Recombinant expression and characterization of a novelendoglucanase from Bacillus subtilis in Escherichia coli

Muddassar Zafar • Sibtain Ahmed •

Muhammad Imran Mahmood Khan •

Amer Jamil

Received: 18 April 2013 / Accepted: 22 January 2014

� Springer Science+Business Media Dordrecht 2014

Abstract The goal of this work was to produce high

levels of endoglucanase in Escherichia coli for its potential

usage in different industrial applications. Endoglucanase

gene was amplified from genomic DNA of Bacillus subtilis

JS2004 by PCR. The isolated putative endoglucanase gene

consisted of an open reading frame of 1,701 nucleotides

and encoded a protein of 567 amino acids with a molecular

mass of 63-kDa. The gene was cloned into pET-28a(?) and

expressed in E. coli BL21 (DE3). Optimum temperature

and pH of the recombinant endoglucanase were 50 �C and

9, respectively which makes it very attractive for using in

bio-bleaching and pulp industry. It had a KM of 1.76 lmol

and Vmax 0.20 lmol/min with carboxymethylcellulose as

substrate. The activity of recombinant endoglucanse was

enhanced by Mg2?, Ca2?, isopropanol and Tween 20 and

inhibited by Hg2?, Zn2?, Cu2?, Ni2? and SDS. The

activity of this recombinant endoglucanase was signifi-

cantly higher than wild type. Therefore, this recombinant

enzyme has potential for many industrial applications

involving biomass conversions, due to characteristic of

broad pH and higher temperature stability.

Keywords Expression � Purification � Endoglucanase �Bacillus subtlis � Carboxymethylcellulase

Introduction

Cellulose is the most abundant organic polymer in this

planet and is an important renewable energy source along

with sugars and starches [1]. Cellulase degradation and its

subsequent utilizations are important for global carbon

sources. The value of cellulose as a renewable source of

energy has made cellulose hydrolysis the subject of intense

research and industrial interest [2, 3].

Cellulases and hemicellulases are two important classes

of enzymes produced by microorganisms including fila-

mentous fungi and secreted into the cultivation medium [4,

5]. Cellulase enzymes, which can hydrolyze cellulose

forming glucose and other commodity chemicals, can be

divided into three types: endoglucanase (endo-1, 4-b-D-

glucanase, EG, EC 3.2.1.4); exoglucanase (also called as

cellobiohydrolase) (exo-1,4-b-D-glucanase, CBH, EC

3.2.1.91) and b-glucosidase (1,4-b-D-glucosidase, BG, EC

3.2.1.21) [6]. The cleavage of cellulose is based on syn-

ergistic actions of exo-b-1,4-glucanase (EC 3.2.9.11),

endo-b-1,4-glucanase (EC 3.2.1.4) and b-glucosidase (EC

3.2.1.21) [7]. Endoglucanases are mainly responsible for

hydrolyzing the internal glycosidic bond to decrease the

length of the cellulose chains.

Cellulases play key role in increasing the yield of the fruit

juices, beer filtration, oil extraction and in improving the

nutritive quality of bakery products and animal feed [8]. The

application of cellulases to the hydrolysis of lignocellulosic

M. Zafar � A. Jamil (&)

Department of Biochemistry, Pir Mehr Ali Shah Arid

Agriculture University, Rawalpindi, Pakistan

e-mail: amerjamil@yahoo.com

S. Ahmed

Department of Chemistry and Biochemistry, University of

Agriculture, Faisalabad, Pakistan

S. Ahmed (&)

University of California, San Diego, 9500 Gilman Drive,

La Jolla, CA 92093, USA

e-mail: sibtain@ucsd.edu

M. I. M. Khan

School of Biological Sciences, University of the Punjab, Lahore,

Pakistan

123

Mol Biol Rep

DOI 10.1007/s11033-014-3192-8

materials (biomass) in order to further convert the released

fermentable sugars into ethanol has increased because of their

worldwide demand for renewable fuels [9]. Xylanases and

cellulases together with pectinases account for 20 % of the

world enzyme market [10, 11]. There are many industrial

applications of endoglucanases such as in animal feed pro-

duction, in processing of beer and fruit juice [12].

Elevated temperatures (above 40 �C) during industrial

processes result in decrease of activity of native glucan-

ases. So the search for recombinant endoglucanase with

enhanced activity and improved thermal stability continues

[13]. Therefore, exploration of new microbes capable of

producing cellulolytic enzymes with increased specific

activities and higher efficiency are always welcomed [14].

For the purpose of optimization of industrial processes and

energy saving, it is necessary that endoglucanases exhibit

reasonably high activities [15]. Cellulases have been pro-

duced by many fungal and bacterial strains. Bacteria have

good potential for cellulase production because their

growth rate is much higher than fungi. However there is not

sufficient information available for recombinant expression

of cellulases for industrial applications.

Escherichia coli is a very important microorganism for

scientist working on ceullosic biofuels because of its ease of

genetic manipulation. E. coli has been manipulated for ethanol

production [16], advanced biofuel molecules, such as butanol

[17], fatty acids [18], biodiesel [19] and alkanes/alkenes [20].

Although E. coli is well known to be an ideal host for

recombinant protein production, secreting proteins into the

extracellular medium has been a difficult task in E. coli [21]. If

E. coli could efficiently secrete recombinant proteins, such as

cellulases, a consolidated bioprocessing approach could be

applied where the same organism could hydrolyze the bio-

mass and produce biofuel [22]. A few attempts have been

made in this regard by various groups [19, 20], but there is a

need for a systematic analysis of this approach.

Advancement in gene manipulation techniques has

created a favorable environment for production and appli-

cations of cellulases at industrial level. The introduction of

new techniques and search for improved strains of micro-

organisms to be used in industry has led towards multitude

of future industrial potential of cellulases. In this study,

cloning and sequencing of the gene encoding endoglucanse

and its heterologous expression in E. coli are described

along with the characterization of recombinant enzyme.

Materials and methods

Materials

Carboxymethylcellulose (CMC), Cellulose, glucose, malt-

ose, 5-bromo-4-chloro-3-indoyl-b-D-galactopyranoside

(X-Gal) and isopropyl-1-thio-b-D-galactopyranoside

(IPTG) were purchased from Sigma, USA. Genomic DNA

isolation kits, cloning and expression vectors, restriction

enzymes, modifying enzymes, T4 DNA ligase and Taq

DNA polymerase were obtained from Fermentas. Kits used

for the isolation of plasmid DNA were from Qiagen. The

bacterial strain was selected on Luria–Bertani (LB) med-

ium and cultured in LB broth. The antibiotics, ampicillin

and kanamycin were obtained from Sigma and were used

for selection with concentrations of 100 and 50 lg/mL,

respectively.

Microorganism and plasmids

Bacillus subtilis was used as a source for the amplification

of endoglucanse gene in the present study. It was isolated

in the laboratory from the alkaline soil sample and desig-

nated as B. subtilis JS2004. B. subtilis JS2004 was cultured

in LB medium containing 1 % CMC at 37 �C.

pTZ57R/T cloning vector was used for sequencing en-

doglucanse gene. E. coli BL21 and vector pET-28(?) were

used for expression of endoglucanase.

Cloning and sequence analysis of endoglucanase gene

Standard protocols were employed for the DNA manipu-

lations [23]. Genomic DNA of B. subtilis JS2004 was

isolated as described previously [24]. Endoglucanse gene

was isolated from genomic DNA of B. subtilis JS2004 by

PCR technique using primers MZ1 and MZ2 (Table 1).

The PCR amplification procedure consisted of an initial

denaturing step of 5 min at 94 �C, followed by 30 cycles of

denaturation (94 �C) for 1 min, 1 min annealing (56 �C)

and 1 min elongation (72 �C). The amplified gene was

purified from the agarose gel after electrophoresis using

Qiagen DNA extraction kit and ligated into the pTZ57R/T

cloning vector. The ligation mixture was placed at 22 �C

overnight. Transformations were performed by heat shock

method [23]. The bacteria transformed with the ligation

mixture were spread on IPTG-XGAL-LB-agar-ampicillin

plates. The ampicillin was added in the medium to a final

concentration of 100 lg/mL and the plates with bacteria

were incubated at 37 �C overnight. The recombinant col-

onies were isolated by blue/white screening method. The

Table 1 Primers used in this study

Primers Sequences (50? 3

0)

MZ1 CCATGGATCATGAGGATGTGAAAACTC

MZ2 CTCGAGTGAATTGGTTGTCTGAGCTG

MZ3 CAGTCCCATGGGAAAACTCTCG

MZ4 GCGTGCATCTCGAGTCTTGTC TTAAACCC

Mol Biol Rep

123

positive transformants were re-plated on IPTG-Xgal-LB-

agar-ampicillin plates. After isolation of plasmid DNA

through MiniPrep kit (Qiagen), it was digested with BamHI

and EcoRI restriction enzymes using appropriate buffer at

37 �C for one hour.

The endoglucanase gene was sequenced from DNA

sequencing facility of Centre for Applied Molecular Biol-

ogy (CAMB), Lahore, Pakistan. GenBank was used for the

retrieval of DNA sequence, PRF was used to get peptide

information, SwissProt was used to get functional infor-

mation and PIR was used for structural classification of

protein [25].

Expression of the endoglucanase gene in E. coli

Endoglucanse gene was amplified from B. subtilis JS2004

using primers MZ3 and MZ4 (Table 1), which have the

restriction sites for NcoI and XhoI, for expression in pET-

28a(?). The amplified endoglucanase gene was digested by

NcoI and XhoI and ligated into the corresponding sites of

pET-28a(?) expression vector. The recombinant plasmid

pET-28a(?)-e.g. was transformed in E. coli (BL21) strain.

The recombinant strain was grown in LB medium containing

100 lg/mL kanamycin. The culture was induced at 0.6

OD600nm by the addition of isopropyl-b-D-thiogalactopyra-

noside (IPTG) After addition of IPTG, fractions of the cul-

ture were collected at intervals of 2, 4, 6, 8 and 10 h for

measuring absorbance and SDS-PAGE analysis. The inducer

(IPTG) was added to the culture at different concentrations

(0.1–1 mM). The culture was allowed to incubate up to 16 h

at 37 �C. One mL culture from each flask was collected and

centrifuged for 3 min at 3,000g. The pellets were resus-

pended and subjected to expression analysis by SDS-PAGE.

Purification of the recombinant endoglucanse

Recombinant E. coli expressing endoglucanse at maximum

activity was sonicated and centrifuged at 8,000g for

15 min. The supernatants were precipitated in 60 %

ammonium sulphate. The reaction was carried out at 4 �C

for 50 min. After dissolution, the sonicated product was

dialyzed overnight with 50 mM Glycine-NaOH buffer (pH

9). The protein was further purified by affinity chroma-

tography using HiTrap IMAC HP column (Sigma-Aldrich)

following manuals instructions.

Recombinant enzyme characterization

Optimum pH and temperature

Optimum pH of the recombinant enzyme was determined

by measuring its activity at different pH values (3–12). The

buffers used for this purpose included 50 mM concentra-

tions of citric acid buffer (pH 3–6), phosphate buffer (pH

6–8), Tris–HCl (pH 8–9) and glycine-NaOH buffer (pH

9–10). Before addition of the substrate, enzyme fractions

were incubated with buffers for 90 min and enzyme

activity was determined by Dinitrosalicylic acid (DNS)

method. The enzyme was incubated in 50 mM Glycine-

NaOH buffer (pH 9) at different temperatures (25–65 �C)

up to 4 h and optimum temperature was assayed.

Determination of substrate specificity and kinetics

parameters of recombinant endoglucanase

The substrate specificity of purified recombinant endoglu-

canase was determined by employing different substrates:

CMC, pNPC, avicel, cellubiose, alpha-glucan and xylan.

For determination of Michaelis constant (KM) and maxi-

mum velocity (Vmax), the enzyme was treated with 50 mM

Glycine-NaOH buffer (pH 9) using CMC as substrate with

0.15–2.5 lmol concentrations. Lineweaver–Burk plots

were drawn for the determination of the Vmax and KM.

Effect of metal ions and chemicals on recombinant

endoglucanse activity

The effect of metal ions and other chemicals on recombi-

nant endoglucanase activity was also studied. For this

purpose, purified recombinant enzyme extract in glycine-

NaOH buffer (50 mM, pH 9) was incubated (15 min,

37 �C) with HgCl2, ZnCl2, CuCl2, NiCl2, CaCl2, SDS,

isopropanol, b-mercaptoethanol and tween 20. The enzyme

activity was defined as 100 % in the absence of metal ion

[26].

SDS PAGE analysis

SDS–polyacrylamide gel electrophoresis was performed

for the analysis of expression of recombinant endoglu-

canase. For molecular mass determination, a prestained

protein molecular weight marker was used and proteins

were stained with Coomassie brilliant blue [27].

Endoglucanse assay

The activity of endoglucanase was assayed. Briefly two

hundred microlitres of diluted enzyme was added to

1.8 mL of carboxymethylcellulose (1 %) prepared in

NaOH-glycine buffer (pH 9) and incubated at 40 �C for

30 min. The reaction was stopped by addition of 3.0 mL

DNS and then the reaction mixture was incubated in water

bath at 100 �C for 15 min [28] and ice cooled for color

stabilization. The absorbance was noted at 540 nm. The

Mol Biol Rep

123

enzyme unit was defined as the amount of enzyme liber-

ating 1 lg reducing sugar equivalent to glucose per minute.

Determination of protein concentration

Protein concentration was determined by Bradford method

[29]. Bovine serum albumin (BSA) was used as standard.

Results

Cloning of endoglucanase gene from B. subtilis JS2004

Bacterial originated cellulase would be ideal for expression

in E. coli. We therefore used endoglucanase gene from B.

subtilis JS2004 strain for expression in E. coli. The endo-

glucanse production from this strain was maximum after

24 h of growth in LB medium containing 1 % CMC at

37 �C (Data not shown). DNA was extracted from 24 h

grown culture for PCR amplification of endoglucanse gene.

Endoglucanse gene was amplified by PCR and cloned in

pTZ57R/T cloning vector and sequenced. The sequence

results indicated that endoglucanase gene sequence con-

tained an open reading frame (ORF) of 1,701 nucleotides

that started with an ATG start codon and terminated with a

TGA stop codon (Fig. 1). It encodes a protein of 567 amino

acids with a predicted molecular mass of 63-kDa.

Recombinant expression and purification

of endoglucanase

The endoglucanase gene was expressed under the control

of T7 RNA polymerase promoter in E. coli strain BL21

CodonPlus (DE3). Endoglucanse gene was ligated into

pET28a(?) expression vector and expressed in an IPTG

inducible system of E. coli (BL21). Protein expression was

induced with 1 mM IPTG. The endoglucanase activity of

pET28a(?) reached optimal activity after 5 h induction,

and the activity was significantly higher than that of the

wild type strain. The supernatant of the culture broth was

subjected to ammonium sulphate precipitation and desalt-

ing. The enzyme was purified to homogeneity of more than

90 % purity in sufficient yield. After purification of endo-

glucanase through first and second HiTrap IMAC HP

(Sigma-Aldrich), following manual instructions, it showed

a single band on SDS–PAGE which is in accordance with

expected molecular mass of 63-kDa (Fig. 2).

Properties of the recombinant endoglucanase

The optimum pH of recombinant endoglucanse was found

to be 9 (Fig. 3a). A rapid decrease in activity above pH 9

was observed. Optimum temperature for recombinant en-

doglucanse was found to be 50 �C (Fig. 3b). A rapid

decrease in activity below 50 �C was observed. Moreover,

no activity was observed above 60 �C.

The effect of pH on the stability of recombinant endo-

glucanse showed that 80 % of the activity was between pH

7.0–12.0 (Fig. 3c) and a fast decrease below pH 6.0 was

observed, which indicated that the recombinant endoglu-

canase was alkali-stable. The effect of thermo stability on

the recombinant endoglucanse showed that it was ther-

mostable between 30 and 40 �C (Fig. 3d), after that there

was decline in thermostability.

The recombinant endoglucanse showed highest activi-

ties against carboxymethylcellulose, pNPC and avicel. The

enzyme was unable to degrade Alpha-glucan, cellobiose

and xylan. The KM and Vmax values for the recombinant

Fig. 1 Nucleotide sequence of endoglucanase gene from B. subtilis

JS2004. The sites for ribosomal binding, restriction enzymes,

promoter and operator are underlined. The sites for transcriptional

start and stop codon are also mentioned. The GenBank database was

used for retrieval of gene sequence

Mol Biol Rep

123

endoglucanase were 1.76 lmol and 0.20 lmol/min,

respectively using Carboxymethyl cellulose as substrate.

Several metal ions were assayed for their effects on

recombinant endoglucanse activity. The activity of

recombinant endoglucanse was enhanced by Mg2?, Ca2?,

isopropanol and Tween 20 and inhibited by Hg2?, Zn2?,

Cu2?, Ni2? and SDS (Table 2).

Discussion

Over recent years, great interest has been given for the

development of recombinant cellulases with efficient pH

and temperature stability. In this paper, we reported

expression and characteristics of recombinant endoglu-

canase from B. subtilis, which may be used for bioble-

aching and pulp industry where higher pH and temperature

is required. The potential of cellulose degrading enzymes

has been studied previously and research is being con-

ducted for the production of industrial enzymes which are

constituted by different compartments [30]. The industrial

needs for the production of recombinant cellulases, which

can work even at higher temperatures, have been suggested

by researchers [31]. Conversion methods that involve

enzymatic cleavage of cellulose by microbial cellulases

instead of chemical hydrolysis are better because their

employment for bioconversion lead to decreased contri-

bution towards environmental pollution [32].

Bacillus sp. isolated from an alkaline source was used in

this study for the amplification of endoglucanse gene. The

microorganisms having cellulase enzymes even at high

temperatures have been isolated from different environ-

ments earlier [33]. In addition to bacteria, cellulose-

degrading enzymes have also been isolated from different

fungi [34–36]. But there are several advantages of pro-

duction of cellulase enzymes from bacteria. The generation

time of bacteria is short, can be easily grown to highly

elevated cell density using cheaper sources of nitrogen and

carbon. The expression system and exploitation of bacteria

is very convenient as expression of endogenous cellulases

at increased levels is more easily obtained in bacteria than

in fungi [32]. Therefore, production of recombinant cellu-

lase enzymes from bacterial origin is preferred.

Fig. 2 SDS–PAGE analysis

of endoglucanase gene from the

recombinant E. coli BL21

(DE3). Lane 1, E. coli harboring

recombinant pET28a-end. The

arrow is indicating an

expression product (63 kDa)

of recombinant endoglucanase

gene. Lane 2, Purified

recombinant endoglucanase by

affinity chromatography. Lane

3, negative control. Lane 4,

protein molecular mass marker

showing bands of different size

(kDa)

Fig. 3 Biochemical characterization of recombinant endoglucanase

from Bacillus subtilis JS 2004. Error bars show standard deviation

among three observations. a Effect of different pH on endoglucanase

activity; b Effect of different temperature on endoglucanase activity.

The 50 mM NaOH-glycine (pH 9) buffer was used during measuring

the enzyme activity; c pH stability. The enzyme was pre-incubated at

different pH values (3–12) for 30 min at 50 �C; d Thermal stability of

recombinant endoglucanase produced by Bacillus subtilis JS2004.

The enzyme was incubated in 50 mM Glycine-NaOH buffer (pH 9) at

25, 30, 35, 40, 45, 50, 55, 60 and 65 �C

Mol Biol Rep

123

Endoglucanse gene was cloned in pTZ57R/T cloning

vector and sequenced. The open reading frame (ORF) of

endoglucanase gene consisted of 1,701 nucleotides

encoding a protein of endoglucanse gene. Different

researchers have reported cloning and expression of

Bacillus cellulase genes in different hosts [32, 37–43].

Endoglucanase gene from B. subtilis JS2004 strain was

expressed in E. coli in this study. This achievement of

successful expression of endoglucanse as demonstrated by

a single band of 63-kDa suggests the possibility of using

this E. coli expression system for production of other

bacterial cellulases for their purification and characteriza-

tion. Since no native cellulases are present in E. coli,

therefore it is much better for cellulases production com-

pared to wild type bacteria which contain different types of

cellulases and it, is difficult to purify and characterize

individual cellulases from them.

The recombinant enzymes are preferred than native

due to many reasons. The production environment in

recombinant enzymes can be well controlled through

choice of expression vector and strain following the

cloning of an enzymatic system. A more purified product

with decreased processing duration is produced in a

recombinant enzyme system than native. Larger yields are

obtained through recombinant and overexpressed enzymes

as compared to native strains [44]. Moreover, recombi-

nant enzymes can be easily manipulated which leads to

the commercialization of new enzymes with potential

industrial applications.

The optimum pH of recombinant endoglucanse found in

this study was 9 and enzyme exhibited more than 60 %

activity at pH 7–10. The stability of the fungal cellulases is

commonly between pH 3.0 and pH 8.0 [45, 46].

Recombinant endoglucanse with optimum activity at pH 9

and could potentially be employed in bio-bleaching process

where a higher pH is required. Currently, the limiting

factor to the economic viability of ethanol production from

cellulosic materials is the efficient release of its component

glucose molecules for subsequent fermentation. One

favored approach is to pretreat the cellulosic material (e.g.,

straw) with alkaline reagents to release the cellulose from

other plant cell wall polymers and its subsequent neutral-

ization before digestion with a cocktail of cellulolytic

enzymes [47]. Enzymes that are more active under alkaline

conditions would help to reduce the costs associated with

the pretreatment process [48].

Recombinant endoglucanse showed optimal activity at

50 �C. Cellulases in general show optimum temperature

between 30 and 55 �C [45, 46]. The optimum activity of

recombinant endoglucanse at 50 �C, makes it suitable for

usage in pulp industry where a higher temperature is required.

These kinetic and substrate properties of recombinant

endoglucanse observed in this study are in accordance with

previous studies on endoglucanases. The recombinant en-

doglucanse showed highest activities against carboxy-

methylcellulose, pNPC and avicel. The enzyme was unable

to degrade Alpha-glucan, cellobiose and xylan. This sub-

strate specificity of the characteristic of recombinant en-

doglucanse was in accordance with earlier studies [48–51].

The KM and Vmax values for the recombinant endoglucan-

ase were 1.76 lmol and 0.20 lmol/min, respectively using

CMC as substrate.

The recombinant endoglucanse activity was strongly

inhibited by SDS and divalent ions (Hg2?, Zn2 and Ni2?

with 1 mM concentration. Hg2? ions inhibition was not

only due to binding with the thiol groups but also because

of interactions at residue of tryptophan or the carboxyl

group of amino acids in the enzyme [52]. However, there

was significant increase in the enzyme activity by Mg2?,

Ca2?, isopropanol and Tween 20. This inhibition and

increase in the activity of endoglucanase by metal ions and

Tween-20 is in accordance with the results reported pre-

viously [40].

Conclusion

We have successfully cloned, expressed and characterized

an endoglucanase gene from strain B. subtilis JS2004. The

recombinant enzyme had broad substrate specificity,

completely hydrolyzed cello-oligosaccharides and showed

stability even at high temperature. As this recombinant

endoglucanse is stable in alkaline conditions, it has

potential as one of the component of enzymes mixtures for

degradation of cellulosic material for ethanol production.

Table 2 Effect of metal ions and chemicals on recombinant activity

of EG

Effectora Relative activity (%)

(Mean ± SD)

Control 100 ± 0.003

HgCl2 40 ± 0.040

ZnCl2 21 ± 0.012

CuCl2 18 ± 0.047

NiCl2 27 ± 0.017

MgCl2 145 ± 0.019

CaCl2 127 ± 0.031

SDS 7 ± 0.011

Iso propanol 130 ± 0.061

Beta mercaptoethanol 70 ± 0.043

Tween 20 150 ± 0.012

a The final concentration of the various cations was 1 mM. Data are

given as mean ± SD

Mol Biol Rep

123

Acknowledgments We acknowledge the financial support from

Higher Education Commission (HEC), Pakistan for this research

work.

References

1. Ahmed S, Riaz S, Jamil A (2009) Molecular cloning of fungal

xylanases: an overview. Appl Microbiol Biotechnol 84(1):19–35

2. Ahmed S, Aslam N, Latif F, Rajoka MI, Jamil A (2005)

Molecular cloning of cellulase genes from Trichoderma harzia-

num. Atta-ur-Rehman/Choudhary/Khan, Eds.), Frontiers in Nat-

ural Product Chemistry. Bentham Science Publishers, The

Netherlands, 1: 73–75

3. Ahmed S, Qurrat-ul-Ain, Aslam N, Naeem S, Sajjad-ur-Rehman,

Jamil A (2003) Induction of xylanase and cellulase genes from

Trichoderma harzianum with different carbon sources. Pak J Biol

Sci 6(22):1912–1916

4. Ahmed S, Imdad SS, Jamil A (2012) Comparative study for the

kinetics of extracellular xylanases from Trichoderma harzianum

and Chaetomium thermophilum. Electron J Biotechnol. doi:10.

2225/vol15-issue3-fulltext-2

5. Saadia M, Ahmed S, Jamil A (2008) Isolation and cloning of cre1

gene from a filamentous fungus Trichoderma harzianum. Pak J

Bot 40(1):421–426

6. Ahmed S, Bashir A, Saleem H, Saadia M, Jamil A (2009) Pro-

duction and purification of cellulose-degrading enzymes from a

filamentous fungus Trichoderma harzianum. Pak J Bot

41(3):1411–1419

7. Li W, Zhou Y, Ma QY, Chen YL (2009) Simultaneous cloning

and expression of two cellulase genes from Bacillus subtilis

newly isolated from Golden Takin. Biochem Biophys Res

Commun 383(4):397–400

8. Bhat MK (2000) Cellulases and related enzymes in biotechnol-

ogy. Biotechnol Adv 18(5):355–383

9. de Castro AMde, de Carvalho MLDA, Leite SGf, Pereira N

(2010) Cellulases from Penicillium funiculosum: production,

properties and application to cellulose hydrolysis. J Ind Microbiol

Biotechnol 37(2):151–158

10. Ahmed S, Jabeen A, Jamil A (2007) Xylanase from Trichoderma

harzianum: enzyme characterization and gene isolation. J Chem

Soc Pak 29(2):176–182

11. Saleem F, Ahmed S, Jamil A (2008) Isolation of a xylan

degrading gene from genomic DNA library of a thermophilic

fungus Chaetomium thermophile ATCC 28076. Pak J Bot

40(3):1225–1230

12. Yujuan W, Wang HYJ, Zengliang Y (2009) Truncation of the

cellulose binding domain improved thermal stability of endo-b-

1,4-glucanase from Bacillus subtilis JA18. Bioresour Technol

100(1):345–349

13. Wen T, Chen J, Lee S, Yang N, Shyur L (2005) A truncated Fi-

brobacter succinogenes 1, 3–1, 4-b-glucanase with improved enzy-

matic activity and thermotolerance. Biochemistry 44(25):9197–9205

14. Zhang M, Shi ML, Zhou Z, Yang S, Yuan ZY (2006) Production

of Alcaligenes faecalis penicillin G acylase in Bacillus subtilis

WB600 (pMA5) fed with partially hydrolyzed starch. Enzyme

Microb Technol 39(4):555–560

15. Chaoning L, Fioronic M, Rodriguez-Roperoc F, Xuea Y, Schw-

anebergc U, Maa Y (2011) Directed evolution of a thermophilic

endoglucanase (Cel5A) into highly active Cel5A variants with an

expanded temperature profile. J Biotechnol 154(1):46–53

16. Jarboe LR, Grabar TB, Yomano LP, Shanmugan KT, Ingram LO

(2007) Development of ethanologenic bacteria. Adv Biochem

Eng Biotechnol 108:237–261

17. Atsumi S, Cann AF, Connor MR, Shen CR, Smith KM, Bry-

nildsen MP, Chou KJ, Hanai T, Liao JC (2008) Metabolic

engineering of Escherichia coli for 1-butanol production. Metab

Eng 10(6):305–311

18. Liu H, Yu C, Feng D, Cheng T, Meng X, Liu W, Zou H, Xian M

(2012) Production of extracellular fatty acid using engineered

Escherichia coli. Microb Cell Fact 11:41. doi:10.1186/1475-

2859-11-41

19. Steen EJ, Kang Y, Bokinsky G, Hu Z, Schirmer A, McClure A,

Del Cardayre SB, Keasling JD (2010) Microbial production of

fatty-acid-derived fuels and chemicals from plant biomass. Nat-

ure 463(7280):559–562

20. Schirmer A, Rude MA, Li X, Popova E, del Cardayre SB (2010)

Microbial biosynthesis of alkanes. Science 329(5991):559–562

21. Gupta S, Adlakha N, Yazdani SS (2013) Efficient extracellular

secretion of an endoglucanase and a b-glucosidase in E. coli.

Protein Expr Purif 88(1):20–25

22. Lynd LR, van Zyl WH, McBride JE, Laser M (2006) Consoli-

dated bioprocessing of cellulosic biomass: an update. Curr Opin

Biotechnol 16(5):577–583

23. Sambrook J, Russel D (2001) Molecular cloning: a laboratory

manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold

Spring Harbor

24. Yamada YM, Koiche M, Hossan O, Kumito N, Yayoi Y, Masako

O (2002) Comparison of two different methods for extraction of

mitochondrial DNA from human pathogen yeast. Jpn J Infect Dis

55(4):122–125

25. Hingamp P, Broek AE, Stosser G, Baker W (1999) The EMBL

nucleotide sequence database. Contributing and accessing data.

Mol Biotechnol 12(3):255–267

26. Yildirim N, Ciftci M, Kufreviog OI (2002) Kinetic analysis of

multi enzyme systems: a case study of the closed system of

creatine kinase, hexokinase and glucose 6-phosphate dehydro-

genase. J Math Chem 31(1):121–130

27. Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature

227(5259):680–685

28. Miller GL, Blum R, Glennon WE, Burton AL (1960) Measure-

ment of carboxymethylcellulase activity. Anal Biochem

1(2):32–127

29. Bradford MM (1976) Rapid and sensitive method for the quan-

titation of microgram quantities of protein utilizing the principle

of protein-dye binding. Anal Biochem 72(1–2):248–254

30. Dienes D, Borjessonb J, Stalbrandb H, Reczey K (2006) Pro-

duction of Trichoderma reesei Cel7B and its catalytic core on

glucose medium and its application for the treatment of second-

ary fibers. Process Biochem 41(9):2092–2096

31. Haki GD, Rakshit SK (2003) Developments in industrially

important thermostable enzymes: a review. Bioresour Technol

89(1):17–34

32. Li, Zhang WW, Yang MM, Chen YL (2008) Cloning of the

thermostable cellulase gene from newly isolated Bacillus subtilis

and its expression in Escherichia coli. Mol Biotechnol

40(2):195–201

33. Ng S, Li CW, Yeh YF, Chen PT, Chir JL, Ma CH, Yu SM, Ho

TH, Tong CG (2009) A novel endo-glucanase from the thermo-

philic bacterium Geobacillus sp. 70PC53 with high activity and

stability over a broad range of temperatures. Extremophiles

13(3):425–435

34. Ghori MI, Ahmed S, Malana MA, Jamil A (2012) Kinetics of

exoglucanase and endoglucanase produced by Aspergillus niger

NRRL 567. Afr J Biotechnol 11(28):7227–7231

35. Ghori MI, Ahmed S, Malana MA, Jamil A (2011) Corn stover-

enhanced cellulase production by Aspergillus niger NRRL 567.

Afr J Biotechnol 10(31):5878–5886

Mol Biol Rep

123

36. Jamil A, Naim S, Ahmed S, Ashraf M (2005) Production of

industrially important enzymes using molecular approaches:

cellulases and xylanases. In: Thangadurai D, Pullaiah T, Pedro A

(eds) Balatti genetic resources and biotechnology II, vol 2.

Regency publications, New Delhi, pp 143–183

37. Ogura J, Toyoda A, Kurosawa T, Chong AL, Chohnan S, Masaki

T (2006) Purification, characterization, and gene analysis of

cellulase (Cel8A) from Lysobacter sp. IB-9374. Biosci Biotech-

nol Biochem 70(10):2420–2428

38. You JL, Kima BK, Lee BH, Joa KI, Leea NK (2008) Purification

and characterization of cellulase produced by Bacillus amyoliq-

uefaciens DL-3 utilizing rice hull. Bioresour Technol

99(2):378–386

39. Bo KK, Lee BH, Leeb YJ, Jina H, Chunga CH, Lee JW (2009)

Purification and characterization of carboxymethylcellulase iso-

lated from a marine bacterium Bacullus subtilis subsp. A-53.

Enzyme Microb Technol 44(6–7):411–416

40. Odeniyi OA, Onilude AA, Ayodele MA (2009) Production

characteristics and properties of cellulose polygalacturonase by a

Bacillus coagulans strain from a fermenting palm-fruit industrial

residue. Afr J Microbiol Res 3(8):407–417

41. Gurdeep R, Bhallaa A, Adhikaria A, Bischoff KM, Hughesb SR,

Christopherc LP, Sani RK (2010) Characterization of thermo-

stable cellulases produced by Bacillus and Geo bacillus strains.

Bioresour Technol 101(22):8798–8806

42. Thirumalai P, Piriyaa PS, Prabhua DIG, Vennison SJ (2011)

Cellulosic ethanol production by Zymomonas mobilis harboring

an endoglucanase gene from Enterobacter cloacae. Bioresour

Technol 102(3):2585–2589

43. Zhuo Y, Peia X, Wu Z (2011) Introduction of glycine and proline

residues onto protein surface increases the thermostability of

endoglucanase CelA from Clostridium thermocellum. Bioresour

Technol 102(3):3636–3638

44. Maria JM, Rosana VM, Adrian AL, Maximiliano JA, Sergio EA,

Gladys MC (2006) Production of recombinant enzymes of wide

use for research. Elect J Biotech. doi:10.2225/vol9-issue3-full

text-16

45. Xu Z, Shih MC, Poulton JE (2006) An extracellular exo-beta-

(1,3)-glucanase from Pichia pastoris: purification, characteriza-

tion, molecular cloning, and functional expression. Protein Expr

Purif 47(1):118–127

46. Peng Y, Chi ZM, Wang XH, Li J (2009) Purification and

molecular characterization of exo-beta-1,3-glucanases from the

marine yeast Williopsis saturnus WC91-2. Appl Microbiol Bio-

technol 85(1):85–94

47. Anne BB, Anne BO, Tomas F, Annette P, Anette SS (1996)

Pretreatment of wheat straw using combined wet oxidation and

alkaline hydrolysis resulting inconvertible cellulose and hemi-

cellulose. Biotechnol Bioeng 49(5):568–577

48. Zhang F, Chen J-J, Ren W-Z, Nie G-X, Ming H, Tang S-K, Li W-J

(2011) Cloning, expression and characterization of an alkaline

thermostable GH9 endoglucanase from Thermobifida halotolerans

YIM 90462T. Bioresour Technol 102(21):10143–10146

49. Endo K, Hakamada Y, Takizawa S, Kubota H, Sumitomo N,

Kobayashi T, Ito S (2001) A novel alkaline endoglucanase from

an alkaliphilic Bacillus isolate: enzymatic properties, and nucle-

otide and deduced amino acid sequences. Appl Microbiol Bio-

technol 57(1–2):109–116

50. Sharma P, Gupta JK, Vadehra DV, Dube DK (1990) Purification

and properties of an endoglucanase from a Bacillus isolate.

Enzyme Microb Technol 12(2):132–137

51. Jo KI, Lee YJ, Kim BK, Lee BH, Jung CH, Nam SW (2008)

Pilot-scale production of carboxymethylcellulase from rice hull

by Bacillus amyloliquefaciens DL-3. Biotechnol Bioprocess Eng

13(2):182–188

52. Lamed R, Tormo, Chirino AJ, Morag E, Bayer EA (1994)

Crystallization and preliminary X-ray analysis of the major cel-

lulose-binding domain of the cellulase from Clostridium ther-

mocellum. J Mol Biol 244(2):236–237

Mol Biol Rep

123