promoter and signal sequence from filamentous fungus can drive recombinant protein production in the...

Bioresource Technology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Bioresource Technology

journal homepage: www.elsevier .com/locate /bior tech

Promoter and signal sequence from filamentous fungus can driverecombinant protein production in the yeast Kluyveromyces lactis

http://dx.doi.org/10.1016/j.biortech.2014.03.0020960-8524/� 2014 Elsevier Ltd. All rights reserved.

⇑ Corresponding author. Tel.: +91 471 2515368; fax: +91 471 2491712.E-mail address: [email protected] (R.K. Sukumaran).

Please cite this article in press as: Madhavan, A., Sukumaran, R.K. Promoter and signal sequence from filamentous fungus can drive recombinantproduction in the yeast Kluyveromyces lactis. Bioresour. Technol. (2014), http://dx.doi.org/10.1016/j.biortech.2014.03.002

Aravind Madhavan, Rajeev K. Sukumaran ⇑Centre for Biofuels, Biotechnology Division, CSIR-National Institute for Interdisciplinary Science and Technology, Industrial Estate PO, Trivandrum 695 019, India

h i g h l i g h t s

� First report on cross recognition of the core promoter elements from filamentous fungus in yeast.� T. reesei cbh1 promoter is recognized by K. lactis transcription machinery.� T. reesei cbh1 signal peptide is highly effective in secretion of recombinant protein in K. lactis.� Fungal promoter and secretion signal efficacy in K. lactis is proven by GFP expression.

a r t i c l e i n f o

Article history:Received 31 December 2013Received in revised form 26 February 2014Accepted 1 March 2014Available online xxxx

Keywords:PromoterSecretion signalCellobiohydrolaseHeterologous proteinsKluyveromyces

a b s t r a c t

Cross-recognition of promoters from filamentous fungi in yeast can have important consequencestowards developing fungal expression systems, especially for the rapid evaluation of their efficacy. Atruncated 510 bp inducible Trichoderma reesei cellobiohydrolase I (cbh1) promoter was tested for theexpression of green fluorescent protein (GFP) in Kluyveromyces lactis after disrupting its native b-galac-tosidase (lac4) promoter. The efficiency of the CBH1 secretion signal was also evaluated by fusing it tothe lac4 promoter of the yeast, which significantly increased the secretion of recombinant protein in K.lactis compared to the native a-mating factor secretion signal. The fungal promoter is demonstrated tohave potential to drive heterologous protein production in K. lactis; and the small sized T. reesei cbh1secretion signal can mediate the protein secretion in K. lactis with high efficiency.

� 2014 Elsevier Ltd. All rights reserved.

1. Introduction

Well established promoter elements are required for develop-ing expression systems, studying gene regulation, metabolicengineering and more recently for synthetic biology approaches.Hybrid promoter approaches are established in many yeast speciesby combining native core promoter elements to upstream activatorsequence (UAS) elements for increasing heterologous proteinproduction and other metabolites. Many authors have reportedthe hybrid promoter approach in Saccharomyces cerevisiae bycombining promoter elements from different species of the samegenus (Rosenberg and Tekamp-Olson, 1992). In this work wepresent a hybrid promoter approach by combining Trichodermareesei cellobiohydrolase1 (cbh1) core promoter region to the 50

promoter elements of the b-galactosidase (lac4) promoter ofKluyveromyces lactis for increasing recombinant protein productionin the yeast.

The commercial K. lactis expression system uses lactose induc-ible promoter (PLAC4) for recombinant protein production and theproteins are secreted, which reduces the cost of downstream pro-cessing. Efficient extracellular secretion and the high cell densitiesattained in submerged growth makes this organism an attractivehost for recombinant protein production (Gellissen and Hollen-berg, 1997; Swinkels et al., 1993; Van den Berg et al., 1990; vanOoyen et al., 2006). However, the cross recognition of PLAC4 inEscherichia coli can interfere with the assembling of expressionconstructs in the bacteria before being introduced into the yeast(Colussi and Taron, 2005). Cbh1 promoter of T. reesei is one of thestrongest inducible promoters of fungal world and hence used forthe construction of expression vectors (Nyyssonen and Keranen,1995; Zou et al., 2012). The promoter is induced by lactose and isunder the tight regulation by several transcription factors (Kubiceket al., 2009). Many inducible promoters are interchangeable amongother species of the same genus, both in filamentous fungus andyeast. But cross recognition of promoters across different classesis an interesting possibility that has not been described so far.

protein

http://dx.doi.org/10.1016/j.biortech.2014.03.002

mailto:[email protected]


http://www.sciencedirect.com/science/journal/09608524

http://www.elsevier.com/locate/biortech


2 A. Madhavan, R.K. Sukumaran / Bioresource Technology xxx (2014) xxx–xxx

Secretion of the recombinant proteins has several advantagesover intracellular localization. Extracellular expression stays in-duced for longer compared to the intracellular expression and isalso advantageous for the expression of toxic proteins. Anotheradvantage is the easy downstream processing, since the cellharvesting and disruption steps may be avoided and the proteinproduct is relatively pure.

The use of fungal secretion signal in driving recombinant pro-tein production in yeasts has attained much attention recently.Most of the yeast expression systems contain the S. cerevisiae a fac-tor pre pro signal as the secretion signal. The cellobiohydrolase I(CBH1) secretion signal from T. reesei is relatively small comparedto other secretion signals, making this a suitable candidate for driv-ing heterologous protein production in yeast. Very few secretionsignals of fungal origin are used in yeast expression systems,including the signal peptide of Rhizopus oryzae amylase (Li andWang, 2011) and Aspergillus awamori glucoamylase (Fierobeet al., 1997). But all these signal peptides are typically used forexpressing their own native proteins and not for other (heterolo-gous) proteins. Signal peptides differ in their capacity to secreteproteins and the selected secretion signal should be compatibleto a variety of proteins.

Promoters and secretion signal peptides are the crucial ele-ments for controlling heterologous protein production in yeastand fungus. The present study was aimed to investigate the crossrecognition of filamentous fungal promoter in yeast, by construct-ing a hybrid promoter element. This was performed by combiningthe essential region of T. reesei cbh1 promoter and the 50 promoterelements of K. lactis and evaluating it for recombinant protein pro-duction. Also, the efficiency of CBH1 secretion signal was analyzedby fusing the signal peptide to enhanced green fluorescent protein(EGFP).

2. Methods

2.1. Strains and growth conditions

E. coli DH5a cells were cultivated in Luria Bertani medium(Himedia, India). YPD agar (Himedia, India) plates were used forgrowth of K. lactis. Transformants of K. lactis were selected onYCB agar (New England Biolabs, USA) containing 5 mM acetamide.

2.2. Construction of a pKlac vector lacking functional promoter

To test the functionality of the cbh1 promoter in K. lactis, thepKlac1 expression vector was engineered by removing part of thelac4 promoter including TATA boxes (�230, �170, �142) andUAS 1 and 2 (�326, �435) which is essential for induction. Thiswas achieved by PCR using the engineered primers KlacF and KlacR(Table 1). The whole region resided within approximately –700bases from the start codon. The whole vector was ligated and

Table 1Oligo nucleotide primers used for the study.

Primer Primer sequence (50-30)

KlacF GGCAAGCTTGAAAAAAATGAAATTCTCTACTATKlacR AAGAAGCTTCCCTGAACTTTGCGGTGAACAGAATSigF ATTAAGCTTATGTATCGGAAGTTGGCCGTCATCTCGF2 AATTCTAGAATGGTGAGCAAGGGCGAGGAGCTGTCBFR1 AATCTAGAGGCCGACTGAGCACGAGCTGTGGCCGFPR1 AACCAGAGCTCCTTAATCACTTACTTGTACAGCTCGTCCATGCCCBHT1F ATAAGGAGCTCCAGTCTCACTACGGCCAGTGCGGCCBHTR1 TGAATGGTACCGGTCCTCGGCTACGTTGTCATCGTCCBH1CF AATCTCGAGAGGGATGCTTGAGTGTATCGTGEGFPF AAGCTCGAGATGGTGAGCAAGGGCGAGGAGCEGFPR AAGGGTACCTTACTTGTACAGCTCGTCCATGC

Please cite this article in press as: Madhavan, A., Sukumaran, R.K. Promoter anproduction in the yeast Kluyveromyces lactis. Bioresour. Technol. (2014), http:/

transformed into E. coli DH5a cells. The deletion was confirmedby sequencing of the construct.

2.3. Construction of pCBH1-EGFP-TCBH1 expression cassette

Fungal DNA isolation was performed by Cetyl Trimethyl Ammo-nium Bromide (CTAB) method (Stewart and Via, 1993) and all DNAmanipulations were performed by standard methods as outlined inSambrook et al. (2001). The primers used for PCR amplification ofvarious sequences are listed in Table 1. The truncated cbh1 pro-moter of T. reesei with native signal peptide was PCR amplifiedusing the primers CBH1CF and CBFR1, cloned into pTZ57R/T vector(Fermentas, USA) and sequenced. The EGFP gene, lacking anysecretion signal was amplified from pEmGFP (Life Technologies,USA) using CGF2 and GFPR1 and the amplicon was fused to the30 end of truncated cbh1 promoter. The cbh1 transcription termina-tor was PCR amplified from T. reesei genomic DNA using primersCBHT1F and CBHTR1 and fused to the 30 end of the construct.The whole cassette was constructed by ligation PCR method andwas cloned into the MCS of the pKLac vector lacking functionalpromoter (pKLac⁄) constructed as mentioned above. The EGFPalone was cloned in pKlac⁄ as a negative control.

2.4. Construction of CBH1 signal peptide-EGFP fusion and evaluation ofthe secretion efficiency of signal peptides

CBH1 secretion signal peptide sequences were analyzed usingthe Signal P 3.0 HMM software (Bendtsen et al., 2004). For determi-nation of the secretion signal strength, signal peptide of CBH1(CBH1SS) was PCR amplified using SigF and EGFPR primer pairs(Table 1) and fused in-frame to the 50 end of the EGFP codingsequence. The construct was introduced into unmodified pKlacvector downstream of its native lac4 promoter. EGFP cloned down-stream of the native a mating factor secretion signal (aMFSS) wasused as control. Secretion efficiency of the signal peptides wasmeasured as fluorescence emission of the secreted GFP fromculture fluids.

2.5. Transformation of K. lactis cells

After linearization with Sac11, the plasmids were transformedinto K. lactis cells by electroporation using an electroporator(Eppendorf, Germany) with a 2 mm electroporation cuvette. Theconditions used were: a sample volume of 100 ll, charging voltageof 1.8 kV, and capacitance of 25 lF. Integration of the expressioncassette into the genome occurred by homologous recombinationinto the lac4 locus. Transformed colonies were selected on YPD-acetamide plates and were incubated at 30 �C for 3–4 days. Thetransformants were analyzed by PCR amplification with the spe-cific primers CBH1CF and CBHTR1 (Table 1).

2.6. Expression of GFP in K. lactis

2.6.1. Confocal microscopyIntracellular expression of EGFP from the cbh1 promoter was

monitored as the fluorescence emission due to GFP accumulationin the cells. Cells grown for 24 h in lactose containing mediumwere harvested by centrifugation (15450g, 10 min), washed twicewith distilled water and were resuspended in distilled water fol-lowed by imaging of the intra cellular fluorescence using BD path-way 855 Confocal microscope (BD Biosciences, USA).

2.6.2. Flow cytometric analysesK. lactis cells expressing EGFP were used for flow cytometry

analyses. The cells grown for 36 h were diluted in phosphate buf-fered saline to a final concentration of 1 � 107 cells/ml. For each

d signal sequence from filamentous fungus can drive recombinant protein/dx.doi.org/10.1016/j.biortech.2014.03.002


A. Madhavan, R.K. Sukumaran / Bioresource Technology xxx (2014) xxx–xxx 3

measurement, data from 10,000 single cell events were collectedusing a Fluorescence Activated Cell Sorter (BD FACS Aria II, USA)equipped with 488 and 561-nm excitation lasers. The results wereanalyzed using BD FACS Diva� software.

2.6.3. Measurement of fluorescence intensitySupernatant and cells were subjected to fluorescent intensity

analyses using a multimode plate reader (Tecan Infinite Pro 200,Switzerland) with excitation and emission wavelengths of 488and 520 nm respectively. Cell-free supernatant (50 ll) was mixedwith 150 ll refolding buffer (0.05 M NaH2PO4, 0.1 M NaCl, and0.5 M Imidazole) and the fluorescence intensity was measured.For fluorescent intensity measurements, 50 ll cell suspensionswere centrifuged at 13400g for 2 min at room temperature, andthe cells washed 3 times with the refolding buffer, were suspendedin 200 ll of the same buffer.

2.6.4. Poly acrylamide gel electrophoresis (PAGE) and Western blotanalysis

Cells were harvested after 36 h of growth by centrifugation at15450g for 2 min. The total protein concentration in the culturefluid was determined by Bradford’s method (1976). The proteinin the supernatant was precipitated using 10� volumes of 12% Tri-chloroacetic acid (TCA) in acetone, and the precipitate was recov-ered by centrifugation at 13400g for 20 min at 4 �C. The pelletswere washed thrice with acetone, air dried and was resuspendedin distilled water. Samples normalized for their protein contentwere loaded on either 12% Native or SDS poly acrylamide gelsand were separated electrophoretically (Laemmli, 1970).

Fig. 1. Schematic diagram representing construction of expression cas


Native PAGE bands were excited by long wavelength (302 nm)UV for observing the GFP fluorescence. Digital images were cap-tured and documented. The EGFP protein present in the superna-tant was further analyzed by Western blotting. The proteins wastransferred onto a PVDF membrane by semi-dry blotting and wasdetected with Rabbit aGFP IgG-HRP conjugate (Life technologies,USA) using the chromogenic substrate 3, 305, 50 Tetramethyl Benzi-dine (TMB). Digital Images of the Western Blot were captured anddensitometric analysis of the signal intensities were performedusing ImageJ software (Schneider et al., 2012).

3. Results and discussion

3.1. T. reesei cbh1 promoter is recognized by the K. lactis transcriptionmachinery

Deletion of the TATA boxes and UAS elements affects transcrip-tion initiation and b galactosidase induction in K. lactis (Ficca andHollenberg, 1989). The pKlac vector was modified by disruptingthree TATA box like elements and UAS elements of its native lac4promoter so as to make the vector unable to initiate transcriptionfrom its own promoter elements. The modified pKlac vector(pKlac⁄) lacked lac4 promoter functionality confirmed by its failureto express the cloned EGFP gene. The promoter for EGFP expressionwas created by inserting a 510 bp truncated core cbh1 promoter ofT. reesei downstream of the disrupted lac4 promoter in pKlac(Fig. 1). Cross recognition of T. reesei cbh1 promoter in K. lactiswas tested by cloning the CBH1-EGFP-TCBH1 expression cassettein pKlac⁄. Linearized vector was electroporated into K. lactis cellsand successful chromosomal integration was confirmed by PCR

sette for EGFP expression from T. reesei cbh1 promoter in K. lactis.



Fig. 2. Chromosomal integration of the expression cassette PCBH1-CBH1SS-EGFP-CBH1T PCR amplification of the 2039 bp PCBH1-CBH1SS-EGFP-CBH1T expressioncassette from K. lactis genomic DNA. Lane M-1 kb ladder (Fermentas), Lane 1-PCRreaction using primers for expression cassette and non-transformed K. lactisgenomic DNA as template. Lane 2-PCR amplicon of the expression cassette obtainedfrom genomic DNA of recombinant K. lactis as template (�2000 + bp).

Fig. 3. Flow cytometric analysis of K. lactis showing GFP expression by therecombinant cells Flow cytometric analysis of cells expressing GFP. (A) PCBH1-CBH1SS-EGFP-CBH1T K. lactis cells expressing GFP are indicated by the greenfluorescence (FITC-A/X axis) vs Forward scatter (FSC-A)–Y axis. �10% of the cellssatisfy the minimum threshold of green fluorescence to qualify as GFP + ve.Confocal image showing expression of GFP by the recombinant K. lactis cells is givenas inset. (B) K. lactis cells with pKlac⁄ containing EGFP insert, but with the disruptedlac4 promoter. These cells do not show green fluorescence and hence are notexpressing GFP. Signals in the negative quadrant are from auto fluorescence of cellsand debris.


amplification of a 2039 bp fragment using primers specific for theexpression cassette (Fig. 2). Sequencing results confirmed the in-frame construction of the cassette. Cross recognition of the T. reeseicbh1 promoter in K lactis was confirmed by EGFP expression mon-itored as the green fluorescence of recombinant cells. Confocalimaging showed that the cells are indeed synthesizing GFP andaccumulating at least a part of it inside the cells, since the yeastcells showed fluorescence characteristic of GFP (Fig. 3A).

Flow cytometric analysis conducted with recombinant K. lactiscells detected �1000 events of green fluorescence among the10,000 single cell events collected, indicating that about 10% ofthe recombinants were expressing EGFP from the hybrid promoter(Fig. 3A). There was practically no event from control K. lactis cellswith the EGFP gene cloned in pKlac⁄ with disrupted lac4 promoterand lacking cbh1 promoter (Fig. 3B). Lactose acted as an inducer forthe cbh1 promoter for driving the expression of EGFP in K. lactiscells. Lactose -the inducer for lac4 is also known to be an inducerfor cbh1 (Ilmen et al., 1997).

The recombinant K. lactis cells harboring the pKlac⁄ with EGFPexpression cassette secreted green fluorescent protein into the cul-ture medium containing lactose, as evidenced by the fluorescenceof the culture supernatants. Fluorescence intensity analyses indi-cated that the cbh1 driven EGFP expression was 7366 U comparedto 9866 U from the native lac4 promoter. Confirmation of the EGFPsecretion into medium was done by detecting the protein in Nativeand SDS PAGE and by Western blot analysis of the culturesupernatants.

A protein of 25 kDa, which is approximately equal to the pro-tein’s expected molecular weight, was detected in the supernatant(Fig. 4A). EGFP fluorescence was also detected in Native–PAGE un-der UV (Fig. 4B). Western blot analysis with Rabbit aGFP IgG-HRPconjugate also confirmed that the band detected is indeed GFP(Fig. 4C). Densitometry of the Western blot indicated that EGFPsecretion supported by cbh1 promoter, though lower, was notinsignificant in any way compared to that supported lac4 promoter(Fig. 4D). This indicated the efficient cross recognition of the T. ree-sei core promoter elements in K. lactis confirming the results offluorescent intensity analysis.

The mechanism by which cbh1 core promoter element is recog-nized by the K. lactis transcription machinery is unknown. The cbh1promoter of T. reesei contains a heterotrimeric CCAAT transcrip-tional activator protein (HAP) complex binding region, and thepresence of a similar HAP protein complex was reported in K. lactisby Mulder et al. (1994). The binding site for transcription factor‘‘Activator of Cellulase 2’’ (Ace2) is present in the 510 bp truncatedcbh1 promoter and the presence of K. lactis orthologues of S. cere-visiae Ace2 has been reported by Bussereau et al. (2006). The pres-ence of HAP protein binding elements and the Ace2 binding region


might have contributed to the cross recognition of cbh1 promoterin K. lactis. Several hybrid promoter approaches have been estab-lished in S. cerevisiae (Blazeck et al., 2011, 2012), but most of thesepromoter engineering concepts were focussed on UpstreamRepression Sequence (URS) elements or 50 UTR elements insteadof the core promoter elements (Hartner et al., 2008; Staley et al.,2012). Here, a hybrid promoter approach that utilizes fungal corepromoter elements in yeast for driving heterologous proteinexpression was successfully employed. While synthetic core pro-moter engineering has been used successfully in yeast to driveexpression of EGFP (Vogl et al., 2013), till date there are no reportson the use of naturally occurring core promoter from another classof organism in yeast. This opens up the possibilities of core pro-moter engineering across classes by incorporating essential corepromoter elements to create highly efficient hybrid promoters.

3.2. Cbh1 secretion signal is more efficient than the native secretionsignal of K. lactis

Comparison of the fluorescent intensities of the culturesupernatants of K. lactis cells harboring pKlac-CBH1SS-EGFP and



Fig. 4. EGFP expression from the native lac4 promoter and the T. reesei cbh1 promoter in K. lactis (A) SDS–PAGE showing �25 kDa EGFP protein expression (indicated by arrowheads) in the culture fluid of K. lactis with native lac4 or T. reesei cbh1 promoters. Lanes-M: SDS–PAGE Marker, 1&4: Host K. lactis culture fluid, 2&5: culture fluid of K. lactiswith vector but no insert, 3: Culture fluid of K. lactis with lac4 promoter and EGFP insert. 6: Culture fluid of K. lactis with cbh1 promoter and EGFP insert. (B) Fluorescence ofEGFP protein in Native PAGE of the culture fluids of K. lactis with lac4 (lane 1) and cbh1 (Lane 2) promoters. (C) Western Blot of EGFP protein from lac4 (Lane 1) and cbh1 (2)promoters. (D) Peaks showing the band intensities of GFP signals from Western blot: Lane 1-lac4 promoter, Lane 2 – cbh1 promoter. Numbers indicate area under the peakproportional to GFP concentration.

Fig. 5. EGFP secretion from K. lactis having native aMF secretion signal or T. reesei cbh1 secretion signal (A) SDS–PAGE showing �25 kDa secreted EGFP protein (indicated byarrow heads) in the culture fluid of K. lactis with native aMF secretion signal or T reesei cbh1 secretion signal. Lanes-M: SDS–PAGE Marker, 1&4: Host K. lactis culture fluid,2&5: culture fluid of K. lactis with vector but no insert, 3: Culture fluid of K. lactis with aMF secretion signal. 6: Culture fluid of K. lactis with cbh1 secretion signal. (B)Fluorescence of EGFP protein in Native PAGE of the culture fluids of K. lactis with aMF (lane 1) and cbh1 (Lane 2) secretion signals. (C) Western Blot of EGFP protein from K.lactis with aMF (Lane 1) and cbh1 (Lane 2) secretion signals. (D) Peaks showing the band intensities of GFP signals from Western blot: Lane 1-aMF secretion signal, Lane 2 –cbh1 secretion signal. Numbers indicate area under the peak proportional to GFP concentration.


Please cite this article in press as: Madhavan, A., Sukumaran, R.K. Promoter and signal sequence from filamentous fungus can drive recombinant proteinproduction in the yeast Kluyveromyces lactis. Bioresour. Technol. (2014), http://dx.doi.org/10.1016/j.biortech.2014.03.002



pKlac-aMFSS-EGFP showed that there is �1.6-fold increase inextracellular EGFP secretion for the cells harboring CBH1SS com-pared to those with the native aMFSS. In cells with CBH1 secretionsignal, �95% of the GFP was secreted, while in cells with the nativeaMF secretion signal, only about 82% of the GFP was secreted. Thisalso indicated that majority of the EGFPs expressed was beingsecreted, except in the case of aMFSS, where a part of the EGFPsproduced was trapped inside the cell.

The efficiency of cbh1 secretion signal to aid in secretion of re-combinant proteins from K. lactis was also analyzed by SDS PAGE ofthe culture supernatants. EGFP in the culture supernatant washigher in K. lactis with CBH1 secretion signal compared to that fromthe yeast having aMF signal peptide (Fig. 5A). Native PAGE analysisalso confirmed a higher level secretion of EGFP by cells withCBH1SS (Fig. 5B). The secretion of recombinant EGFP was furtherconfirmed by Western blot using the HRP conjugated aGFP anti-body (Fig. 5C). Densitometry of the Western blot confirmed thatthe EGFP secretion is more than 2-fold higher in cells with CBH1secretion signal compared to those with the native aMF secretionsignal (Fig. 5D).

The CBH1 signal peptide described in the present study can be avery potent candidate for efficient extracellular secretion of recom-binant proteins in K. lactis as its amino acid sequence is very small(MYRKLAVISAFLATARAQSA). The a-mating factor secretion signal(aMFSS) of S. cerevisiae is the most widely used secretion signalin yeast system (Brake et al., 1984; Gurramkonda et al., 2010). Nev-ertheless, incomplete processing of the a-mating factor signal pep-tide has been reported in some recombinant proteins which mightlead to problems in efficient secretion of the protein(s) (Hashimotoet al., 1998; Koganesawa et al., 2001). Another important feature isthe absence of glycosylation sites in the CBH1 signal peptide as pre-dicted by NetNGlyc 1.0 (Gupta et al., 2004). This is advantageous asheterogeneous glycosylation can occur if the signal peptide is notremoved during post translational processing (Kottmeier et al.,2011).

Extensive research have been conducted to improve the secre-tary protein yield in yeast expression systems and still the problemis largely unresolved with highly unpredictable yield of secretedheterologous proteins. Recent attempts to improve protein secre-tion in Pichia pastoris expression system include engineering addi-tional copies of Kex2 endoprotease into the genome so as to allowan efficient cleavage of the secretion signal. (Yang et al., 2013). Thepresent study indicate that the use of T. reesei CBH1 secretion signalcan achieve very high efficiencies in secretion of heterologous pro-tein in the K. lactis, system which was better than its native aMFSSand could be applicable for other yeast expression systems also.

4. Conclusion

Cross recognition of the core promoter elements from fungus bytranscription machinery of the yeast K. lactis was demonstratedand the fungal promoter could drive the expression of heterolo-gous protein in yeast. The work proves that promoter recognitionacross class is possible and further improvements may be achievedby incorporating positive regulators of cbh1. The small sized CBH1secretion signal was more effective than the native aMFSS of K. lac-tis and it enhanced the secretion of heterologous protein in theyeast indicating potential for enhancing protein secretion in theyeast.

Acknowledgements

A.M. would like to acknowledge financial support from DST IN-SPIRE program in the form of a fellowship to support his Ph.D.work, for which this work forms a part. We thank the Dr K.G. Raghu


& the APNP division of CSIR-NIIST for flow cytometric analyses. Weacknowledge the help from Dr N. Ramesh Kumar for sequencingthe amplicons and constructs and for his creative suggestions.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.biortech.2014.03.002.

References

Bendtsen, J.D., Nielsen, H., von Heijne, G., Brunak, S., 2004. Improved prediction ofsignal peptides: signal P 3.0. J. Mol. Biol. 340, 783–795.

Blazeck, J., Garg, R., Reed, B., Alper, H.S., 2012. Controlling promoter strength andregulation in Saccharomyces cerevisiae using synthetic hybrid promoters.Biotechnol. Bioeng. 109, 2884–2895.

Blazeck, J., Liu, L., Redden, H., Alper, H., 2011. Tuning gene expression in Yarrowialipolytica by a hybrid promoter approach. Appl. Environ. Microbiol. 77, 7905–7914.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye binding.Anal. Biochem. 72, 248–254.

Brake, A.J., Merryweather, J.P., Coit, D.G., Heberlein, U.A., Masiarz, F.R., Mullen-bach,G.T., Urdea, M.S., Valenzuela, P., Barr, P.J., 1984. Alpha-factor directed synthesisand secretion of mature foreign proteins in Saccharomyces cerevisiae. Proc. Natl.Acad. Sci. USA 81, 4642–4646.

Bussereau, F., Casaregola, S., Lafay, J.F., Bolotin-Fukuhara, M., 2006. TheKluyveromyces lactis repertoire of transcriptional regulators. FEMS Yeast Res.6, 325–335.

Colussi, P.A., Taron, C.H., 2005. Kluyveromyces lactis LAC4 promoter variants thatlack function in bacteria but retain full function in K. Lactis. Appl. Environ.Microbiol. 71, 7092–7098.

Ficca, A.G., Hollenberg, C.P., 1989. Functional relationship among TATA sequences,gene induction and transcription initiation in the b-galactosidase, LAC4, genefrom Kluyveromyces lactis. Curr. Genet. 15, 261–269.

Fierobe, H.P., Mirgorodskaya, E., Frandsen, T.P., Roepstorff, P., Svensson, B., 1997.Overexpression and characterization of Aspergillus awamori wild-type andmutant glucoamylase secreted by the methylotrophic yeast Pichia pastoris:comparison with wild-type recombinant glucoamylase produced usingSaccharomyces cerevisiae and Aspergillus niger as hosts. Protein Expr. Purif. 9,159–170.

Gellissen, G., Hollenberg, C.P., 1997. Application of yeasts in gene expressionstudies: a comparison of Saccharomyces cerevisiae, Hansenula polymorpha andKluyveromyces lactis – a review. Gene 190, 87–97.

Gupta, R., Jung, E., Brunak, S., 2004. Prediction of N-glycosylation sites in humanproteins. Unpublished. Web server – <http://www.cbs.dtu.dk/services/NetNGlyc/>.

Gurramkonda, C., Polez, S., Skoko, N., Adnan, A., Gabel, T., Chugh, D., Swaminathan,S., Khanna, N., Tisminetzky, S., Rinas, U., 2010. Application of simple fed-batchtechnique to high level secretory production of insulin precursor using Pichiapastoris with subsequent purification and conversion to human insulin. Microb.Cell Fact. 9, 34.

Hartner, F.S., Ruth, C., Langenegger, D., Johnson, S.N., Hyka, P., Lin-Cereghino, G.P.,Lin-Cereghino, J., Kovar, K., Cregg, J.M., Glieder, A., 2008. Promoter librarydesigned for fine-tuned gene expression in Pichia pastoris. Nucleic Acids Res. 36,e76.

Hashimoto, Y., Koyabu, N., Imoto, T., 1998. Effects of signal sequences on thesecretion of hen lysozyme by yeast: construction of four secretion cassettevectors. Prot. Eng. 11, 75–77.

Ilmen, M., Saloheimo, A., Onnela, M.L., Pentilla, M.E., 1997. Regulation of cellulasegene expression in the filamentous fungus Trichoderma reesei. Appl. Environ.Microbiol. 63, 1298–1306.

Koganesawa, N., Aizawa, T., Masaki, K., Matsuura, A., Nimori, T., Bando, H., Kawano,K., Nitta, K., 2001. Construction of an expression system of insect lysozymelacking thermal stability: the effect of selection of signal sequence on level ofexpression in the Pichia pastoris expression system. Prot. Eng. 14, 705–710.

Kottmeier, K., Ostermann, K., Bley, T., Rodel, G., 2011. Hydrophobin signal sequencemediates efficient secretion of recombinant proteins in Pichia pastoris. Appl.Microbiol. Biotechnol. 91, 133–141.

Kubicek, C.P., Mikus, M., Schuster, A., Schmoll, M., Seiboth, B., 2009. Metabolicengineering strategies for the improvement of cellulase production by Hypocreajecorina. Biotechnol. Biofuels. 2, 19.

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of thehead of bacteriophage T4. Nature 227, 680–685.

Li, S., Wang, Z., 2011. Improved expression of Rhizopus oryzae a-amylase in themethylotrophic yeast Pichia pastoris. Protein Expr. Purif. 79, 142–148.

Mulder, W., Scholten, I.H., de Boer, R.W., Grivell, L.A., 1994. Sequence of the HAP3transcription factor of Kluyveromyces lactis predicts the presence of a novel 4-cysteine zinc-finger motif. Mol. Gen. Genet. 245, 96–106.




http://refhub.elsevier.com/S0960-8524(14)00301-0/h0005

































http://www.cbs.dtu.dk/services/NetNGlyc/

http://www.cbs.dtu.dk/services/NetNGlyc/



































Nyyssonen, E., Keranen, S., 1995. Multiple roles of the cellulase CBHI in enhancingproduction of fusion antibodies by the filamentous fungus Trichoderma reesei.Curr. Gene. 28, 71–79.

Rosenberg, S., Tekamp-Olson, P., 1992. Enhanced yeast transcription employinghybrid GAPDH promoter region constructs. U.S. patent 5089398.

Sambrook, J., Maccallum, P., Russel, D., 2001. Molecular cloning: a laboratorymanual, third ed. Cold Spring Harbour Press, New York.

Schneider, C.A., Rasband, W.S., Eliceiri, K.W., 2012. NIH Image to ImageJ: 25 years ofimage analysis. Nat. Methods. 9, 671–675.

Staley, C.A., Huang, A., Nattestad, M., Oshiro, K.T., Ray, L.E., Mulye, T., Li, Z.H., Le, T.,Stephens, J.J., Gomez, S.R., Moy, A.D., Nguyen, J.C., Franz, A.H., Lin-Cereghino, J.,Lin-Cereghino, G.P., 2012. Analysis of the 50untranslated region (50UTR) of thealcohol oxidase 1 (AOX1) gene in recombinant protein expression in Pichiapastoris. Gene 496, 118–127.

Stewart, C.N., Via, L.E., 1993. A rapid CTAB isolation technique useful for RAPDfingerprinting and other PCR applications. Biotechniques 14, 748–749.

Swinkels, B.W., Van Ooyen, A.J.J., Bonekamp, F.J., 1993. The yeast Kluyveromyceslactis as an efficient host for heterologous gene expression. Antonie VanLeeuwenhoek 64, 187–201.


Van den Berg, J.A., Van der Laken, K.J., Van Ooyen, A.J., Renniers, T.C., Rietveld, K.,Schaap, A., Brake, A.J., Bishop, R.J., Schultz, K., Moyer, D., 1990. Kluyveromyces ahost for heterologous gene expression: expression and secretion ofprochymosin. Biotechnology 8, 135–139.

Van Ooyen, A.J., Dekker, P., Huang, M., Olsthoorn, M.M., Jacobs, D.I., Colussi, P.A.,Taron, C.H., 2006. Heterologous protein production in the yeast Kluyveromyceslactis. FEMS Yeast Res. 6, 381–392.

Vogl, T., Ruth, C., Pitzer, J., Kickenweiz, T., Glieder, A., 2013. Synthetic corepromoters for Pichia pastoris. ACS Synth. Biol.. http://dx.doi.org/10.1021/sb400091p.

Yang, S., Kuang, Y., Li, H., Liu, Y., Hui, X., Li, P., Jiang, Z., Zhou, Y., Wang, Y., Xu, A., Li,S., Liu, P., Wu, D., 2013. Enhanced production of recombinant secretary proteinsin Pichia pastoris by optimizing Kex2 P10 site. PLoS ONE 8, e75347. http://dx.doi.org/10.1371/journal.pone.0075347.

Zou, G., Shi, S., Jiang, Y., van den Brink, J., de Vries, R.P., Chen, L., Zhang, J., Ma, L.,Wang, C., Zhou, Z., 2012. Construction of a cellulase hyper-expression system inTrichoderma reesei by promoter and enzyme engineering. Microb. Cell Fact. 11,21.





























http://dx.doi.org/10.1021/sb400091p

http://dx.doi.org/10.1021/sb400091p

http://dx.doi.org/10.1371/journal.pone.0075347

http://dx.doi.org/10.1371/journal.pone.0075347






promoter and signal sequence from filamentous fungus can drive recombinant protein production in the...

Documents