 400 µl of Buffer AL were pipetted into

the bottom of the tube. The tube was mixed thoroughly by vortexing vigorously. After

81

that, the tube was incubated at 56oC for 20 minutes. Four hundred microliters of

absolute ethanol was added into the tube after incubation and was mixed thoroughly

by vortexing vigorously before being centrifuged at 6,500 xg for 1 minute.

Then, 700 µl of the mixture was carefully transferred into the QIAamp Spin-Column

in a 2 ml collection tube without wetting the rim. The cap was closed and was

centrifuged at 6,500 xg for 1 minute. Then the spin column was transferred into the

new collection tube. The remaining mixture was added into the spin column and was

centrifuged at 6,500 xg for 1 minute.

After that, the QIAamp Spin-Column was placed in a clean 2 ml collection tube while

the tube containing the filtrate was discarded. Five hundred microliters of Buffer AW1

was added without wetting the rim and the tube was centrifuged at 6,500 xg for 1

minute. The spin column was then transferred into the new collection tube and the

tube containing the filtrate was discarded.

Five hundred microliters of Buffer AW2 was added into the tube without wetting the

rim and the tube was centrifuged at 13,300 xg for 10 minutes. Then, the spin column

was transferred to a new 1.5 ml micro centrifuge tube while the tube containing the

filtrate was discarded. Thirty microliters of Buffer AE was added into the spin column

during the elution step and the spin column was incubated at room temperature (15-

25oC) for 5 minutes. After that, the spin column was centrifuged at 6,500 xg for 1

minute. This elution step was repeated once again and the procedure was carried out

as described previously. Lastly, the genomic DNA was quantified as described in

Section 3.5.2.2 and stored at -20oC until required.

82

3.5.2.2 DNA quantification

The quantity and quality of the extracted DNA was determined by the

NanoPhotometer®

P-Class analysis using ultraviolet (UV) light. The DNA yields were

determined from the concentration of DNA in the eluate, measured by the absorbance

at 260 nm (A260) and the reading should be within 0.1 – 1.0. The purity was

determined by calculating the ratio of absorbance at 260 nm (A260) to absorbance at

280 nm (A280). Pure DNA has an A260/A280 ratio of 1.7 – 1.9. The A260/A230 ratio

is used as a secondary measure of nucleic purity. The values of the pure samples were

often higher than the respective A260/A280 ratio values. The A260/A230 ratio should

be greater than 1.5, ideally close to 1.8. Otherwise, it may indicate the presence of

contaminants with the absorbance at 230 nm (A230) (Qiagen, 2013).

3.5.2.3 Conventional Polymerase Chain Reaction (PCR) methodology

3.5.2.3.1 Buffers and solutions

3.5.2.3.1.1 Tank buffer and gel buffer

Fifty millilitres of 20X LB Conductive Medium (Faster Better Media, USA) buffer

was diluted in 950 ml distilled water to make up a 1 L of 1X LB Conductive Medium

buffer (working solution) for the tank buffer and gel buffer.

3.5.2.3.2 2% Agarose gel preparation

Two grams of agarose powder (Agarose Biotechnology Grade, Norgen Biotek,

Canada) was weighed and added to a clean Schott Bottle to which a 100 ml of 1X LB

83

Conductive Medium buffer (working solution) was added. The bottle was placed in

the microwave and the solution was heated until all of the agarose powder was

completely dissolved. The bottle was removed from the microwave and 4 µl of

GoodView Nucleic Acid Stain (SBS Genetech, China) was added to the agarose gel

and mixed well. This solution was then poured into the casting tray and was allowed

to polymerize at least 30 minutes prior to sample loading.

3.5.2.3.3 BAGene DNA-SSP Kits – Conventional PCR

A commercially available kit for conventional PCR method for the determination of

Rh types, KEL, Kidd and Duffy systems on a molecular genetic basis from the BAG

Health Care GmbH, Germany was used. This method was only performed on control

samples and then the results from this method were compared with the result from

SNP RT-PCR method. The control samples that used in both method (conventional

PCR and SNP RT-PCR) then were used as a negative and positive control for each

gene detected when SNP RT-PCR method was performed on the study subjects

samples.

The test procedure for conventional PCR was done by using the Sequence Specific

Primers (SSP)-PCR. 10/20 BAGene plates/strips which were sufficient for 10/20

typings. The strips contained the pre-aliquoted and dried reaction mixtures consisting

of allele specific primers, internal control primers (specific for the HGH gene (human

growth hormone) and chromosome I genomic sequence, 90.000 bp 5‟ of Rhesus Box

respectively) and nucleotides. 10X PCR buffer was also provided together with the

kit. Amplification parameters were optimized to a final volume of 10 µl.

84

The calculation of the master mix consisting of 10X PCR buffer, DNA solution, Taq

Polymerase and Aqua dest was done prior to the test. The composition of the master

mix depends on the number of reaction mixes as shown in Table 3.1.

Table 3.1: Composition of the master mix depending on the number of reaction

mixes

No.

of

mixes

Aqua

dest

(µl)

10X PCR

buffer

(µl)

DNA

solution.

(50-100

ng/µl)

(µl)

Taq

Polymerase

(5 U/µl)

(µl)

Total Volume,

approximately

(µl)

1 8 1 1 0.08 10

2 16 2 2 0.2 20

6 50 7 7 0.5 65

7 70 9 9 0.7 90

8 80 10 10 0.8 100

9 88 11 11 0.9 110

10 96 12 12 1.0 120

11 104 13 13 1.0 130

12 112 14 14 1.1 140

13 128 16 16 1.3 160

14 136 17 17 1.4 170

15 144 18 18 1.4 180

16 152 19 19 1.5 190 Source: BAGene DNA-SSP Kits, 2010

For the determination of Rh types, BAGene RH-TYPE (ref number: 6645) kit was

used and for the determination of KEL, Kidd and Duffy systems, BAGene KKD-

TYPE (ref number: 6650) kit was used. Both of these kits have different number of

mixes and the preparations of the master mix were followed based on Table 3.1.

3.5.2.3.4 PCR cycling program

The DNA template was amplified in a Mastercycler® epGradient S (Eppendorf,

Germany) and the program set up was shown in Table 3.2.

85

Table 3.2: PCR Cycling Program using BAGene DNA-SSP Kits

Program-Step Time Temperature No. of Cycles

First Denaturation 5 min 96oC 1 Cycle

Denaturation 10 sec 96oC 5 Cycles

Annealing+Extension 60 sec 70oC


Annealing 50 sec 65oC

Extension 45 sec 72oC


Annealing 50 sec 61oC

Extension 45 sec 72oC

Final Extension 5 min 72oC 1 Cycle Source: BAGene DNA-SSP Kits, 2010

3.5.2.3.5 Gel electrophoresis

The separation of the amplification products was performed by electrophoresis via a

(horizontal) agarose gel. Six microliters of the completed reaction mixture was mixed

with 1 µl of 6X Bromophenol Blue DNA Loading Dye (Norgen Biotek, Canada) and

then loaded in each slot of the gel. At the end of the gel slot, 6 µl of LowRanger

100bp DNA Ladder (100bp-2000bp) (Norgen Biotek, Canada) was loaded.

Electrophoretic separation was done at 10-12 V/cm (with 20 cm distance between the

electrodes approximately 200-240 V) for 40 minutes.

3.5.2.3.6 Documentation and interpretation of result

For documentation, the gel was viewed under gel documentation system (Alpha

Innotech). The exposure time and the aperture were adjusted until the bands were

drawn sharp and stand out against the dark background.

To interpret the results, the evaluation diagram which was provided together with the

BAGene DNA-SSP Kits, Bag Health Care was used. Only bands that have the correct

86

size in correlation to the DNA length standard was considered positive. The correct

sizes can be found in the worksheet and evaluation diagram (Appendix D). In all lanes

without the allele-specific amplification, the internal control has to be 434 bp in all

cases but at lane 2 for PCR reaction of RH-TYPE, the fragment length of the internal

control is 659 bp.

3.5.2.4 Single Nucleotide Polymorphisms Real Time – Polymerase Chain

Reaction (SNP RT-PCR) methodology

3.5.2.4.1 Selection of suitable assay for SNP RT-PCR methodology

The information of the genes of interest were searched through the gene database from

the National Center for Biotechnology Information (NCBI)

(http://www.ncbi.nlm.nih.gov/) before the suitable assay was selected (as shown in

Figure 3.3). The example shown was for KEL system.

87

Figure 3.3: Information searching from the NCBI website for selection of the

suitable assay

1) Front page of NCBI website

2) All of the information about the KEL system

1

2

88

3) Details about the gene of interest

4) Details about the SNP of the KEL system

3.5.2.4.2 TaqMan® SNP genotyping assay

The TaqMan® SNP genotyping assay was designed and optimized to work with

TaqMan®

Universal PCR Mastermix using the same thermal cycling conditions for

genotyping SNPs. The product used the 5‟ nuclease assay for amplifying and

detecting specific SNP alleles in purified genomic DNA samples. This assay contains

3

4

89

two components; sequence-specific forward and reverse primers to amplify the

polymorphic sequence of interest and two TaqMan® MGB probes, where one probe

was labelled with VIC® dye to detect the designated Allele 1 sequence, whilst another

probe was labelled with FAM™

dye to detect the designated Allele 2 sequence. All

assay primers/probes sets selected to detect the SNPs responsible for variant antigen

expression in this study were purchased either as predesigned or custom-designed

based on locus files submitted to Applied Biosystems® (Table 3.3). For the purpose of

this study, 4 Custom-Designed TaqMan®

SNP genotyping assays and 2 Pre-Designed

TaqMan®

SNP genotyping assays were used. The steps identifying which assay was

custom-designed or pre-designed types were shown in Figure 3.4.

Table 3.3: Specifics of selected genotyping assays

System

Name

Gene Antigen SNP rs# Base

Change

AA change

Rh RHCE

E/e 609320 676G>C P226A

C/c 45493401 307T>C S103P

676785 307T>C S103P

Kell KEL K/k 8176058 698C>T T193M

Kidd JK Jka/Jk

b 1058396 838G>A D280N

Duffy FY Fya/Fy

b 12075 125G>A G42D

90

Figure 3.4: Workflow of searching the assay type

1) Applied Biosytems website was opened and directly went to SNP Genotyping Analysis

TaqMan®

Assays page.

2) The page was scrolled down and the unique rs number was typed in the “Enter target

information box”.

1

2

91

3 (a): The rs number was not in the system; custom-designed assay.

3 (b): The rs number was in the system; pre-designed assay.

3.5.2.4.2.1 Custom TaqMan® SNP genotyping assay – RHCE and KEL blood

group antigens

The custom TaqMan® SNP genotyping assays is a part of the custom TaqMan

®

genomic assays service which is available when a product for a SNP of interest is not

found on the Applied Biosystems®

website. This assay development service that

3 (a)

3 (b)

92

designed, synthesized, formulated and delivered analytically quality-controlled primer

and probe sets for genotyping assays based on the sequence information that was

submitted to the Applied Biosystems® representative. Assays to SNPs, as well as to

detect insertions/deletions (in/dels) and multinucleotide polymorphisms (MNPs) up to

6 bases in length, for both human and nonhuman targets, can be designed. In this

study, 4 assays for the genotyping studies were designed:

Table 3.4: Assay for RHCc blood group antigens (1)

Assay Name rs45493401

Assay ID AHGJ8DN

Reporter 1 Dye VIC

Reporter 1 Quencher NFQ

Reporter 2 Dye FAM


Forward Primer Sequence CTGCTGGACGGCTTCCT

Reverse Primer Sequence CCCAATACCTGAACAGTGTGATGAC

Reporter 1 Sequence CCCAGGAGGGAACT

Reporter 2 Sequence TCCCAGAAGGGAACT

Table 3.5: Assay for RHCc blood group antigens (2)

Assay Name rs676785

Assay ID AHFA97F

Reporter 1 Dye VIC


Reporter 2 Dye FAM


Forward Primer Sequence CCCAATACCTGAACAGTGTGATGAC

Reverse Primer Sequence CTGCTGGACGGCTTCCT

Reporter 1 Sequence CTTCCCAGAAGGGAACT

Reporter 2 Sequence CCCAGGAGGGAACT

93

Table 3.6: Assay for RHEe blood group antigens

Assay Name RHCE676G_C

Assay ID AHBKEE7

SNP ID rs609320

Reporter 1 Dye VIC


Reporter 2 Dye FAM


Forward Primer Sequence GCATTCTTCCTTTGGATTGGACTTC

Reverse Primer Sequence GCCCTCTTCTTGTGGATGTTCTG

Reporter 1 Sequence TGTCAACTCTGCTCTGCT

Reporter 2 Sequence TGTCAACTCTCCTCTGCT

Table 3.7: Assay for KEL blood group antigens

Assay Name KEL698C_T

Assay ID AHCTCLF

SNP ID rs8176058

Reporter 1 Dye VIC


Reporter 2 Dye FAM


Forward Primer Sequence GCATCTCTGGTAAATGGACTTCCTT

Reverse Primer Sequence GGAAATGGCCATACTGACTCATCA

Reporter 1 Sequence AAGTCTCAGCGTTCGGT

Reporter 2 Sequence AGTCTCAGCATTCGGT

3.5.2.4.2.2 Pre-Designed TaqMan® SNP genotyping assay – Kidd and Duffy

blood group antigens

TaqMan®

Pre-Designed SNP genotyping assay has more than 3 million genome-wide

assays including assays to more than 2.5 million HapMan SNP, as well as ~ 30,000

high value nonsynonymous cSNPs (including known disease mutations and SNPs in

protein domains associated with drug binding regions). These made to order assays,

available in multiple scales, are manufactured and functionally tested upon ordering.

For this study, 2 Pre-Designed TaqMan® SNP genotyping assays were used.

94

Table 3.8: Assay for Kidd blood group antigens

Assay ID C___1727582_10

Gene Symbol SLC14A1

SNP ID rs1058396

Reporter 1 Dye VIC

Reporter 1

Quencher

NFQ

Reporter 2 Dye FAM

Reporter 2

Quencher

NFQ

Context Sequence ACTCAGTCTTTCAGCCCCATTTGAG[A/G]ACATCTACTT

TGGACTCTGGGGTTT

Gene of interest Kidd

Table 3.9: Assay for Duffy blood group antigens

Assay ID C___2493442_10

Gene Symbol DARC;LOC100131825;CADM3

SNP ID rs12075

Reporter 1 Dye VIC

Reporter 1

Quencher

NFQ

Reporter 2 Dye FAM

Reporter 2

Quencher

NFQ

Context Sequence GATTCCTTCCCAGATGGAGACTATG[A/G]TGCCAACCTG

GAAGCAGCTGCCCCC

Gene of interest Duffy

3.5.2.4.3 TaqMan® GTXpress

™ master mix

TaqMan®

GTXpress™

master mix is a ready to use master mix for the PCR using the

Applied Biosystems®

7500 Fast Real Time PCR Systems (Applied Biosystems®,

USA).

95

3.5.2.4.4 PCR reaction mix components

The PCR reaction consisted of; TaqMan® GTXpress

™ Master Mix (2X), TaqMan

®

Genotyping Assay Mix (20X), DNase-free water and sample. The calculation was

done prior to the test. The composition of the master mix depends on the number of

reaction mixes as shown in Table 3.10.

Table 3.10: PCR reaction mix components

PCR reaction mix components

Component Volume for 5-µL

PCR reaction

(µL/well)

Volume for 10-µL

PCR reaction

(µL/well)

Volume for 25-µL

PCR reaction

(µL/well)

TaqMan®

GTXpress™

Master

Mix (2X)

2.50 5.0 12.50

TaqMan®

genotyping assay

mix (20X)

0.25 0.5 1.25

DNase-free water 1.25 2.5 6.25

Sample 1.0 2.0 5.0

Total 5.0 10.0 25.0 Source: TaqMan

® Genotyping


In SNP RT-PCR, it only requires 1 to 10 ng of purified gDNA sample per well.

Therefore, a standardized purified gDNA was calculated before preparing the PCR

reaction mix.

3.5.2.4.5 PCR cycling program

The DNA template was amplified in the Applied Biosystems® 7500 Fast Real Time

PCR Systems and the program was set up as shown in Table 3.11.

96

Table 3.11: PCR Cycling Program for Applied Biosystems®

7500 Fast Real Time

PCR Systems

Stage Step Temp Time

Holding DNA Polymerase Activation 95oC 20 sec

Cycling

(40 cycles)

Denature 95oC 3 sec

Anneal/Extend 60oC 30 sec



3.5.2.4.6 Interpretation of results

After PCR amplification, an endpoint plate-read was performed using an Applied

Biosystems® Real-Time PCR System software v2.0.6. The Sequence Detection

System (SDS) Software uses the fluorescence measurements made during the plate

read to plot fluorescence (Rn) values based on the signals from each well. The plotted

fluorescence signals indicate which alleles were detected in each sample. The SDS

software recorded the results of the allelic discrimination run on a scatter plot of

Allele 1 versus Allele 2 (Figure 3.5).

97

Figure 3.5: Interpretation of the SNP result

The clusters in the allelic discrimination plot show the three genotypes of one SNP



3.5.2.4.7 Sequencing

The sequencing was done by outsourcing it to a selected company (1st BASE

Laboratories Sdn Bhd). Only selected samples were chosen for the sequencing service

which consists of:

i. Few samples from each assays (from the control group and study subjects) to

ensure the sequence of the assays is correct.

ii. Samples that have discrepancies results between blood and buccal swab

sample (if any).

Homozygous Allele 2

Heterozygous Allele 1/ Allele 2

Homozygous Allele 1

98

Due to the short base pair (bp) for each assay tested, cloning must be done before the

sequencing method and the reference clones were constructed by subcloning of the

RHCE, KEL, SLC14A1 and DARC fragments into pJET1.2/vector. Five positive

colonies were randomly picked for sequencing.

3.6 DATA COLLECTION

The data domains and related specific data that were collected in this study were

tabulated as shown in Table 3.12.

Table 3.12: Data domains that were collected in this study

A Demographic Gender, age, ethnic

B Type of thalassaemia and

its clinical severity

Thalassaemia major, Thalassaemia intermedia: E-

beta thalassaemia, HbH disease

C Transfusion history Frequency of transfusion, type of red cell product

transfused

D Serological investigations Red cell phenotype from pre-transfusion and post-

transfusion samples, Direct Coombs Test (DCT)

result and antibody screening result.

E Red cell profile ABO group, RH status, KEL group, Kidd group,

Duffy group

F Red cell genotype Pre-transfusion and post-transfusion samples from

peripheral blood and buccal swab

3.7 DATA ANALYSIS

Analyses of the data from the study subjects‟ samples were performed. TaqMan®

Genotyper Software v1.0.1 was used to analyse the raw data from the genotyping

experiments which were created using the Applied Biosystems® Real-Time PCR

system. This software gives more accurate, efficient and comprehensive

99

understanding of the results. The results were viewed as individual data points for

each reaction on the Cartesian plot representing the signal intensity of the fluorescent

VIC® reporter (Allele 1) versus signal intensity of the fluorescent FAM

™ reporter

(Allele 2). Genotype calls were determined by interpretation of the ratio of VIC®

signal to FAM™

signal for each system. Reaction clusters obtained at the x/y axis that

do not contain the template of DNA were used as negative controls for the experiment

The statistical analysis was performed using the IBM Statistical Package for the Social

Science (SPSS) software version 20.0. Demographic data was summarized and

tabulated. The continuous variables were summarized by descriptive statistics, which

included the sample size and mean. Discrete variables were summarized by

frequencies and percentages illustrated in contingency tables.

Cross tabulation tables were employed to compare the result of red cell phenotype by

serological methods with PCR genotype on peripheral blood samples and also to

compare the result of red cell genotype by PCR on peripheral whole blood with buccal

swabs.

100

CHAPTER IV

FINDINGS

4.1 RESULTS FOR STUDY SUBJECTS

4.1.1 Demographic data

A cross-sectional comparative study was conducted at Faculty of Medicine and Health

Sciences Universiti Sains Islam Malaysia (USIM), Hospital Ampang and Universiti

Kebangsaan Malaysia Medical Centre (UKMMC) over a two-year period from

September 2013 until August 2015. Complete data was available in 33 multiply-

transfused thalassaemia patients. The study population consisted of 12 males (36.4%)

and 21 females (63.6%). Twenty-three patients (69.7%) were Malays and 10 (30.3%)

were Chinese. There were no patients from other ethnic groups (Figure 4.1). In this

study, 15 (45.5%) were thalassaemia β-intermedia patients. Fourteen (42.4%) had

thalassemia β-major and four (12.1%) had Hb H disease (Table 4.1).

101

Figure 4.1: Distribution of the study subjects according to gender and race

Table 4.1: Types of thalassaemia according to race

Malay Chinese Total

Thalassaemia β-

Major

8

8

14

Thalassaemia β-

Intermedia

14 1 15

Hb H Disease 3 1 4

Total 23 10 33

4.1.2 Frequency of ABO, RHD blood group, antibody screening and

Direct Coombs Test.

Blood grouping was performed by antigen antibody agglutination test using

commercial monoclonal antisera. The distribution of ABO phenotypes in the total

samples were 8 (24.2%), 8 (24.2%), 2 (6.1%), 15 (45.5%) for groups A, B, AB and O,

0

5

10

15

20

25

Male Female

7

16 5

5

Chinese

Malay

102

respectively (Figure 4.2). All patients were Rhesus positive. The phenotypic

frequencies of blood group in ABO and Rhesus system according to gender is shown

in Table 4.2. Antibody screening for unexpected antibodies showed 24.2% positive.

The DCT results are as shown in Table 4.3.

Figure 4.2: Phenotypic frequencies of blood group in ABO and Rhesus system

Table 4.2: Phenotypic frequencies of blood group in ABO and Rhesus system

according to gender

Gender

Phenotype

Total A Rh D

Positive

B Rh D

Positive

AB Rh D

Positive

O Rh D

Positive

Male

2

4

0

6

12

Female 6 4 2 9 21

Total

8

8

2

15

33

8

8

2

15 A Rh D Positive

B Rh D Positive

AB Rh D Positive

O Rh D Positive

103

Table 4.3: Antibody screening and DCT results

Result Antibody

screening

DCT (pre-transfusion,

D0)

DCT (post-transfusion,

D7)

AHG IgG C3d AHG IgG C3d

Positive

(%)

8

(24.2)

10

(30.3)

6

(18.2)

3

(9.1)

10

(30.3)

4

(12.1)

2

(6.1)

Negative

(%)

25

(75.8)

23

(69.7)

27

(81.8)

30

(90.9)

23

(69.7)

29

(87.9)

31

(93.9)

4.1.3 Frequency of transfusion and types of red blood cell product

transfused

Eleven patients received a blood transfusion as frequent as every 4 weekly intervals,

shown in Table 4.4. Thirteen of thalassaemia β-major patients received 2 to 4 weekly

blood transfusions and only one patient required 6 to 8 weekly blood transfusions.

Eight of thalassaemia β-intermedia patients required 2 to 4 weekly blood transfusions,

five received 6 to 8 weekly blood transfusion and two required 12 weekly blood

transfusions. Only three of the Hb H disease patients received 6 to 8 weekly blood

transfusions and one patient required 12 weekly blood transfusions (Figure 4.3).

There are three types of red blood cell products that patients received during

transfusion; Filtered Red Blood Cells (FRBC), Packed Red Blood Cells (PC) and

Buffy-coat Poor Packed Cells (BCPPC) as shown in Figure 4.4. Twenty-eight patients

received FRBC products.

104

Table 4.4: Frequency of transfusion

Frequency of transfusion Number of patients

2 weekly 4

4 weekly 17

6 weekly 3

8 weekly 6

12 weekly 3

Figure 4.3: Frequency of transfusion based on types of thalassaemia

13

8

1

5

3

2

1

0

2

4

6

8

10

12

14

Thal β- Major Thal β- Intermedia Hb H disease

2-4 weekly

6-8 weekly

12 weekly

105

Figure 4.4: Types of red blood cell product received during transfusion

Data shown were obtained during this study period only. The types of red cell product received by

patients may be different from the previous transfusion.

4.1.4 Red cell phenotype using peripheral blood: pre- and post-

transfusion samples

The phenotype frequencies determined serologically for RH, KEL, Kidd and Duffy

are shown in Table 4.5. The most frequent phenotype of the RH system determined on

pre-transfusion blood samples were Rh C+c- (45.5%) and Rh E-e+ (57.6%). For Kidd

system, the most frequent phenotype was Jk(a+b+) (27.3%) and for Duffy system was

Fy(a+b+) (39.4%). There were 9, 8, 18 and 16 samples that could not be interpreted

due to mixed field reactions in the Rh C/c, Rh E/e, Kidd and Duffy system,

respectively.

On day 7 post-transfusion peripheral blood samples, Rh C+c- (45.5%) and Rh E-e+

(57.6%) were detected as the most frequent phenotype in the RH system. Jk(a+b+)

(36.4%) and Fy(a+b+) (21.2%) were also the most frequent phenotype in the Kidd and

28

1 4

FRBC

PC

BCPPC

106

Duffy system, respectively. There were 9, 9, 17 and 23 samples that could not be

interpreted in the Rh C/c, Rh E/e, Kidd and Duffy system, respectively.

For KEL system, in pre- and post-transfusion samples, it shows 100% of the

phenotype is K-k+ and no undetermined samples were detected.

107

Table 4.5: Blood group phenotype frequencies on pre- and post-transfusion using

peripheral blood samples

Pre-

transfusion

Patients (N = 33) Post-

transfusion

Patients (N = 33)

Frequency n Frequency n

Rh system

Rh C+c- 45.5 15 Rh C+c- 45.5 15

Rh C+c+ 27.3 9 Rh C+c+ 27.3 9

Rh C-c+ 0 0 Rh C-c+ 0 0

Undetermined 27.3 9 Undetermined 27.3 9

Rh E+e- 0 0 Rh E+e- 0 0

Rh E+e+ 18.2 6 Rh E+e+ 15.2 5

Rh E-e+ 57.6 19 Rh E-e+ 57.6 19


Kidd system

Jk(a+b-) 12.1 4 Jk(a+b-) 6.1 2

Jk(a+b+) 27.3 9 Jk(a+b+) 36.4 12

Jk(a-b+) 6.1 2 Jk(a-b+) 6.1 2


Duffy system

Fy(a+b-) 12.1 4 Fy(a+b-) 9.1 3

Fy(a+b+) 39.4 13 Fy(a+b+) 21.2 7

Fy(a-b+) 0 0 Fy(a-b+) 0 0


KEL system

K+k- 0 0 K+k- 0 0

K+k+ 0 0 K+k+ 0 0

K-k+ 100 33 K-k+ 100 33

Undetermined 0 0 Undetermined 0 0 N, number of individuals; n, number of alleles

4.1.5 Blood group genotype by SNP RT-PCR using peripheral blood:

pre- and post-transfusion samples

Genotypic frequencies results for pre- and post-transfusion using peripheral blood

samples are shown in Table 4.6. The most frequent genotype of the RH system were

RHCE*CC (66.7%) and RHCE*ee (81.8%), the Kidd system was JK*A/JK*B

108

(45.5%) and the Duffy system was FY*A/FY*A (75.8%). The genotype of the KEL

system was KEL*2/KEL*2 (100%). All of the patients‟ samples of red blood cell

blood group genotype both on the pre- or post- transfusion samples were able to be

determined. The results are concordant between the two samplings.

Table 4.6: Blood group genotype frequencies on pre- and post-transfusion of

peripheral blood samples by using SNP RT-PCR method

Pre-

transfusion

Patients (N = 33) Post-

transfusion

Patients (N = 33)


Rh system

RHCE*CC 66.7 22 RHCE*CC 66.7 22

RHCE*Cc 33.3 11 RHCE*Cc 33.3 11

RHCE*cc 0 0 RHCE*cc 0 0

Undetermined 0 0 Undetermined 0 0

RHCE*EE 0 0 RHCE*EE 0 0

RHCE*Ee 18.2 6 RHCE*Ee 18.2 6

RHCE*ee 81.8 27 RHCE*ee 81.8 27


Kidd system

JK*A/JK*A 30.3 10 JK*A/JK*A 30.3 10

JK*A/JK*B 45.5 15 JK*A/JK*B 45.5 15

JK*B/JK*B 24.2 8 JK*B/JK*B 24.2 8


Duffy system

FY*A/FY*A 75.8 25 FY*A/FY*A 75.8 25

FY*A/FY*B 21.2 7 FY*A/FY*B 21.2 7

FY*B/FY*B 3.0 1 FY*B/FY*B 3.0 1


KEL system

KEL*1/KEL*1 0 0 KEL*1/KEL*1 0 0

KEL*1/KEL*2 0 0 KEL*1/KEL*2 0 0

KEL*2/KEL*2 100 33 KEL*2/KEL*2 100 33


109

4.1.6 Blood group genotype by SNP RT-PCR using peripheral blood and

buccal swab: pre-transfusion sampling

We collected samples from peripheral blood and buccal swabs at D0 or pre-

transfusion. DNA was extracted and the blood group genotype was determined using

SNP RT-PCR. Genotypic frequencies for pre-transfusion using peripheral blood and

buccal swab samples are as shown in Table 4.7. The most frequent genotype of the

RH system were RHCE*CC (66.7%) and RHCE*ee (81.8%), the Kidd system was

JK*A/JK*B (45.5%), the Duffy system was FY*A/FY*A (75.8%) and the KEL

system was KEL*2/KEL*2 (100%) for both types of samples. The results for both

sampling methods are concordant.

110

Table 4.7: Blood group genotype frequencies which were determined on

peripheral blood and buccal swab pre-transfusion samples (D0) by

using SNP RT-PCR

Blood samples Patients (N = 33) Buccal swab

samples

Patients (N = 33)


Rh system

RHCE*CC 66.7 22 RHCE*CC 66.7 22

RHCE*Cc 33.3 11 RHCE*Cc 33.3 11

RHCE*cc 0 0 RHCE*cc 0 0




RHCE*ee 81.8 27 RHCE*ee 81.8 27


Kidd system

JK*A/JK*A 30.3 10 JK*A/JK*A 30.3 10

JK*A/JK*B 45.5 15 JK*A/JK*B 45.5 15

JK*B/JK*B 24.2 8 JK*B/JK*B 24.2 8


Duffy system

FY*A/FY*A 75.8 25 FY*A/FY*A 75.8 25

FY*A/FY*B 21.2 7 FY*A/FY*B 21.2 7

FY*B/FY*B 3.0 1 FY*B/FY*B 3.0 1


KEL system

KEL*1/KEL*1 0 0 KEL*1/KEL*1 0 0

KEL*1/KEL*2 0 0 KEL*1/KEL*2 0 0

KEL*2/KEL*2 100 33 KEL*2/KEL*2 100 33


111

4.1.7 Phenotype-genotype frequencies detected on pre-transfusion


The blood group phenotype frequencies determined serologically on pre-transfusion

peripheral blood samples are shown in Table 4.5. There were a few samples that could

not be interpreted in each blood group system serologically.

DNA patients were tested using SNP RT-PCR. All of the patients‟ samples blood

group genotypes were able to be determined (Table 4.8). RHCE*CC (66.7%) and

RHCE*ee (81.8%) were the most frequent genotype in the RH system. JK*A/JK*B

(45.5%) and FY*A/FY*A (75.8%) were the most frequent genotype in their own

system, respectively. The frequencies were discordant in most but all undetermined

phenotypes by serology were resolved.

For KEL blood group system, the phenotype and genotype frequency was concordant;

KEL*2/KEL*2 (100%).

112

Table 4.8: Phenotype-genotype frequencies for pre-transfusion peripheral blood

samples

Phenotype Patients (N = 33)

Genotype Patients (N = 33)


Rh system

Rh C+c- 45.5 15 RHCE*CC 66.7 22

Rh C+c+ 27.3 9 RHCE*Cc 33.3 11

Rh C-c+ 0 0 RHCE*cc 0 0

Undetermined 27.3 9 Undetermined 0 0

Rh E+e- 0 0 RHCE*EE 0 0

Rh E+e+ 18.2 6 RHCE*Ee 18.2 6

Rh E-e+ 57.6 19 RHCE*ee 81.8 27


Kidd system

Jk(a+b-) 12.1 4 JK*A/JK*A 30.3 10

Jk(a+b+) 27.3 9 JK*A/JK*B 45.5 15

Jk(a-b+) 6.1 2 JK*B/JK*B 24.2 8


Duffy system

Fy(a+b-) 12.1 4 FY*A/FY*A 75.8 25

Fy(a+b+) 39.4 13 FY*A/FY*B 21.2 7

Fy(a-b+) 0 0 FY*B/FY*B 3.0 1


KEL system

K+k- 0 0 KEL*1/KEL*1 0 0

K+k+ 0 0 KEL*1/KEL*2 0 0

K-k+ 100 33 KEL*2/KEL*2 100 33


4.1.8 Phenotype-genotype frequencies detected on post-transfusion


The blood group phenotype frequencies determined serologically on post-transfusion

peripheral blood samples are shown in Table 4.5. The phenotype-genotype

frequencies for post-transfusion peripheral blood are shown in Table 4.9. The

113

frequency of undetermined serological phenotype was much higher on post-

transfusion.

All of the samples‟ genotypes were able to be determined by using SNP RT-PCR.

RHCE*CC (66.7%) and RHCE*ee (81.8%) was the highest frequent genotype in RH

system. JK*A/JK*B (45.5%) and FY*A/FY*A (75.8%) was the highest frequent

genotype in Kidd and Duffy system, respectively. All undetermined serological

phenotypes were resolved.

Similar to the pre-transfusion samples, the phenotype-genotype frequency for KEL

system also showed concordant results; KEL*2/KEL*2 (100%).

114

Table 4.9: Phenotype-genotype frequencies for post-transfusion peripheral blood

samples

Phenotype Patients (N = 33)

Genotype Patients (N = 33)


Rh system

Rh C+c- 45.5 15 RHCE*CC 66.7 22

Rh C+c+ 27.3 9 RHCE*Cc 33.3 11

Rh C-c+ 0 0 RHCE*cc 0 0



Rh E+e+ 15.2 5 RHCE*Ee 18.2 6

Rh E-e+ 57.6 19 RHCE*ee 81.8 27


Kidd system

Jk(a+b-) 6.1 2 JK*A/JK*A 30.3 10

Jk(a+b+) 36.4 12 JK*A/JK*B 45.5 15

Jk(a-b+) 6.1 2 JK*B/JK*B 24.2 8


Duffy system

Fy(a+b-) 9.1 3 FY*A/FY*A 75.8 25

Fy(a+b+) 21.2 7 FY*A/FY*B 21.2 7

Fy(a-b+) 0 0 FY*B/FY*B 3.0 1


KEL system

K+k- 0 0 KEL*1/KEL*1 0 0

K+k+ 0 0 KEL*1/KEL*2 0 0

K-k+ 100 33 KEL*2/KEL*2 100 33


4.1.9 Correlation of blood group genotype results between peripheral

blood and buccal swab samples: pre-transfusion sampling

There were full agreement of the genotype results between peripheral blood and

buccal swab samples in all the selected blood group systems tested (Table 4.10).

115

Table 4.10: Genotype result between pre-transfusion peripheral blood and buccal

swab samples

Blood Samples Buccal Swab Samples

Rh System

CCee

CcEe

Ccee

CCee 22

CcEe 6

Ccee 5

CcEE

Kidd System JK*A/JK*B JK*A/JK*A JK*B/JK*B

JK*A/JK*B 15

JK*A/JK*A 10

JK*B/JK*B 8

Duffy System FY*A/FY*B FY*A/FY*A FY*B/FY*B

FY*A/FY*B 7

FY*A/FY*A 25

FY*B/FY*B 1

KEL System KEL*1/KEL*1 KEL*1/KEL*2 KEL*2/KEL*2

KEL*2/KEL*2 33

4.1.10 Correlation between phenotype and genotype results

Correlation between phenotype and genotype was done in only peripheral blood

samples as the genotypic result for buccal swab samples are concordant with the

genotypic result from peripheral blood samples (as shown in Table 4.10).

4.1.10.1 Phenotype-genotype discrepancies of pre-transfusion sampling

Duffy blood group system showed the highest number of discrepancies between the

red cell phenotype determined serologically with the genotype determined by

molecular technique (SNP RT-PCR). Twenty-five cases were discordant (Table 4.11).

116

The main discrepancy was found in FY*A/FY*A when serologically showed

Fy(a+b+) and undetermined result (mixed field).

Twenty-two patients were found to have discrepancies between the serological

phenotype and genotype in the RH blood group system. Agreement between

phenotype and genotype was observed for RH blood group system in 18 patients.

Thirteen patients are CCee, 3 patients are CcEe and 2 patients are Ccee.

The Kidd blood group system showed 23 discrepancies between the two methods

used.

There were no discrepancy results in KEL blood group system.

117


SNP RT-PCR method for pre-transfusion peripheral blood samples

Serological

Phenotype

Genotype by SNP RT-PCR

Rh System

CCee

CcEe

Ccee

CCee 13 1

CcEe 2 3 1

Ccee 2

Undetermined 7 6 5


Jk (a+b+) 6 1 2

Jk (a+b-) 1 3

Jk(a-b+) 1 1

Undetermined 7 6 5


Fy(a+b+) 4 8 1

Fy(a+b-) 4

Undetermined 3 13


K-k+ 33 The shaded cells indicate the discrepant cases between phenotype by serology and genotype by SNP

RT-PCR. All results outside of the shaded cells represent concordances.

4.1.10.2 Phenotype-genotype discrepancies of post-transfusion sampling

Duffy blood group system also showed the highest number of discrepancies result

between the phenotype and genotype in post-transfusion peripheral blood samples.

Twenty-eight cases were discordant (Table 4.12). The main discrepancy was found in

FY*A/FY*A when four cases showed Fy(a+b+) and 18 cases could not be determined

by haemagglutination technique. Agreement between phenotype and genotype was

observed in 5 cases only; 2 were FY*A/FY*B and 3 were FY*A/FY*A.

118

Fourteen patients were found to have discrepancies between the phenotype and

genotype result in RH blood group system. Nineteen cases have concordant results; 14

are CCee, 3 are CcEe and 2 are Ccee.

There were 24 discrepancies cases in Kidd system. The main discrepancy was found

in JK*A/JK*B when serologically showed Jk(a-b+) (1 case) and undetermined (8

cases). Agreement between phenotype and genotype was observed in 9 patients only.

Six patients were JK*A/JK*B, 2 patients were JK*A/JK*A and 1 patient was

JK*B/JK*B.

There were no discrepant cases in the KEL system.

119


SNP RT-PCR method for post-transfusion peripheral blood samples

Serological

Phenotype

Genotype by SNP RT-PCR

Rh System

CCee

CcEe

Ccee

CCee 14 1

CcEe 1 3 1

Ccee 1 2

Undetermined 6 2 2


Jk (a+b+) 6 2 4

Jk (a+b-) 2

Jk(a-b+) 1 1

Undetermined 8 6 3


Fy(a+b+) 2 4 1

Fy(a+b-) 3

Undetermined 5 18


K-k+ 33 The shaded cells indicate the discrepant cases between phenotype by serology and genotype by SNP

RT-PCR. All results outside of the shaded cells represent concordances.

4.1.11 Prevalence of donor leukocyte contamination in post-transfusion


No discrepancy was recorded in blood genotype of pre- and post-transfusion

peripheral blood samples‟ results (as shown in Table 4.13). The frequency of each

antigen between pre- and post-transfusion results also showed full concordance (as

shown in Table 4.6).

120

Table 4.13: Blood genotype result of pre- and post-transfusion peripheral blood

samples

Genotype of pre-

transfusion samples

Genotype of post-transfusion samples

Rh System

CCee

CcEe

Ccee

CCee 22

CcEe 6

Ccee 5


JK*A/JK*B 15

JK*A/JK*A 10

JK*B/JK*B 8


FY*A/FY*B 7

FY*A/FY*A 25

FY*B/FY*B 1


KEL*2/KEL*2 33

4.1.12 Comparison of DNA yields and purity between buccal swab and


DNA yields and purity from buccal swab and peripheral blood samples are shown in

Table 4.14. Mean DNA concentration from buccal swab samples were lower than

peripheral blood samples (in both pre- and post-transfusion peripheral blood samples).

Mean DNA concentration from buccal swab samples were 14.14 ng/µl while mean

DNA concentration from pre- and post-transfusion blood samples were 338.08 ng/µl

and 275.11 ng/µl, respectively.

121

For measurement of DNA purity, the mean A260/A280 ratio between all of the three

types of samples were almost similar; 1.81 for buccal swab and 1.79 for pre- and post-

transfusion peripheral blood samples.

Table 4.14: Comparison of DNA yields and purity according to different types of

samples

Types of samples Buccal swab

Peripheral Blood

Pre-transfusion

samples

Post-transfusion

samples

Number of

samples

33 33 33

Amount of sample

used

2 swabs 200 µl 200 µl

Mean DNA

concentration

(ng/µl; range)

14.14 (4.5 – 46.5) 338.08 (23 – 1015) 275.11 (62.5 – 721)

Mean A260/A280

ratio (range)

1.81 (1.70 – 2.25) 1.79 (1.70 – 1.85) 1.79 (1.71 – 1.84)

4.2 RESULTS FOR CONTROL GROUP

4.2.1 Demographic data

Seventeen samples were obtained voluntarily from USIM postgraduate students and

staffs as normal healthy controls for the study. The control group was chosen for the

optimization of the SNP RT-PCR platform. The control group consisted of 4 males

122

(23.5%) and 13 females (76.5%). Sixteen (94.1%) were Malays and only 1 (5.9%) was

Indian (Figure 4.5).

Figure 4.5: Distribution of the control groups according to gender and race

4.2.2 PCR results

Results from conventional PCR using BAGene DNA SSP-Kits were compared with

the results from SNP RT-PCR.

4.2.2.1 Conventional results

The conventional PCR results are shown in Figure 4.6. We identified the patterns of

the genotypes and the figures shown below are the examples (according to the kit

package insert, APPENDIX D).

0

2

4

6

8

10

12

14

Male Female

4

12

1

Indian

Malay

123

Figure 4.6: Conventional result by BAGene DNA SSP-Kits

Genotype: KEL*2/KEL*2; JK*A/JK*B; FY*A/FY*B

Genotype: KEL*2/KEL*2; JK*A/JK*A; FY*B/FY*B

124

Genotype: KEL*2/KEL*2; JK*B/JK*B; FY*A/FY*A

Genotype: KEL*2/KEL*2; JK*A/JK*B; FY*B/FY*B

125

Genotype: KEL*2/KEL*2; JK*A/JK*A; FY*A/FY*B

Genotype: Rh D Positive; CCee

126

Genotype: Rh D Positive; CcEe

Genotype: Rh D Positive; ccEe

127

Genotype: Rh D Positive; Ccee

4.2.2.2 SNP RT-PCR results

The samples were tested with the SNP RT-PCR platform after the conventional PCR

was performed and the blood group genotypes were determined. The results that are

shown in the SNP RT-PCR are in an allelic discrimination plot. The red colour plot

represents the homogenous (homozygous) for Allele 1, the blue colour plot represents

the homogenous (homozygous) for Allele 2 and the green colour plot represents the

heterogeneous (heterozygous) of Allele 1 and Allele 2 (Figure 4.7). List of the Allele

1 and Allele 2 for RH E/e, Kidd and Duffy system are stated in Table 4.15.

128

Figure 4.7: SNP RT-PCR allelic plot results

Table 4.15: List of Allele 1 and Allele 2 for RH E/e, Kidd, Duffy and KEL blood

group system

Blood system SNP rs# Allele 1 Allele 2

RH E/e 609320 RH e RH E

Kidd 1058396 Jk b Jk a

Duffy 12075 Fy b Fy a

KEL 8176058 Cellano (k) Kell (K)

4.2.2.2.1 Results for RH C/c blood group system by using different assay

names and IDs

For RH C/c blood group systems, two primers with different assay names and assay

IDs were used. The results for both assays were found to be concordant (Figure 4.8 &

Figure 4.9). List of the Allele 1 and Allele 2 for RH C/c system is stated in Table 4.16.

129

Figure 4.8: SNP RT-PCR allelic plot results for RH C/c (rs45493401)

14 samples were homozygous Allele 2, 9 samples were heterozygous Allele 1/ Allele 2 and 1 sample

was homozygous Allele 1

Figure 4.9: SNP RT-PCR allelic plot results for RH C/c (rs676785)

1 sample was homozygous Allele 2, 9 samples were heterozygous Allele 1/ Allele 2 and 14 samples

were Allele 1

Homozygous Allele 2


Homozygous Allele 1

Homozygous Allele 2


Homozygous Allele 1

130

Table 4.16: List of Allele 1 and Allele 2 for RH C/c blood group system

Blood system SNP rs# Allele 1 Allele 2

RH C/c 45493401 RH c RH C

676785 RH C RH c

4.2.2.2.2 Sequencing results

Due to the short base pair (bp) for each assay tested, cloning have been done before

the sequencing method and the reference clones were constructed by subcloning of the

RHCE, KEL, SLC14A1 and DARC fragments into pJET1.2/vector. Five positive

colonies were randomly picked for sequencing. Figure 4.10 show the construct map

for the cloning process and Figure 4.11 are the detailed sequence of the whole

construct. List of the blood group results based on the SNP sequences are stated in

Table 4.17.

Figure 4.10: Construct map for the cloning process

131

Figure 4.11: Detailed sequence of the whole construct

Primers sequences are highlighted in yellow and green colour indicate the positive colonies where they

were inserted.

132

Table 4.17: List of the blood group results based on the SNP sequences

Gene SNP rs# SNP sequences

RH E/e 609320 CTTTGGATTGGACTTCTCAGCAGAG[C/G]AGAGTTGA

CACTTGGCCAGAACATC

C = RH E (Allele 2)

G = RH e (Allele 1)

RH C/c 45493401 GGACGGCTTCCTGAGCCAGTTCCCT[C/T]CTGGGAAG

GTGGTCATCACACTGTT

C = RH C (Allele 2)

T = RH c (Allele 1)

676785 AACAGTGTGATGACCACCTTCCCAG[A/G]AGGGAACT

GGCTCAGGAAGCCGTCC

A = RH c (Allele 2)

G = RH C (Allele 1)

KEL 8176058 TGGACTTCCTTAAACTTTAACCGAA[A/C/G/T]GCTGAG

ACTTCTGATGAGTCAGTAT

A/T = K (Kell) (Allele 2)

C/G = k (cellano) (Allele 1)

Kidd 1058396 ACTCAGTCTTTCAGCCCCATTTGAG[A/G]ACATCTACT

TTGGACTCTGGGGTTT

A = Jk b (Allele 1)

G = Jk a (Allele 2)

Duffy 12075 GATTCCTTCCCAGATGGAGACTATG[A/G]TGCCAACCT

GGAAGCAGCTGCCCCC

A = Fy b (Allele 1)

G = Fy a (Allele 2)

133

4.2.3 Phenotype-genotype frequencies using peripheral blood samples

There was full agreement between phenotype determined serologically and genotype

by both conventional PCR and SNP RT-PCR method using peripheral blood samples

in the control group (Table 4.18).

Table 4.18: Phenotype-genotype frequencies using peripheral blood samples

Phenotype Control (N = 17)

Genotype Control (N = 17)

Frequency n Frequency N

Rh system

Rh C+c- 47.1 8 RHCE*CC 47.1 8

Rh C+c+ 47.1 8 RHCE*Cc 47.1 8

Rh C-c+ 5.9 1 RHCE*cc 5.9 1


Rh E+e+ 23.5 4 RHCE*Ee 23.5 4

Rh E-e+ 76.5 13 RHCE*ee 76.5 13

Kidd system

Jk(a+b-) 35.3 6 JK*A/JK*A 35.3 6

Jk(a+b+) 41.2 7 JK*A/JK*B 41.2 7

Jk(a-b+) 23.5 4 JK*B/JK*B 23.5 4

Duffy system

Fy(a+b-) 64.7 11 FY*A/FY*A 64.7 11

Fy(a+b+) 23.5 4 FY*A/FY*B 23.5 4

Fy(a-b+) 11.8 2 FY*B/FY*B 11.8 2

KEL system

K+k- 0 0 KEL*1/KEL*1 0 0

K+k+ 0 0 KEL*1/KEL*2 0 0

K-k+ 100 17 KEL*2/KEL*2 100 17 Genotype results shown here represented for both types of PCR method (conventional PCR and SNP

RT-PCR)

134

4.2.4 Blood group genotype frequencies between peripheral blood and

buccal swab samples by conventional PCR and SNP RT-PCR

There is also full agreement of genotype results between peripheral blood and buccal

swab samples using both types of PCR method (conventional PCR and SNP RT-PCR)

(Table 4.19). The most frequent genotype in RH system were RHCE*CC (47.1%) and

RHCE*Cc (47.1%) and RHCE*ee (76.5%). JK*A/JK*B (41.2%), FY*A/FY*A

(64.7%) and KEL*2/KEL*2 (100%) were the most frequent genotype in Kidd, Duffy

and KEL system, respectively.

135

Table 4.19: Genotype frequencies between peripheral blood and buccal swab

samples

Peripheral

Blood

samples

Control (N = 17) Buccal swab

samples

Control (N = 17)


Rh system

RHCE*CC 47.1 8 RHCE*CC 47.1 8

RHCE*Cc 47.1 8 RHCE*Cc 47.1 8

RHCE*cc 5.9 1 RHCE*cc 5.9 1



RHCE*ee 76.5 13 RHCE*ee 76.5 13

Kidd system

JK*A/JK*A 35.3 6 JK*A/JK*A 35.3 6

JK*A/JK*B 41.2 7 JK*A/JK*B 41.2 7

JK*B/JK*B 23.5 4 JK*B/JK*B 23.5 4

Duffy system

FY*A/FY*A 64.7 11 FY*A/FY*A 64.7 11

FY*A/FY*B 23.5 4 FY*A/FY*B 23.5 4

FY*B/FY*B 11.8 2 FY*B/FY*B 11.8 2

KEL system

KEL*1/KEL*1 0 0 KEL*1/KEL*1 0 0

KEL*1/KEL*2 0 0 KEL*1/KEL*2 0 0

KEL*2/KEL*2 100 17 KEL*2/KEL*2 100 17 Genotype results shown here represented for both types of PCR method (conventional PCR and SNP

RT-PCR)

4.2.5 Comparison of DNA yields and quality between buccal swab and


DNA yields and purity from buccal swab and peripheral blood samples are shown in

Table 4.20. Mean DNA concentration from buccal swab samples were lower than

mean DNA concentration from blood samples. Mean DNA concentration from buccal

swab samples were 24.26 ng/µl while for peripheral blood samples were 109.41 ng/µl.

136

For measurement of DNA purity, the mean A260/A280 ratio in both types of samples

were almost similar; 1.84 for buccal swab and 1.81 for peripheral blood samples.

Table 4.20: Comparison of DNA yields and quality between buccal swab and


Types of samples Buccal swab Peripheral Blood

Number of samples

17

17

Amount of sample used 2 swabs 200 µl

Mean DNA

concentration (ng/µl;

range)

24.26 (5.0 – 73) 109.41 (26.5 – 241)

Mean A260/A280 ratio

(range)

1.84 (1.70 – 2.13) 1.81 (1.73 – 1.91)

137

CHAPTER V

ANALYSIS AND DISCUSSIONS

5.1 INTRODUCTION

Serological tests are widely utilized in many blood banks and transfusion laboratories

to evaluate the presence of the major blood antigens, which are the A, B, AB, O and

the RhD antigens. These tests are routinely performed to avoid any unwanted side

effects, notably haemolytic transfusion reactions that may occur during or even after

the commencement of a blood transfusion. Nowadays, there are 35 known minor

blood groups with more than 300 different blood antigens identified (Transfusion,

2015). For a patient who receives only one or two transfusions during their lifetime,

mismatches for the minor blood antigens do not pose a problem. However, patients

that require regular or frequent blood transfusions especially those with red cell

disorders such as patients with red cell membrane disorders; such as hereditary

spherocytosis, southeast asian ovalostomatocytosis, globin chain disorders; such as

thalassaemia, sickle cell disease and other haemoglobinopathies, and patients with

enzymopathies; such as Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency,

their body can develop strong and sometimes even fatal immune responses. In some

cases, acute or delayed haemolytic reaction may occur. The Public Health Agency of

Canada has estimated that as many as 1 in 12,000 transfusions end in an acute

reaction, with as many as 1 in 600, 000 ending in death. Delayed reactions occur in as

138

many as 1 in 5000 transfusion, even though less often fatal, it causes considerable

morbidity. Nevertheless, for many different reasons, including the

continual increase in reagent costs, unreliable serological results and lack of tests for

some antigens, the detection of minor blood antigens is not routinely performed either

on blood donors (Quill, 2008; Mograin, 2009) or on patients too. This problem is also

a major concern in most blood banks and transfusion laboratories in Malaysia due to

inability to provide the extended red cell blood group antigen phenotype to the

patients especially for those that require multiple transfusions. Accurate blood

phenotype assessment is also very difficult to implement for this group of patients due

to the presence of donor‟s blood cells in their blood circulation from previous

transfusions unless the red cell phenotyping is performed at diagnosis or prior to the

first transfusion. Unfortunately most of the hospital‟s blood banks in Malaysia are

unable to provide extended blood phenotype profile especially for the clinically

significant blood group antigens; RhCcEe, KEL, Kidd and Duffy.

After the discovery of the molecular basis of the ABO blood group by Yamamoto et

al., (1990), many researchers have shown their interest in identifying the other minor

blood groups by using molecular analysis (Cherif-Zahar et al., 1991; Hadley & Peiper,

1997; Lee, 1997; Dean, 2005). Currently, almost all of human blood groups genes

have now been cloned and the molecular basis for all of the clinically important blood

group polymorphisms have been determined by the rapidly growing variety of

technologies, from the low throughput to the high throughput platforms (Monteiro et

al., 2011). Difficulties in identifying the blood phenotype by serological test for

multiply-transfused patients are expected to be resolved by performing the molecular

technique.

139

In order to prove the importance of molecular blood genotyping in multiply-transfused

patients, we compared their blood phenotype result by haemagglutination method with

the genotyping result by TaqMan®

SNP RT-PCR method. We also attempted to use an

alternative sampling technique other than peripheral blood as a source of DNA for

blood group genotyping. In light of the debate about donor‟s blood being present in

patients‟ circulation if genotyping was done from the recently transfused samples, we

adopted a D0 (pre-transfusion sample) and D7 (post-transfusion sample) for

comparison. Therefore, we have also compared the genotyping results from the blood

samples with samples obtained from buccal cell scrapping.

5.2 DEMOGRAPHIC DATA

The sample groups include thalassaemia β-intermedia patients (45.5%), thalassaemia

β-major patients (42.4%) and Hb H disease patients (12.1%). Thirteen of our

thalassemia β-major patients received 2 to 4 weekly blood transfusions and only one

patient required 6 to 8 weekly blood transfusions. From our β-intermedia patients,

eight of them required 2 to 4 weekly blood transfusions, five received 6 to 8 weekly

blood transfusions and two required 12 weekly blood transfusions. Only three of the

Hb H disease patients received 6 to 8 weekly blood transfusions and one patient

required 12 weekly blood transfusions. Majority of the patients received blood

transfusions as frequent as 4 weekly (51.5%). The main aim of the red cell transfusion

in these patients is to keep the mean haemoglobin level >9 g/dL as this condition is

vital to suppress ineffective erythropoiesis which is the basis for the clinical features

for this disease while minimising the complications and maintaining tissue

140

oxygenation. The decision to start blood transfusion will require proper clinical

assessment of each individual thalassaemia patient. The blood transfusion should be

started promptly when there is clinical evidence of severe anaemia with signs or

symptoms of cardiac failure, failure to thrive and/or thalassaemia bone deformity

(Malaysia, 2009). Transfusion interval depends on the pre- and post-transfusion Hb

level in any types of thalassaemia and can be as frequent as 2 to 4 weeks apart

(Malaysia, 2008). Pre-transfusion Hb level should be kept at 9 to 10 g/dL and the

optimal post-transfusion Hb level should be targeted between 13.5 to 15.5 g/dL. It is

recommended that the Hb level should be monitored at least one hour after completion

of the transfusion (Malaysia, 2009).

A high alloimmunization rate of around 20% was observed among Asian

Thalassaemia patients (Singer et al., 2000). Other than antigenic discrepancies, the

immune system in particular, is undoubtedly involved with the heightened

development of harmful alloantibodies and/or autoantibodies in these patients.

Immunomodulatory effects of transfused blood, especially suppression of recipient

white cells, is a well-recognized area (Blajchman, 1998). However, absolute

lymphocytosis especially in splenectomized thalassaemia individuals, is accompanied

by an increase in serum immunoglobulins, presence of circulating immune complexes

and cells coated with surface immunoglobulins, which are the result of the

immunomodulatory effects of blood elements, absence of spleen and recipient

immune status (Blajchman, 1998; Ghio et al., 1999; Sibinga, 1999). This activated

immune system increases the propensity of thalassaemia patients, who are considered

high-risk individuals to develop alloantibodies and autoantibodies.

141

In this current study, 24.2% of the patients were detected positive for either

alloantibodies or autoantibodies or both. DCT was variably positive both in pre-

transfusion and post-transfusion samplings. Most of the patients were referred cases

from other hospitals and hence were subjected to different transfusion policies and

practises of each hospital. Furthermore, once current or previous record of

alloimmunization has been documented, the availability of RBC units for transfusion

may be severely restricted by compatibility issues and the time taken to identify the

compatible units may be prolonged. Current practices in Malaysia only test for the

presence of ABO and RhD antigen by traditional agglutination method. When specific

antigen-negative bloods are needed, they must test the donor‟s blood for the presence

of the relevant antigens that must be avoided. The patients also must have their

extended red blood cell antigen profiled. However, for these regularly-transfused

patients, this test becomes more complicated because the results from the

agglutination method may not be reliable due to the coated antibodies on the surface

of the patients‟ own RBC that typically reacts with all cell tested or mixture with

previous transfused blood.

The „pre-transfusion blood sampling or D0‟ and „post-transfusion blood sampling or

D7‟ approach were employed in the present work to eliminate result‟s bias, validate

patient sampling while at the same time confirming the DNA results and evaluate the

presence of potential donor leukocyte.

142

5.3 THE IMPORTANCE OF DOING PATIENTS’ EXTENDED RED

CELL BLOOD GROUP GENOTYPE

The relevance of performing extended blood group genotyping in multiply-transfused

patients has been demonstrated to be useful. It will allow the clinicians to determine

the actual extended blood group and assisting in the selection of antigen-negative

RBCs for transfusion (Guelsin et al., 2010). By receiving antigen-matched RBCs

based on genotype, patients have shown better in vivo RBC survival, increased

haemoglobin levels and diminished frequency of transfusion (Castilho et al., 2002a;

Ribeiro et al., 2009).

However, limited study has been performed on the prevalence of the extended blood

groups which are clinically significant amongst the Malaysian population. Improper

data recording and management of data especially regarding the extended blood group

antigens amongst the multiply-transfused patients further complicate the problem

especially when phenotypic-matched blood is required for supply. This has happened

because most of the patients will refer their cases from one hospital to other

specialized hospital depending on their health, degree of complications and socio-

economic status. In this present works, the extended blood groups were tested by

haemagglutination method and molecular method. However, the results from

haemagglutination method are unreliable and have many undetermined results. The

phenotype frequencies of pre- and post-transfusion samples are not in line between the

two samplings as shown in Table 4.5. When the molecular method was applied to

determine the extended blood groups, the results from the molecular method are the

most reliable. The genotype frequencies of pre- and post-transfusion are concordant as

143

shown in Table 4.6 and the undetermined blood phenotype results were resolved.

However, the molecular method is not simple to perform as haemagglutination

method. The selection of suitable primer must be done properly and correctly as some

of the blood antigens tested are polymorphic and lacking of local data towards the

blood antigens making the process quite difficult. In the beginning of this study, we

plan to compare the genotyping results with two different molecular methods;

conventional PCR using BAGene DNA-SSP Kits and SNP RT-PCR. However, due to

budget constraint, we have decided to perform the optimization and comparison of the

commercial kit and the SNP RT-PCR platform for healthy controls only. After a

concordant result was obtained, the patient samples were genotyped with the SNP RT-

PCR method only.

5.3.1 Primer designation for determination of RHCcEe and KEL blood

group antigens

The primers detecting the RHCcEe and KEL antigens are custom made. It is only

available when a product for a SNP of interest is not found on the Applied

Biosystems® website and the primers will be designed upon customer‟s request.

During the primer designation process, the important factors that need to be

considered are, i) which antigens is most prevalent amongst Malaysian population and

ii) which amino acid substitutions are associated with the blood group antigens

because both blood groups are polymorphic and SNPs analysis are going to be applied

in this study.

Rhesus blood group is one of the most complicated blood group systems (Dean, 2005)

and it has 54 well-known antigens (Transfusion, 2015) which is encoded by two

144

genes; RHD and RHCE (Flegel, 2007). In this study, we only focus on RhCE. The

RhCE protein encodes the C/c antigen and E/e antigen with many other antigens. For

C/c polymorphism, there are four amino acid substitutions that show association but

only Ser103Pro encoded by exon 2 is definitive for determining C or c activity. The

E/e polymorphism only come from a Pro226Ala substitution (Mouro et al., 1993;

Dean, 2005). Difficulties were encountered when choosing suitable primer for RhCc.

Two different assay names with different assay IDs (rs45493401, AHGJ8DN and

rs676785, AHFA979F, respectively) have been found during the primer designation

process. Both assays showed that they will detect the same antigen at the same amino

acid substitution. Thus we decided to try both assays and compare the results which

both assays were found to be concordant. As mentioned earlier, even with different

assay names or IDs for one blood group antigen, the results should be reliable if the

primer is correct as proven by sequencing analysis.

Primer designation for KEL blood group antigen was not as complicated as RhCc

because the k/K polymorphism results from single base mutation only, 698C>T SNP

in exon 6, encoding a Thr193Met substitution. This is the only amino acid substitution

that represents k/K polymorphism.

5.3.2 Primer designation for determination of Kidd and Duffy blood

group antigens

In contrast with the primer designation for RhCcEe and KEL blood group antigens,

the primer used for these two types of blood antigens are pre-designed; it is available

in multiple scales, manufactured and functionally tested upon ordering - quite stable

and trusted. The blood group antigens tested were not polymorphic. In Kidd blood

145

group systems, there are only three antigens detected; Jka, Jk

b and Jk

3 however only

Jka and Jk

b are the most common. The Jk

a/Jk

b polymorphism arise from SNP

838G>A, resulting in a D280N substitution. For Duffy blood group systems, there are

five antigens but only two are the most important; Fya and Fy

b which differ by a SNP

125G>A resulting in a G42D substitution. From the blood genotypic results, we did

not find any rare blood group (eg: Fy(a-b-) or Jk(a-b-)) as all of our study subjects are

Malaysians and these types of blood group antigen are rare amongst the Asian

population.

5.4 CORRELATION BETWEEN PHENOTYPE AND GENOTYPE

RESULTS IN PRE- AND POST-TRANSFUSION SAMPLES

The haemagglutination method, though regarded as the gold standard in blood group

identification, the results may be unreliable in certain situations. Many factors need to

be considered before analysing the results and assigning the blood groups. These

include patient‟s history of previous exposure to donor blood transfusions, the

duration, pregnancy status in females and transplantation should be taken into account

especially for vulnerable groups such as infants, the elderly and immunocompromised

patients.

After receiving multiple transfusions, the patients‟ serologic typing of blood group

phenotype may be very problematic to determine due to mixed RBC population in

their blood circulation. Based on the phenotype-genotype results from this current

study from two samplings (D0 and D7), it is shown that there is a very high likelihood

of mistyping when haemagglutination is performed (Table 4.8 and Table 4.9). This

146

would potentially lead to false assignment of the relevant blood group systems. When

doing a correlation between phenotype and genotype results, 25 cases in Duffy

system, 23 cases in Kidd system and 22 cases in the RH blood group system were

found to have discrepancies in pre-transfusion or D0 samples (Table 4.11). This shows

that the extended blood group phenotype was unreliable even before transfusion was

commenced. Post-transfusion samples or D7 was even worse whereby, 28 cases in

Duffy system, 24 cases in Kidd system and 14 in the RH blood group system cases

were found to have discrepancies (Table 4.12). Blood group phenotypes were also

undetermined when mixed-field reactions were recorded.

A number of studies and observations have reported that the high failure rate of

serological antigen typing in multiply-transfused patients makes the serological results

unreliable (Reid et al., 2000; Rožman et al., 2000; Castilho et al., 2002a; Castilho et

al., 2002b; Ribeiro et al., 2009; Guelsin et al., 2010). The phenotyping results in all of

these studies have shown discordance with the genotyping results. In these studies,

different types of molecular methods were employed amongst the multiply-transfused

patients with various haematological diseases and one study in patients with renal

failure. Mixed-field agglutination was also observed in more than one antigen typing

which makes it difficult to interpret the patients‟ blood phenotype and determination

of the antigen-matched red cell that are suitable for the patients. As accurately stated

in AABB Technical Manual (Martha Rae Combs et al., 2005), the results of serologic

test can only be accessed with combination of the patient‟s history and clinical data

and the interpretation of the results must be done by a well-trained personnel.

147

In this present work, even though there are many discrepancies results between pre-

(D0) and post-transfusion samples (D7) in each blood group tested, the blood group

phenotypes which were managed to find are amongst the common genotypes and most

likely within the range of the Malaysian population. In the Rh system, there are 3 Rh

phenotypes/genotypes that can be seen from the results; CCee, CcEe and Ccee. Due to

the fact that all the patients were Rh D positive, there are many possibilities of Weiner

assignments that can arise from the results. The possible Weiner assignments for

RHDCCee are R1R1 and R1r‟, for RHDCcEe are R1R2, R0RZ, R0Ry, R1r‟‟, R2r‟ and RZr

and for RHDCcee are R1r, R0r‟, and R1R0. One study was conducted amongst 594

Malaysian donors and the results showed that that the five most common phenotype

for Rhesus blood group system in the Malaysian population were RHDCCee/R1R1,

RHDCcEe/R1R2, RHDCcee/R1r, RHDccEE/R2R2 and RHDccEe/R2r (Musa et al.,

2012). In other study involving 1014 Malaysian donors, ccee/rr was reported to be

amongst the common phenotype for Rhesus blood group system in the Malaysian

population which was relatively high in Indian donors (Musa et al., 2015). Based on

these databases, our patients‟ blood group phenotype can still be classified as common

genotypes.

For Kidd and Duffy blood group system, we did not find any rare genotypes such as

Jk(a-b-) and Fy(a-b-). Jk(a+b+) is always the first common genotype among Asians

followed by Jk(a+b-) and Jk(a-b+). This finding is in line with our finding and also

supported with the study by Musa et al., (2012) involving 594 Malaysian donors.

However, the Jk(a-b-) or commonly known as antigen Jk3, though cannot be found in

this present work, it can still be found amongst the Malaysian population and it is the

rarer genotype (Musa et al., 2012). As with the Duffy system, it has been previously

148

reported that the Fya is very common amongst Asian populations with the occurrence

of about 90.8%, 81.5% and 69% in Chinese, Japanese and Thai subjects, respectively

(Reid & C, 2004). Similar findings have been obtained in this study, where the

Fy(a+b-) is the commonest phenotypes followed by Fy(a+b+) and Fy(a-b+). No Fy(a-

b-) was found in this study which is considered as rare phenotype even though it can

still be found amongst Malaysian population (Musa et al., 2012). Fy(a-b-) has been

reported with higher frequencies in countries with high incidence of Plasmodium

vivax and Plasmodium knowlesi (Hamblin & Di Rienzo, 2000; Beth H. Shaz & John

D. Roback, 2009). Plasmodium vivax is currently the most dominant malaria species

in Malaysia (Seng, 2006).

In the KEL system, the k antigen has high frequency in all populations while K

antigen has frequency of about 9% amongst Caucasians and may be as high as 25%

amongst Arabs (Reid & C, 2004). The findings in this study are not in conflict with all

the previous reports since the majority of the patients were kk positive.

The DNA that used for detecting the blood genotyping in this current study was

collected from the buffy-coat layer comprising of leukocytes. In patients who are

multiply-transfused, the presence of any residual donor leukocytes may interfere with

molecular blood group genotyping. However, based on the genotyping results using

pre-transfusion (D0) and post-transfusion samples (D7) (Table 4.6 and Table 4.13),

the results were fully concordant and showed that potential donor leukocytes admixed

with patient‟s leukocytes from the post-transfusion samples did not interfere with the

results. Therefore peripheral blood samples collected 7 days post-transfusion may still

be used in blood genotyping. Nevertheless, the presence or clearance of donor

149

leukocyte contamination cannot be discussed in detail in this report as a chimerism

analysis was not performed. While Lee and colleagues (1995) stated that the

concentration of donor leukocytes in recipient blood increases transiently in their post-

transfusion orthopaedic surgery patients, a number of studies showed that DNA from

the post transfusion samples would not affect the blood group genotyping results

without the risk of detecting microchimerism (Reid et al., 2000; Rožman et al., 2000;

Castilho et al., 2002a). This would most likely be due to the overwhelming excess of

patients‟ own DNA. These findings are parallel with our finding. On the other hand,

the finding by Reid and associates (2000) was also in agreement with Wenk and

Chiafari (1997) who showed that, in 12 massively transfused adult patients, Southern

blot analysis of variable number of tandem repeat polymorphism sequences detected

patient DNA but not donor DNA. There were also many arguments amongst the

researchers regarding their finding about microchimerism after transfusion of

leukodepleted blood to patients (Lee et al., 2005; Utter et al., 2006; Lapierre et al.,

2007). Based on the types of blood product transfused (Figure 4.4), not all patients

received leukoreduced red cells and hence would be difficult to analyse. To support

our findings, when compared with the genotype results obtained from buccal swab,

the results also showed full concordance (Table 4.10).

For many years, it has been observed that RBC components from allogeneic donors

contain 106 to 10

8 leukocytes which are capable of survival and expansion (Schechter

et al., 1972; Schechter et al., 1977; Lee et al., 1995). Although these leukocytes do not

serve any therapeutic role, prolonged exposure to donor cells can cause transfusion-

related complications, such as chill-fever reactions known as febrile non-haemolytic

transfusion reactions, to HLA alloimmunization, graft-versus-host disease (GVHD)

150

and transfusion transmitted diseases (Lee et al., 1995; Gupta et al., 2011; Alves et al.,

2012). For management of blood transfusion amongst thalassaemia patients in

Malaysia, whenever possible fresh blood of less than 14 days and leukoreduced

products should be given to the patients (Centre, 2007; Malaysia, 2009) in order to

reduce the risk of transfusion complications that will make the patients‟ blood

transfusion management become more complicated. Universal leukodepletion is also a

strategy that could be adopted to minimise the risk of donor leukocyte contamination.

5.5 THE USEFULNESS OF SNP MOLECULAR GENOTYPING IN

RESOLUTION OF PHENOTYPE DISCREPANCIES ISSUES

Haemagglutination method is demonstrated to be simple but challenging to interpret

in the present work. There are many phenotype discrepancies reported. Molecular

analysis in determining the blood group overcomes the limitation of

haemagglutination method. This is because it is not influenced by immunoglobulin

coating of the red blood cells, the presence of the recently-transfused red blood cells

or any form of polyagglutination or by the limitations commonly found with the

antisera. No mixed-field reaction will occur which lead to the undetermined result.

Undetermined phenotypes detected using the haemagglutination technique in D0 and

D7 samples were resolved when the patient‟s DNA was subjected to red cell blood

group system genotyping using the SNP RT-PCR. Mixed-field reaction denotes a

mixture of more than one population of red cells and therefore a positive and negative

reaction are both seen in the reaction tube. However, for KEL system, there was full

concordance between the phenotype and genotype results in pre- and post-transfusion

samples. When comparing the genotyping results between different types of samples,

151

peripheral blood and buccal swab, the results were found to be concordant (Table 4.7

& Table 4.10). Even though there are many types of PCR method that can be used for

blood genotyping like PCR-RFLP, PCR-SSP, multiplex-PCR which was gel-based

detection, the SNP RT-PCR was considered most suitable to be applied as it offers

medium to high throughput platform, the number of SNPs that can be run per samples

was not too low or too high and the turnaround time was quite fast compared with the

gel-based detection.

Most of blood group antigens are bi-allelic and generally result from SNPs. As the

technology for molecular method grows rapidly and the molecular bases of almost all

the major blood group antigens have been determined over the past 20 years, many

research has enabled the development of various DNA-based methods for determining

the blood group genotype (Yamamoto et al., 1990; Cherif-Zahar et al., 1991; Hadley

& Peiper, 1997; Lee, 1997). Although the conventional PCR still remains a well-

established and first of choice method for genotyping, with the fast development of

molecular technologies and increasing demands, it is no longer suitable to be used in a

busy transfusion laboratory or donor collection setting. As conventional PCR offers

limited number of SNPs analysed per run, relatively high cost and provide low

throughput service, real-time PCR can be considered as the second option for

genotyping analysis.

Comparison was done between the conventional PCR and SNP RT-PCR that were

used for molecular analysis in this study. In term of cost, after including the

consumables‟ price and the reagents (cost of DNA extraction was excluded), the cost

for SNP RT-PCR was much cheaper than the conventional PCR; RM 4 for two blood

152

group antigens compared with the conventional PCR that cost almost RM 12 for gel

preparation only. Besides that, the total turnaround time (time taken from preparing

samples until results analysis) between SNP RT-PCR and conventional PCR showed

significant difference; approximately 1 hour 45 minutes for SNP RT-PCR and almost

5 hours for conventional PCR. Furthermore, there is no longer a need to use

mutagenic substances such as ethidium bromide as some of the procedure in

conventional PCR need to use this substance. Less usage of DNA template volume

also should be considered because the samples used in this study have less of DNA

concentration; in conventional PCR, the minimum concentration of template should

be 50 ng/µl. If the concentration of DNA template is too low, more volume is needed

when preparing the mastermix. In contrast with SNP RT-PCR, the minimum

concentration of DNA template was very little, which is only 1 ng/µl. However, even

after the concentration of sample was standardized to 10 ng/µl per reaction, the DNA

template volume was still in balance.

Comparison between haemagglutination test and SNP RT-PCR was also demonstrated

in this study. Even though the method is straightforward and can be performed in a

short period of time, the cost to perform haemagglutination test was quite high

compared with the cost for SNP RT-PCR. Results from the haemagglutination test

were deemed not totally reliable as samples were taken from the recently-transfused

patients. The results also show discordance between the pre- and post-transfusion

samples. From the results of this investigation, it shows that SNP analysis by PCR is a

useful tool for red cell genotyping.

153

However, when performing the SNP RT-PCR, there are many areas that need to be

considered in order to reduce the contamination and false positive results. Storage of

the reagents is one of the most important things that need to be taken into account.

TaqMan® Genotyping Master Mix must be stored at 2

oC – 8

oC while the TaqMan

®

SNP Genotyping Assay must be stored at -20oC, in the dark condition as it is light

sensitive. Excessive exposure to light may affect the fluorescent probes. Other than

that, the freeze-thaw cycles should be minimized. The best solution is to separate the

assays into a few sterile tubes (act as stock) and only retrieve the stock when it is

needed. Lastly, wearing appropriate PPE and following the laboratory rules and

regulations are also important to avoid contamination of samples and tests.

5.6 BUCCAL SWAB AS AN ALTERNATIVE SOURCE IN BLOOD

GENOTYPING

Blood has always been the first choice of sampling in determining the blood group

types. However, blood sampling is invasive, time consuming and expensive. To get

the blood, it must be conducted by a skilled individual (optimally a certified

phlebotomist). The phlebotomy procedure may become painful and not suitable for

certain types of patients such as infants and elderly patients. The accurate phenotyping

of RBC from recently transfused patients also become problematic due to the presence

of donors RBC in patients‟ blood. Although blood typing can be resolved by

molecular method using the DNA from the blood, if the DNA is prepared from a

transfused patient‟s blood sample, donor leukocytes, at least will interfere the

genotyping results (Adams et al., 1992; Lee et al., 1995). To overcome these

problems, another source of DNA should be used in the determination of blood

154

genotyping. As the genetic code is contained within all somatic cells, buccal cell

collection, on the other hands, are considered as a convenient, inexpensive and non-

invasive for collecting the genetic material hence doing the blood genotyping (Rios et

al., 1999; Mulot et al., 2005; McMichael et al., 2009).

Buccal cell collection can be performed either by buccal swab or mouthwash

procedure. A few studies compared these methods in terms of DNA yield and found

that mouthwash procedure provides more yield and higher quality DNA than buccal

swab methods (García-Closas et al., 2001; Cozier et al., 2004; Mulot et al., 2005).

Nevertheless, mouthwash procedure was not suitable for the application of infants or

toddlers, elderly or unconscious patients. Therefore for these subjects, buccal swab

was the best choice of method to collect the DNA. Our finding revealed that we still

can extract the DNA from buccal swab and do the blood genotyping even though the

mean DNA concentration from buccal swab is lower than the blood samples (Table

4.14). The buccal cells provided usable amounts of DNA from two swabs although the

amount of extracted DNA gave interindividual variation. Mulot and co-workers

(2005) claimed that the two consecutive brushes that they applied by using cytobrush

to collect the buccal cells did not affect the DNA yield but it is contradicted with our

finding where we found that after using two swabs, we got better DNA yield and the

amount of the samples were enough for us to run the genotyping test. In terms of

DNA purity, when the mean UV A260/A280 ratio between buccal swab and

peripheral blood samples is compared, the value obtained did not show any significant

differences; which means that the quality between both types of samples were almost

similar and our samples were maybe not contaminated with the protein. Comparison

of genotype results between peripheral blood and buccal swab were shown to be fully

155

concordant (Table 4.7 and Table 4.10). Thus, this study has shown that DNA from

buccal swab can be used in blood genotyping as supported by Rios and associates

(1999) although few researchers do not suggest the use of the buccal cell DNA as an

alternative to blood due to high potential of getting bacterial contamination during the

process of obtaining the buccal cell (Livy et al., 2011). However, this is more cost

effective to the genotyping experiments if buccal swab is used as the sample.

156

CHAPTER VI

CONCLUSIONS AND RECOMMENDATIONS

In conclusion, red blood cell molecular-based genotyping can be extremely helpful in

determining the actual extended blood group systems in multiply-transfused patient

populations and assisting in the identification of suspected antibodies and the selection

of antigen-negative RBCs for transfusion. DNA from buccal swab can be the

alternative source for blood genotyping. The development of medium to high-

throughput genotyping platforms that utilize microarray and chip technologies offers

the opportunity to perform large-scale testing on numerous antigens simultaneously,

allowing an accurate selection of donor units to facilitate matching of donor RBCs to

the recipient‟s blood type. Commercial kits available are not only expensive in cost

but are developed based on the prevalence of Western population. What is important

is the inclusion of alleles that are relevant and prevalent to the Malaysian population.

The development of a Malaysian-based genotype assay using molecular techniques

suited for small to moderate scale for patients and larger scale for prospective blood

donors will be the focus for future research and investigation.

157

6.1 LIMITATIONS

6.1.1 Samplings

Total number of samples was less than the target due to the subjects‟ refusal to

perform post-transfusion sampling at D7. After complete data cleaning was done, only

33 samples were included in the final analysis.

6.1.2 Methodology

Difficulties were encountered during buccal swab collection. Patient‟s mouth was

found to be quite dry and the usage of cotton swab was not practicable as the cotton

from the swab will stick at the patient‟s inner cheek and make the process of

harvesting the buccal cell quite difficult. Cytobrush perhaps could be used in the

future to resolve this issue. Good quality DNA from the buccal swab was quite

challenging to achieve at the beginning of the study. Optimization of this step was

lengthy but crucial to obtain higher DNA yields and purity before the actual molecular

work was performed on patient‟s sample.

WBC count in donor blood bag and the chimerism analysis were not performed in this

study. Therefore, the donor leukocyte contamination in patient‟s post transfusion

blood sampling could not be included in the present study.

Blood genotyping for Rh D gene was omitted in this study as 99% of the population

was phenotyped as RhD positive by serology; less than 1% are Rh D negative. The

158

serology result was also very clear for Rh D because all the patients were Rh D

positive. The objective of the study was to explore the extended Rh alleles as matched

blood for transfusion in most hospitals stop short at D positive typing only. If RhD

gene was also included in future research, the researcher would have to take into

account the polymorphic nature of the gene and take into account the prevalent alleles

in our population to be included on the genotyping panel. Furthermore, alloanti-D is

very rarely detected. The antigen profile used in this study was limited to only Rh (C,

c, E, e), KEL, Kidd and Duffy as it is based on the highest frequency of antibody

developed in thalassaemia patients.

159

BIBLIOGRAPHY

Abraham, J.E., M.J. Maranian, I. Spiteri, R. Russell, S. Ingle, C. Luccarini, H.M. Earl,

P.P. Pharoah, A.M. Dunning & C. Caldas. 2012. "Saliva samples are a viable

alternative to blood samples as a source of DNA for high throughput

genotyping". BMC Med Genomics. Vol. 5: pp. 19.

Adams, P.T., R.D. Davenport, D.A. Reardon & M.S. Roth. 1992. "Detection of

circulating donor white blood cells in patients receiving multiple transfusions".

Blood. Vol. 80(2): pp. 551-555.

Aidar, M. & S.R.P. Line. 2007. "A simple and cost-effective protocol for DNA

isolation from buccal epithelial cells". Brazilian dental journal. Vol. 18(2): pp.

148-152.

Allen, F., L. Diamond & B. Niedziela. 1951. "A new blood group antigen". Nature.

Vol. 167: pp. 482.

Allen, F.H., Jr., S.M. Krabbe & P.A. Corcoran. 1961. "A new phenotype (McLeod) in

the Kell blood-group system". Vox Sang. Vol. 6: pp. 555-560.

Allen, F.H., Jr. & S.J. Lewis. 1957. "Kpa, (Penney), a new antigen in the Kell blood

group system". Vox Sang. Vol. 2(2): pp. 81-87.

Alves, V.M., P.R.J. Martins, S. Soares, G. Araújo, L.C. Schmidt, S.S.d.M. Costa,

D.M. Langhi & H. Moraes-Souza. 2012. "Alloimmunization screening after

transfusion of red blood cells in a prospective study". Revista Brasileira de

Hematologia e Hemoterapia. Vol. 34(3): pp. 206-211.

Ameen, R., S. Al-Shemmari, S. Al-Humood, R.I. Chowdhury, O. Al-Eyaadi & A. Al-

Bashir. 2003. "RBC alloimmunization and autoimmunization among

transfusion-dependent Arab thalassemia patients". Transfusion. Vol. 43(11):

pp. 1604-1610.

Anstee, D.J. 2009. "Red cell genotyping and the future of pretransfusion testing".

Blood. Vol. 114(2): pp. 248-256.

Avent, N.D. 2009. "Large-scale blood group genotyping – clinical implications".

British Journal of Haematology. Vol. 144(1): pp. 3-13.

Avent, N.D., S.K. Butcher, W. Liu, W.J. Mawby, G. Mallinson, S.F. Parsons, D.J.

Anstee & M.J. Tanner. 1992. "Localization of the C termini of the Rh (rhesus)

polypeptides to the cytoplasmic face of the human erythrocyte membrane".

Journal of Biological Chemistry. Vol. 267(21): pp. 15134-15139.

Avent, N.D., A. Martinez, W.A. Flegel, M.L. Olsson, M.L. Scott, N. Nogués, M.

Písǎcka, G. Daniels, E. Van Der Schoot & E. Muñiz‐Diaz. 2007. "The

BloodGen project: toward mass‐scale comprehensive genotyping of blood

donors in the European Union and beyond". Transfusion. Vol. 47(s1): pp. 40S-

46S.

Bahlo, M., J. Stankovich, P. Danoy, P.F. Hickey, B.V. Taylor, S.R. Browning, M.A.

Brown & J.P. Rubio. 2010. "Saliva-derived DNA performs well in large-scale,

high-density single-nucleotide polymorphism microarray studies". Cancer

Epidemiology Biomarkers & Prevention. Vol. 19(3): pp. 794-798.

160

Bauer, M., A. Kraus & D. Patzelt. 1999. "Detection of epithelial cells in dried blood

stains by reverse transcriptase-polymerase chain reaction". J Forensic Sci. Vol.

44(6): pp. 1232-1236.

Bauer, Martijn P., J. Wiersum-Osselton, M. Schipperus, Jan P. Vandenbroucke & E.

Briët. 2007. "Clinical predictors of alloimmunization after red blood cell

transfusion". Transfusion. Vol. 47(11): pp. 2066-2071.

Beth H. Shaz. 2009a. Kell and kidd blood group systems. Transfusion Medicine and

Hemostasis - Clinical and Laboratory Aspects. Christopher D. Hillyer, Beth H.

Shaz, James C. Zimring & T.C. Abshire. New York, USA, Elsevier.

Beth H. Shaz. 2009b. Pretransfusion Testing. Transfusion Medicine and Hemostasis -

Clinical and Laboratory Aspects. Christopher D. Hillyer, Beth H. Shaz, James

C. Zimring & T.C. Abshire. New York, USA, Elsevier.

Beth H. Shaz & John D. Roback. 2009. MNS and Duffy Blood Group Systems.

Transfusion Medicine and Hemostasis - Clinical and Laboratory Aspects.

Christopher D. Hillyer, Beth H. Shaz, James C. Zimring & T.C. Abshire. New

York, USA, Elsevier.

Bhatti, F.A., N. Salamat, A. Nadeem & N. Shabbir. 2004. "Red cell immunization in

beta thalassaemia major". J Coll Physicians Surg Pak. Vol. 14(11): pp. 657-

660.

Blajchman, M. 1998. "Immunomodulatory effects of allogeneic blood transfusions:

clinical manifestations and mechanisms". Vox Sanguinis. Vol. 74(S2): pp. 315-

319.

Blumberg, N., K. Ross, E. Avila & K. Peck. 1984. "Should chronic transfusions be

matched for antigens other than ABO and Rho(D)?". Vox Sang. Vol. 47(3): pp.

205-208.

Brantly SG & R. G. 1988. "Red cell alloimmunisation in multitransfused HLA-typed

patients". Transfusion. Vol. 24: pp. 463-466.

Calhoun, L. 1999. Other major blood group systems. Modern blood banking and

transfusion practices. D.M. Harmening. 4th ed. Book Promotion & Service

Co,., Ltd.

Carritt, B., T.J. Kemp & M. Poulter. 1997. "Evolution of the Human RH (Rhesus)

Blood Group Genes: A 50 Year Old Prediction (Partially) Fulfilled". Human

Molecular Genetics. Vol. 6(6): pp. 843-850.

Castilho, L., M. Rios, C. Bianco, J. Pellegrino, Fernando L. Alberto, Sara T.O. Saad &

Fernando F. Costa. 2002a. "DNA-based typing of blood groups for the

management of multiply-transfused sickle cell disease patients". Transfusion.

Vol. 42(2): pp. 232-238.

Castilho, L., M. Rios, J. Pellegrino, Jr., T.O.S. S & F.C. F. 2002b. "Blood group

genotyping facilitates transfusion of beta-thalassemia patients". J Clin Lab

Anal. Vol. 16(5): pp. 216-220.

National Blood Centre. 2007. "Guidelines for the Rational Use of Blood and Blood

Products".

Chaudhuri, A., J. Polyakova, V. Zbrzezna & A. Pogo. 1995. "The coding sequence of

Duffy blood group gene in humans and simians: restriction fragment length

polymorphism, antibody and malarial parasite specificities, and expression in

nonerythroid tissues in Duffy- negative individuals". Blood. Vol. 85(3): pp.

615-621.

161

Cheng, T.-H., S.-P. Chen, T.-C. Lu, W.-C. Chen, J.-S. Sher & Y.-S. Shieh. 2010.

"Optimal DNA extraction from buccal swab samples". Journal of Medical

Sciences. Vol. 30(4): pp. 149-154.

Cherif-Zahar, B., M.G. Mattei, C. Le Van Kim, P. Bailly, J.P. Cartron & Y. Colin.

1991. "Localization of the human Rh blood group gene structure to

chromosome region 1p34.3-1p36.1 by in situ hybridization". Hum Genet. Vol.

86(4): pp. 398-400.

Chown, B., M. Lewis & K. Kaita. 1957. "A new Kell blood-group phenotype".

Nature. Vol. 180(4588): pp. 711.

Colin, Y., B. Cherif-Zahar, C. Le Van Kim, V. Raynal, V. Van Huffel & J.P. Cartron.

1991. "Genetic basis of the RhD-positive and RhD-negative blood group

polymorphism as determined by Southern analysis". Blood. Vol. 78(10): pp.

2747-2752.

Combs, M.R., G. Denomme, B.J. Grossman, N.R. Haley, T. Harris, B.W. Jett, R.M.

Leger, J.V. Linden, J.G. McFarland, J.T. Perkins, S.D. Roseff, J. Sweeney &

D.J. Triulzi. 2005. AABB Technical Manual. M.E. Brecher. 15th ed. AABB.

Coombs, R.R., A.E. Mourant & R.R. Race. 1946. "In-vivo isosensitisation of red cells

in babies with haemolytic disease". Lancet. Vol. 1(6391): pp. 264-266.

Cozier, Y.C., J.R. Palmer & L. Rosenberg. 2004. "Comparison of methods for

collection of DNA samples by mail in the black women's health study". Annals

of Epidemiology. Vol. 14(2): pp. 117-122.

Cutbush, M., P.L. Mollison & D.M. Parkin. 1950. "A New Human Blood Group".

Nature. Vol. 165(4188): pp. 188-189.

Daniel, W.W. 1999. Biostatistics: A Foundation for Analysis in the Health Sciences.

7th ed. Vol. New York: John Wiley & Sons.

Daniels, G. 2005. "The molecular genetics of blood group polymorphism". Transplant

Immunology. Vol. 14(3–4): pp. 143-153.

Dean, L. 2005. Blood Groups and Red Cell Antigens. US. Bethesda (MD): National

Center for Biotechnology Information

Dhawan, H.K., V. Kumawat, N. Marwaha, R.R. Sharma, S. Sachdev, D. Bansal, R.K.

Marwaha & S. Arora. 2014. "Alloimmunization and autoimmunization in

transfusion dependent thalassemia major patients: Study on 319 patients".

Asian Journal of Transfusion Science. Vol. 8(2): pp. 84-88.

Donahue, R.P., W.B. Bias, J.H. Renwick & V.A. McKusick. 1968. "Probable

assignment of the Duffy blood group locus to chromosome 1 in man".

Proceedings of the National Academy of Sciences of the United States of

America. Vol. 61(3): pp. 949-955.

Dunstan, R.A. 1986. "Status of major red cell blood group antigens on neutrophils,

lymphocytes and monocytes". Br J Haematol. Vol. 62(2): pp. 301-309.

Dunstan, R.A., M.B. Simpson & W.F. Rosse. 1984. "Erythrocyte antigens on human

platelets. Absence of Rh, Duffy, Kell, Kidd, and Lutheran antigens".

Transfusion. Vol. 24(3): pp. 243-246.

Flegel, W.A. 2007. "The genetics of the Rhesus blood group system". Blood Transfus.

Vol. 5(2): pp. 50-57.

García-Closas, M., K.M. Egan, J. Abruzzo, P.A. Newcomb, L. Titus-Ernstoff, T.

Franklin, P.K. Bender, J.C. Beck, L. Le Marchand, A. Lum, M. Alavanja, R.B.

Hayes, J. Rutter, K. Buetow, L.A. Brinton & N. Rothman. 2001. "Collection of

162

Genomic DNA from Adults in Epidemiological Studies by Buccal Cytobrush

and Mouthwash". Cancer Epidemiology Biomarkers & Prevention. Vol. 10(6):

pp. 687-696.

Gemke, R.J., H.H. Kanhai, M.A. Overbeeke, C.J. Maas, J. Bennebroek Gravenhorst,

L.F. Bernini, C.P. Engelfriet & M.B. van't Veer. 1986. "ABO and Rhesus

phenotyping of fetal erythrocytes in the first trimester of pregnancy". Br J

Haematol. Vol. 64(4): pp. 689-697.

George, E. 2001. "Beta-thalassemia major in Malaysia, an ongoing public health

problem". Med J Malaysia. Vol. 56(4): pp. 397-400.

George, E. 2013. "HbE B-Thalassaemia in Malaysia: Revisited". J Hematol Thromb

Dis. Vol. 1: pp. 101.

George, E., M.I. Lai, L.K. Teh, R. Ramasamy, E.H. Goh, K. Asokan, J.A. Tan, M.

Vasudevan & S. Low. 2011. "Screening for intermediate and severe forms of

thalassaemia in discarded red blood cells: optimization and feasibility". Med J

Malaysia. Vol. 66(5): pp. 429-434.

Ghio, M., P. Contini, C. Mazzei, S. Brenci, G. Barberis, G. Filaci, F. Indiveri & F.

Puppo. 1999. "Soluble HLA class I, HLA class II, and Fas ligand in blood

components: a possible key to explain the immunomodulatory effects of

allogeneic blood transfusions". Blood. Vol. 93(5): pp. 1770-1777.

Giblett, E. 1958. "Js, a "new" blood group antigen found in Negroes". Nature. Vol.

180: pp. 711.

Guelsin, G.A., A.M. Sell, L. Castilho, V.L. Masaki, F.C. Melo, M.N. Hashimoto, T.T.

Higa, L.S. Hirle & J.E. Visentainer. 2010. "Benefits of blood group

genotyping in multi-transfused patients from the south of Brazil". J Clin Lab

Anal. Vol. 24(5): pp. 311-316.

Guevin, R.M., V. Taliano & O. Waldmann. 1976. "The Cote serum (anti-K11), an

antibody defining a new variant in the Kell system". Vox Sang. Vol. 31(1

SUPPL): pp. 96-100.

Gupta, R., D.K. Singh, B. Singh & U. Rusia. 2011. "Alloimmunization to red cells in

thalassemics: Emerging problem and future strategies". Transfusion and

Apheresis Science. Vol. 45(2): pp. 167-170.

Hadley, T.J. & S.C. Peiper. 1997. "From Malaria to Chemokine Receptor: The

Emerging Physiologic Role of the Duffy Blood Group Antigen". Blood. Vol.

89(9): pp. 3077-3091.

Hamblin, M.T. & A. Di Rienzo. 2000. "Detection of the signature of natural selection

in humans: evidence from the Duffy blood group locus". American Journal of

Human Genetics. Vol. 66(5): pp. 1669-1679.

Hansen, T.v.O., M.K. Simonsen, F.C. Nielsen & Y.A. Hundrup. 2007. "Collection of

Blood, Saliva, and Buccal Cell Samples in a Pilot Study on the Danish Nurse

Cohort: Comparison of the Response Rate and Quality of Genomic DNA".

Cancer Epidemiology Biomarkers & Prevention. Vol. 16(10): pp. 2072-2076.

Herráez, D.L. & M. Stoneking. 2008. "High fractions of exogenous DNA in human

buccal samples reduce the quality of large-scale genotyping". Analytical

Biochemistry. Vol. 383(2): pp. 329-331.

Higgins, J.M. & S.R. Sloan. 2008. "Stochastic modeling of human RBC

alloimmunization: evidence for a distinct population of immunologic

responders". Blood. Vol. 112(6): pp. 2546-2553.

163

Hosono, S., A.F. Faruqi, F.B. Dean, Y. Du, Z. Sun, X. Wu, J. Du, S.F. Kingsmore, M.

Egholm & R.S. Lasken. 2003. "Unbiased whole-genome amplification directly

from clinical samples". Genome Res. Vol. 13(5): pp. 954-964.

Ikin, E.W., A.E. Mourant, H.J. Pettenkofer & G. Blumenthal. 1951. "Discovery of the

expected haemagglutinin, anti-Fyb". Nature. Vol. 168(4288): pp. 1077-1078.

Jansuwan, S., O. Tangvarasittichai & S. Tangvarasittichai. 2015. "Alloimmunization

to Red Cells and the Association of Alloantibodies Formation with

Splenectomy Among Transfusion-Dependent beta-Thalassemia Major/HbE

Patients". Indian J Clin Biochem. Vol. 30(2): pp. 198-203.

Kawthalkar, S.M. 2013. Essentials of Haematology. India: Jaypee Brothers Medical

Publishers (P) LTD.

Klein, H.G. & D.J. Anstee. 2006. Mollison's blood transfusion in clinical medicine.

11th ed. Wiley-Blackwell

Kormoczi, G.F., E.A. Scharberg & C. Gassner. 2009. "A novel KEL*1,3 allele with

weak Kell antigen expression confirming the cis-modifier effect of KEL3".


Kovacevic-Grujicic, N., S. Davidovic, D. Takic, M. Mojsin & M. Stevanovic. 2012.

"Direct PCR amplification of the HVSI region in mitochondrial DNA from

buccal cell swabs". Archives of Biological Sciences. Vol. 64(3): pp. 851-858.

Krista L. Hillyer. 2009. Serologic Testing of Donor Products. Transfusion Medicine

and Hemostasis - Clinical and Laboratory Aspects. Christopher D. Hillyer,

Beth H. Shaz, James C. Zimring & T.C. Abshire. New York, USA, Elsevier.

KÜChler, E.C., P.N. Tannure, P. Falagan-Lotsch, T.S. Lopes, J.M. Granjeiro &

L.M.F. Amorim. 2012. "Buccal cells DNA extraction to obtain high quality

human genomic DNA suitable for polymorphism genotyping by PCR-RFLP

and Real-Time PCR". Journal of Applied Oral Science. Vol. 20(4): pp. 467-

471.

Kyaw, T.Z. 2012. "Molecular analysis of Malaysian Chinese D-donors: a single centre

experience". Asian Biomed. Vol. 6(1): pp. 27-33.

Landsteiner, K. 1900. "Zur Kenntnis der antifermentativen, lytischen und

agglutinierenden Wirkungen des Blutserums und der Lymphe". Zbl Bakt. Vol.

27: pp. 357-362.

Lapierre, V., A. Aupérin, E. Robinet, C. Ferrand, N. Oubouzar, D. Tramalloni, P.

Saas, B. Debaene, P. Lasser & P. Tiberghien. 2007. "Immune modulation and

microchimerism after unmodified versus leukoreduced allogeneic red blood

cell transfusion in cancer patients: results of a randomized study". Transfusion.

Vol. 47(9): pp. 1691-1699.

Le Hellard, S., S.J. Ballereau, P.M. Visscher, H.S. Torrance, J. Pinson, S.W. Morris,

M.L. Thomson, C.A. Semple, W.J. Muir & D.H. Blackwood. 2002. "SNP

genotyping on pooled DNAs: comparison of genotyping technologies and a

semi automated method for data storage and analysis". Nucleic acids research.

Vol. 30(15): pp. e74-e74.

Lee, S. 1997. "Molecular Basis of Kell Blood Group Phenotypes". Vox Sanguinis.

Vol. 73(1): pp. 1-11.

Lee, S. 1998. "Molecular basis of Kell blood group phenotypes". Vox Sang. Vol. 74:

pp. 58.

164

Lee, S., D. Naime, M. Reid & C. Redman. 1997. "The KEL24 and KEL14 alleles of

the Kell blood group system". Transfusion. Vol. 37(10): pp. 1035-1038.

Lee, T.H., E. Donegan, S. Slichter & M.P. Busch. 1995. "Transient increase in

circulating donor leukocytes after allogeneic transfusions in immunocompetent

recipients compatible with donor cell proliferation". Blood. Vol. 85(5): pp.

1207-1214.

Lee, T.H., T. Paglieroni, G.H. Utter, D. Chafets, R.C. Gosselin, W. Reed, J.T.

Owings, P.V. Holland & M.P. Busch. 2005. "High-level long-term white blood

cell microchimerism after transfusion of leukoreduced blood components to

patients resuscitated after severe traumatic injury". Transfusion. Vol. 45(8):

pp. 1280-1290.

Levine, P., M. Backer, M. Wigod & R. Ponder. 1949. "A New Human Hereditary

Blood Property (Cellano) Present in 99.8% of all Bloods". Science. Vol.

109(2836): pp. 464-466.

Livy, A., S. Lye, C.K. Jagdish, N. Hanis, V. Sharmila, L.W. Ler & B. Pramod. 2011.

"Evaluation of Quality of DNA Extracted from Buccal Swabs for Microarray

Based Genotyping". Indian Journal of Clinical Biochemistry. Vol. 27(1): pp.

28-33.

Lum, A. & L. Le Marchand. 1998. "A simple mouthwash method for obtaining

genomic DNA in molecular epidemiological studies". Cancer Epidemiology

Biomarkers & Prevention. Vol. 7(8): pp. 719-724.

Ministry of Health Malaysia. 2008. "Transfusion Practice Guidelines for Clinical and

Laboratory Personnel".

Ministry of Health Malaysia. 2009. "Clinical practice guidelines: Management of

transfusion dependent thalassaemia".

Malaysia, M.o.H. 2010. MyTalasemia Malaysia Thalasemia Vortal - prime source of

information on Thalassaemia. <http://www.mytalasemia.net.my/>. accessed:

18 February 2014

Malaysia, M.o.H. 2013. "Thalassaemia Registry".

Martha Rae Combs, Gregory Denomme, Brenda J. Grossman, N. Rebecca Haley,

Teresa Harris, Betsy W. Jett, Regina M. Leger, Jeanne V. Linden, Janice G.

McFarland, James T. Perkins, Susan D. Roseff, Joseph Sweeney & D.J.

Triulzi. 2005. The Positive Direct Antiglobulin Test and Immune-Mediated

Red Cell Destruction. American Association of Blood Bank Technical

Manual. M.E. Brecher. 15th ed. United States: AABB.

Martino, A., T. Mancuso & A.M. Rossi. 2010. "Application of high-resolution melting

to large-scale, high-throughput SNP genotyping a comparison with the

TaqMan® method". Journal of biomolecular screening. Vol. 15(6): pp. 623-

629.

McMichael, G.L., C.S. Gibson, M.E. O‟Callaghan, P.N. Goldwater, G.A. Dekker,

E.A. Haan, A.H. MacLennan & G. for the South Australian Cerebral Palsy

Research. 2009. "DNA from Buccal Swabs Suitable for High-Throughput SNP

Multiplex Analysis". Journal of Biomolecular Techniques : JBT. Vol. 20(5):

pp. 232-235.

Mercier, B., C. Gaucher, O. Feugeas & C. Mazurier. 1990. "Direct PCR from whole

blood, without DNA extraction". Nucleic acids research. Vol. 18(19): pp.

5908.

165

Michail-Merianou, V., L. Pamphili-Panousopoulou, L. Piperi-Lowes, E. Pelegrinis &

A. Karaklis. 1987. "Alloimmunization to red cell antigens in thalassemia:

comparative study of usual versus better-match transfusion programmes". Vox

Sang. Vol. 52(1-2): pp. 95-98.

Mograin, I. 2009. Development of a Blood Antigen Molecular Profiling Panel using

Genotyping Technologies for Patients Requiring Frequent Transfusions.

(Master Thesis). Université De Montréal

Mohandas, N. & A. Narla. 2005. "Blood group antigens in health and disease". Curr

Opin Hematol. Vol. 12(2): pp. 135-140.

Mollison, P., C. Engelfriet & M. Contreras. 1997. Blood Transfusion in Clinical

Medicine. London: Blackwell Scientific.

Monteiro, F., G. Tavares, M. Ferreira, A. Amorim, P. Bastos, C. Rocha, F. Araújo &

L.M. Cunha-Ribeiro. 2011. "Technologies involved in molecular blood group

genotyping". ISBT Science Series. Vol. 6(1): pp. 1-6.

Moulds, J.M. 2010. "Future of molecular testing for red blood cell antigens". Clin Lab

Med. Vol. 30(2): pp. 419-429.

Mouro, I., Y. Colin, B. Cherif-Zahar, J.-P. Cartron & C.L. Van Kim. 1993.

"Molecular genetic basis of the human Rhesus blood group system". Nat

Genet. Vol. 5(1): pp. 62-65.

Mullis, K.B. & F.A. Faloona. 1987. "Specific synthesis of DNA in vitro via a

polymerase-catalyzed chain reaction". Methods Enzymol. Vol. 155: pp. 335-

350.

Mulot, C., I. Stücker, J. Clavel, P. Beaune & M.-A. Loriot. 2005. "Collection of

Human Genomic DNA From Buccal Cells for Genetics Studies: Comparison

Between Cytobrush, Mouthwash, and Treated Card". Journal of Biomedicine

and Biotechnology. Vol. 2005(3): pp. 291-296.

Musa, R.H., S.A. Ahmed, H. Hashim, Y. Ayob, N.H. Asidin, P.Y. Choo & F.S. Al-

Joudi. 2012. "Red cell phenotyping of blood from donors at the National blood

center of Malaysia". Asian Journal of Transfusion Science. Vol. 6(1): pp. 3-9.

Musa, R.H., N.A. Muhamad, A. Hassan, Y. Ayob & N.M. Yusoff. 2015. "Molecular

basis of Rh blood group system in the Malaysian population". Asian J Transfus

Sci. Vol. 9(1): pp. 48-54.

Nadarajan, V.S., A.A. Laing, S.M. Saad & M. Usin. 2012. "Prevalence and specificity

of red-blood-cell antibodies in a multiethnic South and East Asian patient

population and influence of using novel MUT+Mur+ kodecytes on its

detection". Vox Sang. Vol. 102(1): pp. 65-71.

Nedel, F., M.C.M. Conde, I.O.d. Oliveira, S.B.C. Tarquinio & F.F. Demarco. 2009.

"Comparison between DNA obtained from buccal cells of the upper and lower

gutter area". Brazilian dental journal. Vol. 20(4): pp. 275-278.

Noor Haslina, M.N. 2005. A Pilot Study On Red Cell Immunization In Multiply

Transfused Thalassaemic Patients. (Master Thesis). Universiti Sains Malaysia

Noor Haslina, M.N., N. Ariffin, I. Illuni Hayati & H. Rosline. 2006. "Red cell

immunization in multiply transfused Malay thalassemic patients". Southeast

Asian J Trop Med Public Health. Vol. 37(5): pp. 1015-1020.

Nunes, A.P., I.O. Oliveira, B.R. Santos, C. Millech, L.P. Silva, D.A. González, P.C.

Hallal, A.M.B. Menezes, C.L. Araújo & F.C. Barros. 2012. "Quality of DNA

166

extracted from saliva samples collected with the Oragene™ DNA self-

collection kit". BMC Medical Research Methodology. Vol. 12: pp. 65-65.

Olsson, M.L. & M. Chester. 2001. "Polymorphism and recombination events at the

ABO locus: a major challenge for genomic ABO blood grouping strategies".

Transfusion Medicine. Vol. 11(4): pp. 295-313.

Osman, N.H., A.W. Ahmad Asnawi, M.D. Mohd Rani & J. Sathar. 2014.

"Alloantibody and autoantibody immunization in repeatedly transfused

thalassaemia patients: Hospital Ampang experience". Malaysian J Pathol. Vol.

36(Supplement A): pp. 102-103.

Pinkerton, F.e.a. 1959. "The phenotype Jk(a-b-) in the Kidd blood group system". Vox

Sang. Vol. 4: pp. 155.

Plaut, G., E. Ikin & A.e.a. Mourant. 1953. "A new blood group antibody, anti-Jkb".

Nature. Vol. 171: pp. 431.

Poynter, J.N., J.A. Ross, A.J. Hooten, E. Langer, C. Blommer & L.G. Spector. 2013.

"Predictors of mother and child DNA yields in buccal cell samples collected in

pediatric cancer epidemiologic studies: a report from the Children‟s Oncology

group". BMC Genetics. Vol. 14: pp. 69-69.

Prager, M. 2007. "Molecular genetic blood group typing by the use of PCR‐SSP

technique". Transfusion. Vol. 47(s1): pp. 54S-59S.

Qiagen. 2013. Quantification of DNA.

<https://www.qiagen.com/my/resources/molecular-biology-

methods/dna/#Quantification%20of%20DNA>. accessed: 17 May 2013.

Quill, E. 2008. "Medicine. Blood-matching goes genetic". Science. Vol. 319(5869):

pp. 1478-1479.

Quinque, D., R. Kittler, M. Kayser, M. Stoneking & I. Nasidze. 2006. "Evaluation of

saliva as a source of human DNA for population and association studies".

Analytical Biochemistry. Vol. 353(2): pp. 272-277.

Race, R. 1948. "The Rh genotypes and Fisher's theory". Blood. Vol. (Special issue 2):

pp. 27-42.

Reid, M. 2003. "Applications of DNA‐based assays in blood group antigen and

antibody identification". Transfusion. Vol. 43(12): pp. 1748-1757.

Reid, M. & L.-F. C. 2004. The Blood Group Antigen Facts Book. 2nd edition. New

York: Elsevier Academic Press.

Reid, M.E. 1995. "Molecular Basis of Human Blood Group Antigens. Jean-Pierre

Cartron and Philippe Rouger, eds". Transfusion. Vol. 35(9): pp. 793-793.

Reid, M.E. 2007. "Overview of molecular methods in immunohematology".

Transfusion. Vol. 47(s1): pp. 10S-16S.

Reid, M.E., M. Rios, V.I. Powell, D. Charles-Pierre & V. Malavade. 2000. "DNA

from blood samples can be used to genotype patients who have recently

received a transfusion". Transfusion. Vol. 40(1): pp. 48-53.

Reid, M.E. & K. Yazdanbakhsh. 1998. "Molecular insights into blood groups and

implications for blood transfusion". Curr Opin Hematol. Vol. 5(2): pp. 93-102.

Ribeiro, K.R., M.H. Guarnieri, D.C. Da Costa, F.F. Costa, J. Pellegrino Jr & L.

Castilho. 2009. "DNA array analysis for red blood cell antigens facilitates the

transfusion support with antigen-matched blood in patients with sickle cell

disease". Vox Sanguinis. Vol. 97(2): pp. 147-152.

167

Rios, M., K. Cash, A. Strupp, J. Uehlinger & M. Reid. 1999. "DNA from urine

sediment or buccal cells can be used for blood group molecular genotyping".

Immunohematology. Vol. 15(2): pp. 61-65.

Rosenfield, R., F.J. Allen & P. Rubinstein. 1973. "Genetic model for the Rh blood-

group system". Proc Natl Acad U S A. Vol. 70: pp. 1303-1307.

Rosenfield, R., F.J. Allen, S. Swisher & S. Kochwa. 1962. "A review of Rh Serology

and presentation of a new terminology ". Transfusion. Vol. 2: pp. 287-312.

Rosenfield, R., F.J. Allen, S. Swisher & S. Kochwa. 1979. "Rh nomenclature".

Transfusion. Vol. 19: pp. 487.

Rožman, P., T. Dovč & C. Gassner. 2000. "Differentiation of autologous ABO, RHD,

RHCE, KEL, JK, and FY blood group genotypes by analysis of peripheral

blood samples of patients who have recently received multiple transfusions".


Sadeghian, M.H., M.R. Keramati, Z. Badiei, M. Ravarian, H. Ayatollahi, H.

Rafatpanah & M.K. Daluei. 2009. "Alloimmunization among transfusion-

dependent thalassemia patients". Asian Journal of Transfusion Science. Vol.

3(2): pp. 95-98.

Saftlas, A.F., M. Waldschmidt, N. Logsden-Sackett, E. Triche & E. Field. 2004.

"Optimizing buccal cell DNA yields in mothers and infants for human

leukocyte antigen genotyping". American journal of epidemiology. Vol.

160(1): pp. 77-84.

Saied, D.A., A.M. Kaddah, R.M. Badr Eldin & S.S. Mohaseb. 2011.

"Alloimmunization and erythrocyte autoimmunization in transfusion-

dependent Egyptian thalassemic patients". J Pediatr Hematol Oncol. Vol.

33(6): pp. 409-414.

Sands, J. 2002. "Molecular approaches to urea transporters". J Am Soc Nephrol. Vol.

13: pp. 2795-2806.

Sands, J.M., J.J. Gargus, O. Frohlich, R.B. Gunn & J.P. Kokko. 1992. "Urinary

concentrating ability in patients with Jk(a-b-) blood type who lack carrier-

mediated urea transport". J Am Soc Nephrol. Vol. 2(12): pp. 1689-1696.

Saxena, A. & S.R. Phadke. 2002. "Feasibility of thalassaemia control by extended

family screening in Indian context". J Health Popul Nutr. Vol. 20(1): pp. 31-

35.

Schechter, G.P., F. Soehnlen & W. McFarland. 1972. "Lymphocyte response to blood

transfusion in man". N Engl J Med. Vol. 287(23): pp. 1169-1173.

Schechter, G.P., J. Whang-Peng & W. McFarland. 1977. "Circulation of donor

lymphocytes after blood transfusion in man". Blood. Vol. 49(4): pp. 651-656.

Seng, T.A. 2006. "Malaria and other vector-borne diseases control in Malaysia:

historical development and chronological events.". Vector Journal. Vol. 9(1):

pp. 36-38.

Sibinga, C.T.S. 1999. "Immune effects of blood transfusion". Current opinion in

hematology. Vol. 6(6): pp. 442.

Singer, S.T., V. Wu, R. Mignacca, F.A. Kuypers, P. Morel & E.P. Vichinsky. 2000.

"Alloimmunization and erythrocyte autoimmunization in transfusion-

dependent thalassemia patients of predominantly Asian descent". Blood. Vol.

96(10): pp. 3369-3373.

168

Singleton, B.K., C.A. Green, N.D. Avent, P.G. Martin, E. Smart, A. Daka, E.G.

Narter-Olaga, L.M. Hawthorne & G. Daniels. 2000. "The presence of an RHD

pseudogene containing a 37 base pair duplication and a nonsense mutation in

Africans with the Rh D-negative blood group phenotype". Blood. Vol. 95(1):

pp. 12-18.

Strange, J.J., R.J. Kenworthy, A.J. Webb & C.M. Giles. 1974. "Wka (Weeks), a new

antigen in the Kell blood group system". Vox Sang. Vol. 27(1): pp. 81-86.

Technologies, L. 2014. TaqMan Genotyping Master Mix Protocol.

<https://www.appliedbiosystems.com/>. accessed: 18th February 2014.

Tournamille, C., Y. Colin, J.P. Cartron & C. Le Van Kim. 1995a. "Disruption of a

GATA motif in the Duffy gene promoter abolishes erythroid gene expression

in Duffy-negative individuals". Nat Genet. Vol. 10(2): pp. 224-228.

Tournamille, C., Y. Colin, J.P. Cartron & C. Le Van Kim. 1995b. "Disruption of a

GATA motif in the Duffy gene promoter abolishes erythroid gene expression

in Duffy–negative individuals". Nature genetics. Vol. 10(2): pp. 224-228.

Transfusion, I.S.O.B. 2015. <http://www.isbtweb.org/>. accessed: 30 September

2015.

Utter, G.H., A.B. Nathens, T.-H. Lee, W.F. Reed, J.T. Owings, T.A. Nester & M.P.

Busch. 2006. "Leukoreduction of blood transfusions does not diminish

transfusion-associated microchimerism in trauma patients". Transfusion. Vol.

46(11): pp. 1863-1869.

Vamvakas, E.C. & M.A. Blajchman. 2009. "Transfusion-related mortality: the

ongoing risks of allogeneic blood transfusion and the available strategies for

their prevention". Blood. Vol. 113(15): pp. 3406-3417.

Van der Schoot, C. 2004. "Molecular diagnostics in immunohaematology". Vox

Sanguinis. Vol. 87(s2): pp. 189-192.

Vichinsky, E. 2010. "Complexity of alpha thalassemia: growing health problem with

new approaches to screening, diagnosis, and therapy". Ann N Y Acad Sci. Vol.

1202: pp. 180-187.

Wagner, F.F. & W.A. Flegel. 2000. "RHD gene deletion occurred in the Rhesus box".

Blood. Vol. 95(12): pp. 3662-3668.

Wagner, F.F., A. Frohmajer & W.A. Flegel. 2001. "RHD positive haplotypes in D

negative Europeans". BMC Genetics. Vol. 2(1): pp. 10.

Walker, R.H., C.I. Argall, E.A. Steane, T.T. Sasaki & T.J. Greenwalt. 1963. "Anti-Js-

b, the expected antithetical antibody of the Suttee blood group system".

Nature. Vol. 197: pp. 295-296.

Weatherall, D.J. & J.B. Clegg. 2011. The Thalassaemia Syndromes. 4th. edition.

Blackwell Science, London.

Westhoff, C.M. 2004. "The Rh blood group system in review: A new face for the next

decade". Transfusion Vol. 44: pp. 1663-1673.

Westhoff, C.M. 2006. "Molecular testing for transfusion medicine". Current opinion

in hematology. Vol. 13(6): pp. 471-475.

Wiener, A. 1943. "Genetic theory of the Rh blood types". Proc Soc Exp Biol (NY).

Vol. 54: pp. 316.

Wilkinson, S.L. 2005. Other Blood Groups. Textbook of blood banking and

transfusion medicine. S.V. Rudman. 2nd edition. Elsevier.

169

Win, N., P. Amess, M. Needs & P.E. Hewitt. 2005. "Use of red cells preserved in

extended storage media for exchange transfusion in anti-k haemolytic disease

of the newborn". Transfus Med. Vol. 15(2): pp. 157-160.

Wu, Y.Y. & G. Csako. 2006. "Rapid and/or high-throughput genotyping for human

red blood cell, platelet and leukocyte antigens, and forensic applications".

Clinica Chimica Acta. Vol. 363(1): pp. 165-176.

Yamaguchi, H., Y. Okubo, T. Seno, K. Matsushita & G.L. Daniels. 1979. "A 'new'

allele, Kpc, at the Kell complex locus". Vox Sang. Vol. 36(1): pp. 29-30.

Yamamoto, F.-i., H. Clausen, T. White, J. Marken & S.-i. Hakomori. 1990.

"Molecular genetic basis of the histo-blood group ABO system". Nature. Vol.

345(6272): pp. 229-233.

Yousuf, R., S. Abdul Aziz, N. Yusof & C.F. Leong. 2013. "Incidence of Red Cell

Alloantibody among the Transfusion Recipients of Universiti Kebangsaan

Malaysia Medical Centre". Indian Journal of Hematology & Blood


Zaidi, U., M. Borhany, S. Ansari, S. Parveen, S. Boota, I. Shamim, D. Zahid & T.

Shamsi. 2015. "Red cell alloimmunisation in regularly transfused beta

thalassemia patients in Pakistan". Transfusion Medicine. Vol. 25(2): pp. 106-

110.

170

APPENDIX A

ETHICAL APPROVAL LETTER FROM MEDICAL RESEARCH ETHICAL

COMMITTEE (MREC)

171

APPENDIX B

ETHICAL APPROVAL LETTER FROM UNIVERSITI KEBANGSAAN

MALAYSIA MEDICAL CENTRE (UKMMC)

172

APPENDIX C

PATIENT INFORMATION SHEET AND CONSENT FORM

175

APPENDIX D

BAGene DNA-SSP KITS WORKSHEET AND EVALUATION DIAGRAM

177

APPENDIX E

LIST OF PRESENTATIONS

NAME OF CONFERENCE TITLE

Conference of Pathology (CPATH),

Kuala Lumpur.

[13th

– 14th

June 2105]

A Comparison between Two Sampling

Methods for Extended Red Cell

Genotyping Using TaqMan Single

Nucleotide Polymorphisms

[Poster presentation]

Malaysian J Pathol 2015; 37(2) : pp.

198

Postgraduate Colloquium on Medical

Sciences 2015, Selangor.

[25th

– 26th

May 2015]

Can Buccal Swab Be Used In

Determination of Red Blood Cell

Profiling?

[Oral Presentation – Nomination for

Young Scientist Award]

National Research Seminar 2015, Perak.

[9th

May 2015]

Importance of Extended Blood Group

Genotyping in Multiply Transfused

Patients.

[Oral Presentation – Winner for Best

Paper Award]

Will be published in Journal of

Contemporary Issues and Thought,

Vol 6, 2016

3rd

National Conference on Medical

Laboratory Sciences, Kelantan.

[28th

– 30th

April 2015]

Red Blood Cell Profiling: A Comparison

between Serology and SNP RT-PCR in

Multiply Transfused Patients

[Oral Presentation]

178

International Congress of Pathology &

Laboratory Medicine (ICPaLM), Kuala

Lumpur.

[26th

– 28th

August 2014]

Low DNA Concentration From Buccal

Swab Can Be Used For Blood Group

Molecular Genotyping.

[Oral Presentation – Nomination for

Young Investigator‟s Award]

Malaysian J Pathol 2014; 36:

Supplement A: pp. 63. ISSN 0126-8635

International Congress of Pathology &

Laboratory Medicine (ICPaLM), Kuala

Lumpur.

[26th

– 28th

August 2014]

Alloantibody and Autoantibody

Immunization in Repeatedly Transfused

Thalassaemia Patients: Hospital Ampang

Experience.

[Poster Presentation]

Malaysian J Pathol 2014; 36:

Supplement A: pp. 102-103. ISSN

0126-8635

XIth Malaysian National Haematology

Scientific Meeting, Kuala Lumpur,

[4th

– 6th

April 2014]

A Living Infant With Homozygous

South-East Asian Hereditary

Ovalostomatocytosis.

[Poster Presentation]

179

APPENDIX F

AWARDS & ACHIEVEMENTS

Best Paper Award

Full paper will be published in Journal of Contemporary Issues and Thought, Vol 6,

2016.

180

Young Scientist Award Competition

181

Young Investigator’s Award

182

APPENDIX G

PROCEEDINGS / PUBLICATIONS

Malaysian J Pathol 2015; 37(2): pp. 198

183

Malaysian J Pathol 2014; 36: Supplement A: pp. 63. ISSN 0126-8635

184

Malaysian J Pathol 2014; 36: Supplement A: pp. 102-103. ISSN 0126-8635

186

Journal of Contemporary Issues and Thought, Vol 6, 2016.

nadila haryani bt osman_3130198_a comparison between using

Documents