university of groningen bacillus subtilis: sporulation

University of Groningen

Bacillus subtilis: sporulation, competence and the ability to take up fluorescently labelled DNABoonstra, Mirjam

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2017

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Boonstra, M. (2017). Bacillus subtilis: sporulation, competence and the ability to take up fluorescentlylabelled DNA. Rijksuniversiteit Groningen.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 23-11-2021

https://research.rug.nl/en/publications/bacillus-subtilis-sporulation-competence-and-the-ability-to-take-up-fluorescently-labelled-dna(0915dd2b-7642-40f3-ac34-be59d56f68ed).html

Chapter 4

Following the fate of incoming

DNA during natural

transformation of Bacillus

subtilis with fluorescently

labelled DNA

Mirjam Boonstra, Nina Vesel, Oscar P. Kuipers.

Department of Genetics, GBB, University of Groningen, the Netherlands

Chapter 4

121

Abstract

During competence Bacillus subtilis is able to take up DNA from its

environment through the process of transformation. We investigated the

ability of B. subtilis to take up fluorescently labelled DNA and found that it

is able to take up either Fluorescein-dUTP, DyLight550 or DyLight650-

dUTP labelled DNA. Transformation with labelled DNA containing an

antibiotic cassette resulted in uptake of the labelled DNA and also

generated antibiotic-resistant colonies. The labelled DNA co-localises with

the chromosome and with ComFC and RecA. Fluorescent labelling of DNA

creates the opportunity to directly study interactions of exogenous DNA

with components of the competence machinery and recombination

proteins. The competence machinery is conserved among naturally

competent bacteria, which makes this method of labelling suitable for

studying transformation of other naturally competent bacteria.

Introduction

An interesting aspect of the lifestyle of Bacillus subtilis is its ability to take

up naked DNA from the environment. When nutrients are limited a sub-

population of B. subtilis cells can become competent and transport the

exogenous DNA to its interior. This transport occurs through a large

complex consisting of multiple proteins. The transport complex is highly

conserved among naturally competent bacteria and in B. subtilis it localises

primarily at the pole (Hahn et al., 2005). The first step in the transport

process is the binding of the extracellular DNA. Proteins necessary for the

binding of DNA are the major pseudopilin ComGC, the minor pseudopilins

ComCD, ComGE and ComGG, the ATPase ComGA and the membrane

protein ComGB (Chung and Dubnau, 1998). The dsDNA binding protein

ComEA is also required for transformation (Inamine and Dubnau, 1995;

Provvedi and Dubnau, 1999). The DNA is bound in its double stranded

form and in case of large molecules cleaved into fragments of 13.5-18kb by

NucA (Dubnau, 1999; Dubnau and Cirigliano, 1972). One of the strands of

the dsDNA is degraded by an unknown protein. In B. subtilis no preference

was found for the 3'-5'or 5'-3' strand (Vagner et al., 1990).

Chapter 4

122

Single stranded (ssDNA) is transported through the water-filled ComEC

channel and transport is assisted by the helicase/ATPase ComFA

(Draskovic and Dubnau, 2005; Londoño-Vallejo and Dubnau, 1993;

Takeno et al., 2011). When ssDNA enters the cytoplasm it is bound and

protected from degradation by SsbB and SsbA. (Baitin et al., 2008; Grove

et al., 2005; Yadav et al., 2012). DprA and SsbA facilitate RecA•ATP

mediated strand exchange (Yadav et al., 2012, 2014). While DNA is present

on the surface of the cell it is still accessible to DNaseI, but approximately

1-1.5 minutes after addition of DNA at 37 °C the exogenous DNA becomes

resistant to DNaseI and single-strand donor DNA can be retrieved from

lysed cells confirming uptake of DNA (Piechowska and Fox, 1971; Davidoff-

Abelson and Dubnau, 1973; Dubnau, 1999). If the foreign DNA has

homology to the genome of the recipient bacterium it can be integrated

into the chromosome by homologous recombination. If no homology is

present, but the exogenous DNA is capable of autonomous replication it

can be reconstituted as a plasmid (Kidane et al., 2012; Viret et al., 1991).

The proteins involved in DNA uptake have been extensively studied; for

reviews see (Chen and Dubnau, 2004; Chen et al., 2005; Kidane et al.,

2012). Co-localisation of proteins is often visualised using fusions of the

protein of interest to a fluorescent protein and this has been done

successfully with components of the competence machinery (Hahn et al.,

2005; Kaufenstein et al., 2011; Kramer et al., 2007). Visualising DNA has

also been done successfully although no transfer of DNA into the cytoplasm

of Helicobacter pylori or B. subtilis was detected (Stingl et al., 2010).

Although transport of fluorescently labelled DNA into the cytoplasm of B.

subtilis was not successful previously, we decided to try different labelling

methods and dyes. We incorporated covalently bound dyes into DNA in

order to be able to follow up-take and interactions of DNA with

components of the competence and replication machinery. We tested

several labelled nucleotides to be incorporated via PCR , i.e. DyLight650-

dUTP, DyLight550-dUTP, Fluorescein-dUTP, Cy3-dUTP, Cy5-dUTP and

Alexa Fluor 5 labelled dNTPs which were incorporated via the Klenow

method. To demonstrate the usefulness of labelled DNA in studying

interactions with proteins involved in transformation we also determined

co-localisation with ComFC, RecA and the chromosome.

Uptake of labelled DNA

123

Results

DNA uptake

Because under nutrient-limited conditions in the lab only 5-25% of the B.

subtilis 168 population becomes competent we used a Pxyl-comK over-

expression strain. By growing the cells in competence medium with

fructose as a carbon source we relieved repression of the xylose promoter

and reduced the amount of xylose required for induction of ectopic comK.

Under these conditions approximately 80% of the population became

competent. Labelling of DNA was done either directly through PCR as for

Fluorescein-dUTP, Cy3-dUTP and Cy5-dUTP labelled DNA or indirectly by

PCR with aminoallyl dUTP and subsequent labelling with amino reactive

DyLight650 or DyLight550. Incorporation of Alexa Fluor 5 from the

Bioprime total genomic DNA labelling module was done by use of the

Klenow reaction. All the dyes were covalently bound to the nucleotides and

both strands of the DNA were labelled. The template used was pDG1664

with a concentration of 100ng, and an erythromycin marker plus the

flanking thrC regions were amplified. A negative control was taken in

which all components were the same, except that no enzyme was added.

Amplified PCR or Klenow products were incubated for 2hrs with DpnI to

remove all template DNA. Transformation of the negative control did not

yield resistant colonies confirming that treatment with DpnI removes all

template DNA. A positive control using an amplified product with normal

dNTPs was also taken to confirm competence of the cells. Label

incorporation of Fluorescein-dUTP, Cy3-dUTP and Cy5-dUTP (measured

with a Nanodrop ) generally lies between 1.4-4.6% for Fluorescein-dUTP,

1.4-3% for DyLight650-dUTP, and between and on average 7% for Alexa

Fluor 5. Transformation with Fluorescein, DyLight550 and DyLight650

labelled DNA resulted in resistant colonies. Transformation with Alexa

Fluor 5 labelled DNA did not result in resistant colonies. Transformation

with Cy3 or Cy5 labelled DNA is also possible, but is much lower in

particular for Cy5.

Chapter 4

124

Because transformation with Fluorescein labelled DNA and DyLight

labelled DNA resulted in the highest number of colonies we compared the

transformation efficiency with unlabelled DNA. The transformation

efficiency of the labelled dyes is about 3X lower than that of unlabelled

DNA (S. table1). As mentioned previously when B. subtilis successfully

takes up DNA it becomes resistant to DNaseI treatment. We therefore

treated all samples with 10U of DNaseI for ten minutes at 37 °C after which

the cells were washed and prepared for microscopy. DyLight650-DNA,

Fluorescein-DNA bind to competent B. subtilis (Img. s1, S. Img 1.). Alexa

Fluor 5 labelled DNA also binds in a DNaseI resistant manner, but as

mentioned previously transformation does not result in resistant colonies.

To confirm that DNA binds preferentially to competent cells we incubated

B. subtilis amyE::Pxyl-comK-PcomG-gfp with DyLight650 labelled DNA. The

PcomG-gfp construct in this strain is an indicator for competence, with

competent cells expressing gfp (Smits et al., 2005). Image 3a shows that

labelled DNA binds only to the competent cells and that no binding is

present to non-competent cells. Image3b shows that B. subtilis amyE::Pxyl-

comK grown in LB does not bind labelled DNA which is expected as

competence is very low when B.subtilis is grown in LB. These results show

that labelled DNA only binds to competent cells and confirms that the

bound DNA is resistant to DNaseI. We also performed the same

experiment with Streptococcus pneumoniae D39 to see if competent S.

pneumoniae is also capable of binding labelled DNA and indeed competent

S. pneumoniae binds labelled DNA in a DNaseI resistant manner (Img. 2).


125

To further determine if the labelled DNA is truly internalised we took

advantage of the pH sensitivity of Fluorescein. Fluorescein has a very low

fluorescence at a pH below 5. When cells transformed with labelled DNA

and fixed with 2% formaldehyde are put in PBS buffer at pH 7.4 some foci

can be seen localising on the border of the cells.

Img. 1. Comparison of competent and non-competent B. subtiltis transformed with labelled DNA. (A). B. subtilis amyE::Pxyl-comK-PcomG-gfp transformed with dylight650 labelled DNA. The labelled DNA (red foci) only binds to the competent (blue) cells. (B). B. subtilis grown in LB and incubated with labelled DNA. No labelled DNA can be seen binding to the non-competent cells grown in LB.

Img. 2. Competent Streptococcus pneumoniae D39 incubated with DyLight650 labelled DNA. Labelled DNA binds to competent S. pneumoniae in a DNaseI resistant manner.

Chapter 4

126

When the cells are exposed to a 10mM sodium acetate buffer at pH4

resulting in a low pH outside the fixed cells foci are only seen inside the

cells with no foci localising on the outer edge of the cells (S. Img. 2). These

results combined with the fact that transformation with fluorescently

labelled DNA yields resistant colonies show that labelled DNA is

successfully taken up by the cells. In previous studies 1-4 foci per cell of

competence proteins were found (Kaufenstein et al., 2011). After 1hr of

incubation we also find 1-4 foci per cell for the labelled DNA with the

majority 77.6% having 1 focus, 18.4% 2 foci, 3.7% 3 foci and 0.3% having 4

foci, while rarely a cell is found with more foci (Img. 3, S1.table2). The

localisation of the DNA differs with that of the foci of components of the

competence machinery. In studies into the localisation of the components

of the competence machinery the majority of the foci are localised at the

pole with only 4-15% (average 7.7%) depending on the protein localised

near the centre of the cell (Kaufenstein et al., 2011). In cells fixed with 2%

formaldehyde the labelled DNA is more often (28-23%) localised near the

centre of the cell and co-localises with the chromosome in 21-22% of the

cases. (S. table 3,4). Single foci localise an average of 47% in the centre of

the cell and 39% at the pole.

Img. 3. Number of DyLight650 labelled DNA foci. Generally 1-4 foci per cell are found for the labelled DNA with the majority of cells having 77.6% having 1 focus, 18.4% 2 foci, 3.7% 3 foci and 0.3% having 4 foci of a total of 599 cells rarely a cell is found with more foci.


127

Image 4 shows examples of the different types of localisation of

Fluorescein-dUTP, DyLight650-DNA show the same localisation patterns

as Fluorescein labelled DNA (S table 4). A higher percentage of localisation

near the centre of the cell and co-localisation with the chromosome of

labelled DNA is in accordance with the expectation that the labelled DNA is

internalised. An interesting question is if the competence machinery can

take up multiple DNA molecules at once. Although labelling with one type

of dye creates DNA foci it is not possible to determine with regular

fluorescent microscopy how many DNA molecules there are in one focus.

Therefore to answer this question we mixed DyLight650-DNA and

Fluorescein-DNA in equal amounts and incubated the competent cells with

the mixture of labelled DNA. After 1hr their co-localization is only present

in 8% of the cells containing foci (Img. 5). In 15 % of the cells the foci are

located close to each other, but don't overlap completely. 46% of the cells

have a single Fluorescein focus and 32% have a single DyLight650 focus.

Img. 4. Localisation of foci (A). pole 34%. (B). Centre 23% C: Centre co-localising with chromosome 22%. (D). Pole (partially) co-localising with the chromosome 7%. (E). Two foci at the pole 2%. (F). Two foci at the centre 3%. (G).One focus at the pole one at the centre 3%. (H). Foci at the division site 5%. The chromosome was stained with DAPI.

Chapter 4

128

These results combined with the observation that 77% of the cells only have

one DNA focus when incubated with one type of coloured DNA indicates

that generally only one molecule is taken up at a time. The fact that co-

localisation of the 2 colours of DNA only occurs in 8% of the cases indicates

that parallel transport is rare. B. subtilis does seem to be able to take up

multiple DNA molecules at once, but this is less common (Img. 3).

Co-localisation

To determine whether labelled DNA co-localises with specific components

of the competence machinery we investigated co-localisation with ComFC-

GFP and RecA-YFP. After 10min of incubation with DNA and subsequent

fixing with 2% formaldehyde, washing and treatment with DNaseI, 33% of

the cells contain DNA foci, 26% ComFC-GFP foci and in 6% of the total

number of cells co-localisation of foci can be seen. In the cells containing

both ComFC-GFP and DyLight 650-DNA foci, co-localisation occurs in

23% of the cells (Img6 A-C), S table5). As the labelled DNA successfully co-

localises with the competence machinery we were interested if we could

also see it co-localise with the recombination protein RecA, i.e. whether

DyLight650-DNA also co-localises with RecA-YFP.

Img. 5. Co-localisation of DyLight650 DNA with Fluorescein labelled DNA. (A). Dylight650-DNA localising next to Fluorescein-DNA 14% (B). Overlapping DyLigt650 and Fluorescein-DNA foci 8% C. Single Fluorescein-DNA focus 46%. (D). Single DyLight650-DNA focus 32%. This image was changed from the draft of the thesis to improve quality in the print editon.


129

For this experiment the BD4477 strain was used which contains a RecA-

YFP fusion (Kramer et al., 2007). After 15 minutes of incubation with

DyLight650-DNA 7% of the cells show clear RecA-YFP foci and 51% show

Dylight650 foci. After 1hour 44% of the cells have Dylight650 foci and 14%

have RecA-YFP foci. Of the cells showing both RecA-YFP and DyLight650

foci co-localisation occurs in 26% of the cells at 15 minutes and 15% after 1

hour of incubation (S. Img. 3, tables 6&7). RecA is the main protein

responsible for homologous recombination during transformation and

Kidane and Graumann saw filamentous forms of RecA being formed on

addition of exogenous DNA, this form is likely the form RecA takes when

actively searching for homologous regions (Kidane and Graumann, 2005).

We also see the filamentous form of RecA and this form can be seen to co-

localise with the labelled DNA (Img. 6 G-I). Labelled DNA thus successfully

co-localises with competence and recombination proteins, and can be seen

to co-localise with the DAPI stained chromosome.

We were therefore curious if we could also see the labelled DNA co-localise

at a specific locus on the chromosome. Because we used labelled DNA

capable of integrating into the thrC locus on the chromosome it should be

possible to see the labelled DNA co-localising with this locus. A ParB-GFP

or ParB-mKate protein fusion construct with the original parS site in the

parB gene was therefore cloned into the thrC locus of B. subtilis. After 10

min of incubation with DNA and subsequent fixing with 2% formaldehyde

and treatment with DNaseI, Fluorescein-DNA co-localises with ParB-

mKate at 4%. When incubating for 1hr 9% co-localisation can be seen

(Img6 D-F), S.Tables 10 & 11,). Similar co-localisation percentages can be

seen for labelled DyLight650-DNA and ParB-GFP, which shows 3%. co-

localisation at 10min and 7% co-localisation after 1hr incubation (S. Img. 4

tables 8 & 9). The co-localisation of labelled DNA with the thrC locus is

much lower than the co-localisation with ComFC and RecA, although there

is an increase after 1hr incubation. It is possible that the ParB protein is

displaced from the chromosome when homologous recombination takes

place, and this could explain the lower level of co-localisation compared to

localisation with ComFC and RecA.

Chapter 4

130

Discussion

By covalent fluorescent labelling of DNA we developed a method that can

be used to study the interaction of incoming DNA with components of the

competence and replication machinery during transformation.

Img. 6 A-C. Co-localisation of DyLight650 labelled DNA with ComFC-GFP 10min after addition of DNA. (A). Overlay of ComFC-GFP and Dylight650DNA. (B). ComFC-GFP. (C). Dylight650-DNA. Of cells containing both DNA and ComFC foci co-localisation occurs in 23% of the cells. D-F. Co-localisation of ParB-mKate with Fluorescein labelled DNA.(D). Overlay of ParB-mKate and FLuorescein-DNA. (E). ParB-mKate. (F). Fluorescein-DNA. G-I. Co-localisation of the filamentous form of RecA-YFP with DyLight650 labelled DNA. (G). Overlay of RecA-YFP and DyLight650-DNA. (H). RecA-YFP. (I). Dylight650-DNA. This image was changed from the draft of the thesis to improve quality in the print editon.


131

We show that Fluorescein-DNA and DyLight650 labelled DNA are

successfully taken up by competent B. subtilis. Labelled DNA does not bind

to non-competent B. subtilis in a DNaseI resistant manner, confirming

specificity of binding to competent cells. The DNaseI resistance, the

presence of fluorescein-DNA foci inside the cells at pH4 and the formation

of antibiotic resistant colonies after transformation with DyLight650 and

Fluorescein-DNA show that B. subtilis can successfully be transformed

with the modified DNA albeit at a slightly lower efficiency than non-

labelled DNA. It is unknown if the lower transformation efficiency is the

result of reduced uptake, lower integration rates or if the labelled DNA

results in mutations in the resistance cassette/promoter. The observation

that AlexaFluor5-DNA which has the highest label incorporation does bind

to B subtilis in a DNaseI resistant manner, but does not result in resistant

colonies, indicates that it is either the recombination process and/or an

increased mutation rate that causes deficient transformation. If the

presence of foreign nucleotides in the transformed DNA leads to mutations

in the integrated DNA the level of dye incorporation should also be taken

into account as higher label incorporation could result in more mutations

and lower transformation efficiency. Stingl et al. fluorescently labelled

DNA using Cy3, but this labelling method did not result in uptake of

labelled DNA by B. subtilis (Stingl et al., 2010).

We also attempted transformation with Cy3 and Cy5 labelled DNA, using a

different labelling method, but even with the hypercompetent strain only

very few resistant colonies were formed. Our success with Fluorescein,

Dylight650 and Dylight550 labelled DNA is likely not only the result of

differences in structure, but also in the charge of these molecules.

DyLight650 and DyLight550 are negatively charged and have a higher

solubility in water compared to Cy5 and Cy3. During transformation

negatively charged DNA is transported through the water filled ComEC

channel. Therefore, the charge and solubility of the dye along with its size

likely are important factors in the ability of the competence machinery to

take up modified DNA. After determination of successful transformation

we also looked at co-localisation of labelled DNA with ComFC, RecA and

the chromosome.

Chapter 4

132

Localisation of the labelled DNA differs from that of the components of the

competence machinery with a much higher number of cells with foci

localised inside the cells being found for DNA compared to the competence

proteins further indicating successful internalisation. The labelled DNA co-

localises at an average of 22% with the chromosome. Although labelled

DNA is more often localised in the centre of the cell, the labelled DNA can

be seen to co-localise with ComFC with 23% co-localisation after 10min.

Labelled DNA also co-localises with RecA during transformation with 26%

co-localisation after 15 minutes and 15% co-localisation after 1hr. We also

observed formation of the active filamentous form of RecA (Kidane and

Graumann, 2005) in the presence of labelled DNA. The Co-localisation

with specific sites on the chromosome however is lower than co-

localisation with the chromosome and ComFC and RecA. After 10 min of

incubation only 3-4% of co-localisation with the thrC is found. When

cultures are incubated with the labelled DNA for 1hr the percentage of co-

localisation is slightly higher, i.e. 7-9%. The low level of co-localisation with

the specific locus compared to the entire chromosome, could be the result

of displacement of the ParB-GFP or ParB-mKate foci by the recombination

machinery. Use of a time-lapse microscopy in combination with short

imaging times might be a way in which co-localisation and potential ParB

displacement could be visualised. When competent B. subtilis is

transformed with both DyLight650-DNA and Fluorescein-DNA, full co-

localisation of the two is only seen in 8% of the cells and in15 % of the cells

the foci are located close to each other. The majority of the cells have either

only a DyLight650 focus 32% or a Fluorescein focus 46% indicating that

generally DNA is transpored in serial manner rather than in parallel.

Further investigation using super-resolution microscopy can more

difinitively determine how many DNA molecules are in one focus.

Labelling of DNA through incorporation of fluorescent-nucleotides can be

a powerful method to investigate all phases in the process of

transformation. The labelled DNA binds to competent cells in a DNaseI-

resistant manner not only for B. subtilis, but also for competent S.

pneumoniae.


133

The ability of both B. subtilis and S. pneumoniae to bind labelled DNA in a

DNAseI resistant manner combined with the high level of conservation of

the competence machinery and recombination proteins among naturally

competent species makes it likely that these labelling methods can also be

used for studies in other bacteria. Transformation with labelled DNA can

be used to gain further insights into the interactions of DNA with the

transport and recombination proteins. It can also potentially be used to

follow the entire transformation process from uptake to recombination to

expression of the integrated DNA. Not only can labelled DNA be used to

study the transport and integration of homologous DNA, but it can also be

used to study uptake and reconstitution of plasmid DNA. Many fluorescent

dyes can also be used for super-resolution microscopy (Dempsey et al.,

2011) which further opens up possibilities, such as a more accurate

determination of the number of DNA molecules transported during

competence. In short we conclude that labelled DNA is primarily taken up

at the pole as it can be seen to co-localise with ComFC at the pole. Our

results indicate that generally one molecule of DNA is taken u at a time,

and that uptake may occur in a serial rather than parallel manner. The

DNA is rapidly taken up and can be seen to also localise with the (actively

searching) form of RecA. Labelled DNA also co-localises with the

chromosome, with co-localisation with a specific locus increasing over

time.

Experimental procedures

PCR reaction for labelling with Fluorescein

1μl of 1mM fluorescein-12-dUTP (Thermo Fisher Scientific) and 2μl dNTP

mix (1mM dATP, dCTP, dGTP, 0.5mM dTTP (Thermo Fisher Scientific),

0.5 μl DreamTaq DNA polymerase (Thermo Fisher Scientific) 5μl

DreamTaq buffer, 1μM prMB013 and 1μM prMB014, 100ng PDG1664

(Guérout-Fleury et al., 1996) total volume 50μl. 35 cycles of a standard

Dreamtaq PCR protocol was used. A longer extension time of 3min was

used for a 2300bp product. After PCR samples were incubated for 2hrs

with 0.5μl DpnI (FastDigest Thermo Fisher Scientific).

Chapter 4

134

PCR samples were purified using a Machery-Nagel PCR kit. Samples were

stored at -20 ⁰C Samples were protected from light at all times. The label

incorporation of Fluorescein-dUTP lies between 1-3 pmol measured by

nanodrop.

Labelling with Dylight650

1μl dNTP mix (10mM dGTP, dCTP, dATP, 5mM dTTP, 5mM aminoallyl-

dUTP (Thermo Fisher Scientific) 0.25 μl Dreamtaq (Thermo Fisher

Scientific 5μl Dreamtaq buffer, 1μM prMB013 and 1μM prMB014, 100ng

template. Total volume 50μl, to obtain a high enough amount of product, 8

times 50μl reactions are needed. The PCR program was the same as for

Fluorescein. Samples were incubated for 2hrs with 0.5μl DpnI Samples

were purified with a Machery-Nagel PCR kit PCR kit The second wash step

was done with 80% ethanol and the samples were eluted with 60μl 0.1M

NaHCO3 pH9. Samples were incubated for 3hrs with DyLight650 or

DyLight550 (Thermo Fisher Scientific). Samples were purified with a

Machery-Nagel PCR kit. Labelling resulted in an incorporation of 1-3 pmol

as measured by Nanodrop.

Labelling with Alexa Fluor 5

Bioprime total genomic DNA labelling module (Thermo Fisher Scientific)

was used. Labelling with Alexa Fluor5 dNTP was done according to the

manufacturers protocol, but replacing the manufactures primer solution

with specific primers prMB013 and prMB014. pDG1664 was used as

template. Labelling resulted in an incorporation of between 5 and 9pmol as

measured by Nanodrop.

Labelling with Cy5/Cy3

Labelling with Cy3/Cy5-dUTP (Jena Bioscience) was done according to the

manufacturers protocol using pDG1664 as template and prMB013 and

prMB014 as primers. Labelling resulted in an incorporation of 1-2 pmol as

measured by Nanodrop.


135

Growth conditions

For the competence experiments A medium adapted from (Spizizen 1958)

and (Konkol et al., 2013) 18ml demi water, 2ml 10X competence medium

stock (0.615M K2HPO4 . 3H2O, 0.385M KH2PO4, 20% fructose, 10ml

300mM Tri-Na-citrate, 1ml 2% ferric NH4 citrate, 1g casein hydrolysate

(Oxoid), 2g potassium glutamate) 100μl 2mg/ml tryptophan, 67μl 1M

MgSO4.With the exception of BD4477 (Kramer et al., 2007) which was

grown using glucose as a carbon source. For the co-localisation

experiments of ComFC-GFP, RecA-YFP, ParB-GFP and ParB-mKate the

total volume was scaled up to a final volume of 20ml. For these experiment

the following conditions were used. A single colony was diluted 103-105 fold

in PBS or 1X Spizizen solution to ensure that the cultures are in the

exponential growth phase/early stationary after overnight growth. 100μl of

the diluted sc colony solution was added to 20ml medium 5μg/ml

chloramphenicol in 100 ml Erlenmeyer flasks and grown at 37 Celsius

220rpm. The overnight cultures were diluted to an OD600 of 0.05 in 20ml

medium without antibiotics. The Pxyl-comK strains were induced with 0.5%

xylose after 4hrs of growth. The Pspank-parB strains were also induced with

1mM of IPTG after 4hrs of growth.

Sample preparation

Cultures were incubated with DNA. At the desired time point for harvesting

the samples were incubated with 10U DNaseI in 400μl culture (Sigma-

Aldrich) for 10 minutes at 37°C. The samples were spun down (5000g) and

washed with 1X PBS. For fixing cells (20 minutes at room temperature) a

2% formaldehyde solution made from paraformaldehyde dissolved in 1X

PBS (pH7.4) was used. To protect the dyes samples were protected from

light exposure.

Slide preparation

Cells were immobilised using 1.5% agarose in 1X PBS, 10mM

sodiumacetate buffer pH4 or by polyacrylamide. Polyacrylamide slides

were made with 500μl 40% acrylamide, 1.5ml 1X PBS, 20μl 10%

ammonium persulfate and 2μl TEMED.

Chapter 4

136

A gene frame (Thermo Fisher Scientific or Westburg) was stuck on a glass

object carrier and the polyacrylamide was added and covered with another

object carrier. The slide was left to solidify after which the top slide was

removed and the solidified gel was washed 3x with 30 minutes with PBS.

The gel was kept in PBS until needed and cut in smaller pieces when

necessary. Microscopy was performed on a GE-healthcare OlympusIX71DV

or DVelite microscope. Images were deconvolved with the Softworks

imaging software. Analysis, colour assignment and overlay images were

created using ImageJ and saved as RGB Tiff. Images were put to a 300

pixels/inch CMYK format with Adobe photoshop.

Strain construction

The 168 amyE::pxyl-comK-cm_comFC-gfp-tet strain was obtained by

USER cloning. It consists of a fusion of gfp-DSM with a flexible linker from

JWV500 (Kjos et al., 2015) using primers prMB94 & prMB62 to comFC

prMB97 & prMB89 followed by the pBEST309 tetracyclin region (Itaya,

1992) primers prMB93 & prMB100 and the upstream flanking region of

comFC prMB88 & prMB62. The different components of the construct

were obtained by PCR with pfux7 (Nørholm, 2010), treated with USER

enzyme (NEB), ligated overnight at 4°C and transformed directly into 168

amyE::pxyl-comK-cm for integration into the native locus. The strain was

checked for proper integration by PCR and sequenced. B. subtilis

168_amyE::Pxyl-comK _thrC::Pspank-parB-gfp and B. subtilis 168

amyE::Pxyl-comK_thrC::Pspank- parB-mkate2 were created by

amplification of parB-mkate2 from pMK17 and parB-gfp from pMK11

(Kjos et al., 2015; Raaphorst et al., 2016) with primers 133 and 134. parB-

gfp and parB-mkate were cloned into pMB002 using NheI and HindIII

(FastDigest Thermo Scientific) ligated with T4 ligase (Thermo Scientific)

and transformed into E.coli DH5-α and sequenced. B. subtilis 168 amyE::

Pxyl-comK was transformed with pMB002-parB-mkate or pMB002-parB-

gfp. B. subtilis 168 amyE:: Pxyl-comK _Pcomg-gfp was created by

transformation with chromosomal DNA from B. subtilis 168 PcomG-gfp

(Smits et al., 2005).


137

strains genomic context reference

B. subtilis 168 Pxyl-comK amyE::PxylR-PxylA-comK, trpC2

cmr

(Hahn et al., 1996)

B. subtilis 168 Pxyl-comK-PcomG-

gfp

amyE:: PxylR-PxylA-comK -PcomG-

gfp, trpC2 cmr km

r

This study, made by Claudio

Tiecher

B. subtilis 168 Pxyl-

comK_comFC-gfp

amyE::PxylR-PxylA-comK_comFC-

gfp, trpC2 cmr tet

r

This study

B. subtilis 168 Pxyl-comK_Pspank-

parB-gfp

amyE:: PxylR-PxylA-comK_

thrC::Pspank parB-gfp, trpC2

cmrery

r

This study

B. subtilis 168 Pxyl-comK_parB-

mkate2

amyE:: PxylR-PxylA-comK_

thrC::Pspank parB-mkate2, trpC2

cmrery

r

This study

B. subtilis 168 BD4477 recA-yfp_amyE::Pspank-cfp-yjbF,

his leu met cmr, sp

r

(Kramer et al., 2007)

B.subtilis 168 PcomG-gfp PcomG-gfp kmr (Smits et al., 2005)

Primers

ID name sequence

prMB013 PDG1664-ery_F GGGAACGGTTGGAGCTAATG

prMB014 PDG1664-ery-R TTCCGGGAACAGTGACAGAG

prMB62 U-yvyF-R GATTTTAGAAUTGATTCTGTTTTTATGCCGATATAATC

prMB88 U-comFC-R TTAAGCTCGAUTATGGTGTGGAAACTGGAAG

prMB89 comFC-flank-F TGCATGCCTGUCATAGTATCCGGCACTGTTG

prMB93 tetL-R TTCTAAAATCUTTCCTGTTATAAAAAAAGGATCAATTTTG

prMB94 P2-mcherry-F GATCCGGATUCTGGTGGAGAAGCTGCAGCTAAAG

prMB97 P2-U-comFC-mcherry-F ATCCGGATCUGCTTCTGATCAAGGTAAAAG

prMB100 tetL-mcherry-F TAAGAATTCGUATGAACAGCTTATTTACATAATTCAC

prMB108 P3-gfp-dsm-R CGAATTCTTAUTTACTTATAAAGCTCATCCATGCCGTGAGTG

133 GATCAAGCTTGAGTACTGATTAACTAATAAGGAG

134 TACTAGCTAGCGCTATCAAAAGAATCTTGC

Chapter 4

138

References

Baitin, D.M., Gruenig, M.C., and Cox, M.M. (2008). SSB Antagonizes RecX-RecA

Interaction. J. Biol. Chem. 283, 14198–14204.

Chung, Y.S., and Dubnau, D. (1998). All Seven comG Open Reading Frames Are Required

for DNA Binding during Transformation of Competent Bacillus subtilis. J. Bacteriol. 180,

41–45.

Davidoff-Abelson, R., and Dubnau, D. (1973). Conditions Affecting the Isolation from

Transformed Cells of Bacillus subtilis of High-Molecular-Weight Single-Stranded

Deoxyribonucleic Acid of Donor Origin. J. Bacteriol. 116, 146–153.

Dempsey, G.T., Vaughan, J.C., Chen, K.H., Bates, M., and Zhuang, X. (2011). Evaluation of

fluorophores for optimal performance in localization-based super-resolution imaging.

Nat. Methods 8, 1027–1036.

Draskovic, I., and Dubnau, D. (2005). Biogenesis of a putative channel protein, ComEC,

required for DNA uptake: membrane topology, oligomerization and formation of

disulphide bonds. Mol. Microbiol. 55, 881–896.

Dubnau, D. (1999). Dna Uptake in Bacteria. Annu. Rev. Microbiol. 53, 217–244.

Grove, D.E., Willcox, S., Griffith, J.D., and Bryant, F.R. (2005). Differential Single-stranded

DNA Binding Properties of the Paralogous SsbA and SsbB Proteins from Streptococcus

pneumoniae. J. Biol. Chem. 280, 11067–11073.

Guérout-Fleury, A.-M., Frandsen, N., and Stragier, P. (1996). Plasmids for ectopic

integration in Bacillus subtilis. Gene 180, 57–61.

Hahn, J., Luttinger, A., and Dubnau, D. (1996). Regulatory inputs for the synthesis of

ComK, the competence transcription factor of Bacillus subtilis. Mol. Microbiol. 21, 763–

775.

Hahn, J., Maier, B., Haijema, B.J., Sheetz, M., and Dubnau, D. (2005). Transformation

Proteins and DNA Uptake Localize to the Cell Poles in Bacillus subtilis. Cell 122, 59–71.

Inamine, G.S., and Dubnau, D. (1995). ComEA, a Bacillus subtilis integral membrane

protein required for genetic transformation, is needed for both DNA binding and

transport. J. Bacteriol. 177, 3045–3051.

Itaya, M. (1992). Construction of a Novel Tetracycline Resistance Gene Cassette Useful as

a Marker on the Bacillus subtilis Chromosome. Biosci. Biotechnol. Biochem. 56, 685–686.

Kaufenstein, M., Laan, M. van der, and Graumann, P.L. (2011). The Three-Layered DNA

Uptake Machinery at the Cell Pole in Competent Bacillus subtilis Cells Is a Stable Complex.

J. Bacteriol. 193, 1633–1642.

Referencees

139

Kidane, D., and Graumann, P.L. (2005). Intracellular Protein and DNA Dynamics in

Competent Bacillus subtilis Cells. Cell 122, 73–84.

Kidane, D., Ayora, S., Sweasy, J.B., Graumann, P.L., and Alonso, J.C. (2012). The cell pole:

the site of cross talk between the DNA uptake and genetic recombination machinery. Crit.

Rev. Biochem. Mol. Biol. 47, 531–555.

Kjos, M., Aprianto, R., Fernandes, V.E., Andrew, P.W., Strijp, J.A.G. van, Nijland, R., and

Veening, J.-W. (2015). Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging

of Host-Pathogen Interactions. J. Bacteriol. 197, 807–818.

Konkol, M.A., Blair, K.M., and Kearns, D.B. (2013). Plasmid-Encoded ComI Inhibits

Competence in the Ancestral 3610 Strain of Bacillus subtilis. J. Bacteriol. 195, 4085–4093.

Kramer, N., Hahn, J., and Dubnau, D. (2007). Multiple interactions among the

competence proteins of Bacillus subtilis. Mol. Microbiol. 65, 454–464.

Takeno, M., Taguchi, H., and Akamatsu, T. (2011). Role of ComFA in controlling the DNA

uptake rate during transformation of competent Bacillus subtilis. J. Biosci. Bioeng. 111,

618–623.

Vagner, V., Claverys, J.-P., Ehrlich, S.D., and Méjean, V. (1990). Direction of DNA entry in

competent cells of Bacillus subtilis. Mol. Microbiol. 4, 1785–1788.

Viret, J.F., Bravo, A., and Alonso, J.C. (1991). Recombination-dependent concatemeric

plasmid replication. Microbiol. Rev. 55, 675–683.

Yadav, T., Carrasco, B., Myers, A.R., George, N.P., Keck, J.L., and Alonso, J.C. (2012).

Genetic recombination in Bacillus subtilis: a division of labor between two single-strand

DNA-binding proteins. Nucleic Acids Res. 40, 5546–5559.

Yadav, T., Carrasco, B., Serrano, E., and Alonso, J.C. (2014). Roles of Bacillus subtilis DprA

and SsbA in RecA-mediated Genetic Recombination. J. Biol. Chem. 289, 27640–27652.

Londoño-Vallejo, J.A., and Dubnau, D. (1993). comF, a Bacillus subtilis late competence

locus, encodes a protein similar to ATP-dependent RNA/DNA helicases. Mol. Microbiol. 9,

119–131.

Nørholm, M.H. (2010). A mutant Pfu DNA polymerase designed for advanced uracil-

excision DNA engineering. BMC Biotechnol. 10, 21.

Piechowska, M., and Fox, M.S. (1971). Fate of Transforming Deoxyribonucleate in

Bacillus subtilis. J. Bacteriol. 108, 680–689.

Provvedi, R., and Dubnau, D. (1999). ComEA is a DNA receptor for transformation of

competent Bacillus subtilis. Mol. Microbiol. 31, 271–280.

Raaphorst, R. van, Kjos, M., and Veening, J.-W. (2016). Chromosome segregation drives

division site selection in Streptococcus pneumoniae. BioRxiv 087627.

Chapter 4

140

Smits, W.K., Eschevins, C.C., Susanna, K.A., Bron, S., Kuipers, O.P., and Hamoen, L.W.

(2005). Stripping Bacillus: ComK auto-stimulation is responsible for the bistable response

in competence development. Mol. Microbiol. 56, 604–614.

Spizizen, J. (1958). Transformation of biochemically deficient strains of Bacillus subtilis by

deoxyribonucleate. Proceedings of the National Academy of Sciences, 44(10), 1072-1078.

Stingl, K., Müller, S., Scheidgen-Kleyboldt, G., Clausen, M., and Maier, B. (2010).

Composite system mediates two-step DNA uptake into Helicobacter pylori. Proc. Natl.

Acad. Sci. 107, 1184–1189.

Supplementary material Chapter 4

Images

Img. 1. Binding of labelled DNA to competent B. subtilis. (A). DyLight650 labelled DNA. (B) Fluorescein labelled DNA. C: Alexa Fluor 5 labelled DNA. Samples were incubated with 10U of DNaseI for 10minutes and washed to remove unspecific binding.

Supplementary material

141

Img. 2. Fluorescein labelled DNA localisation at pH 7.4 and pH4. (A). Fluorescein labelled DNA at pH7.4 occasionally shows foci at the border of the cells. (B). Fluorescein labelled DNA at pH4 does not show foci at the edge of cells. The chromosome was strained with DAPI.

Img. 3. Co-localisation of RecA-YFP with DyLight650 labelled DNA. A: Overlay of RecA-YFP and DyLight650-DNA. B: RecA-YFP. C: DyLight650-DNA.

Chapter 4

142

Tables

colonies reduction efficiency

Fluorescein-DNA 745 3

DyLight650-DNA 852 2.7

Unlabelled DNA 2340

nr.foci 1 2 3 4

nr.cells 465 110 22 2

percentage 77.6 18.4 3.7 0.3

Img. 4. Co-localisation ParB-GFP with DyLight650 labelled DNA. (A). Overlay of ParB-mKate and Fluorescein-DNA. (B) ParB-mKate. (C). Fluorescein -DNA. This image was changed from the draft of the thesis to improve quality in the print editon.

Table 1. Transformation of B. subtilis Pxyl-comK with Fluorescein-DNA, DyLight650-DNA and unlabelled DNA. The DNA contains the erythromycin marker and thrC flanking regions from pDG1664.

Table 2. Number of DyLight650-DNA foci per cell. Number of DNA foci after 1hr incubation with DyLight650 DNA and incubation with 10U DNaseI.


143

time pole centre

pole/

chrom.

centre/

chrom. 2pole 2centre

pole/

cent. septum tot foci

tot

cells

15min 63 64 14 56 1 5 4 13 220 371

30min 76 57 5 35 2 4 3 4 186 500

45min 90 64 4 41 4 10 9 9 231 671

60min 58 37 6 39 4 8 8 11 171 578

75min 65 60 11 38 4 12 10 4 204 643

90min 53 65 8 46 4 26 7 14 223 559

120min 74 58 2 49 3 18 5 11 220 510

average 68 58 7 43 3 12 7 9 208 547

% 33 28 3 21 2 6 3 5 100

time pole centre

Pole/

chrom,

Centre/

chrom. 2pole 2centre

Pole/

cent. Sept.

tot

foci

tot

cells

1min 111 77 16 69 4 3 3 15 298 625

15min 112 72 21 72 5 9 10 23 324 817

30min 78 58 11 63 7 12 9 7 245 626

45min 130 80 18 65 9 20 12 15 349 736

60min 73 49 16 48 8 10 12 12 228 592

75min 73 66 43 59 3 6 12 11 273 517

Avrg. 96 67 21 63 6 10 10 14 286 652

% 34 23 7 22 2 3 3 5 100

Table 3. Localisation of Fluorescein labelled DNA. Localisation of DNA foci was followed over time by taking a sample at each time point and the average percentage of foci types during this period were calculated. See image 4 in main text for examples of localisation.

Table 4. Localisation of DyLight650 labelled DNA. Localisation of DNA foci was

followed over time by taking a sample at each time point and the average

percentage during this period was calculated.

Chapter 4

144

total nr. cells: 3369 DNA ComFC co-localisation

total nr. foci 1104 872 197

percentage cells with foci 33 26 6

Percentage co-localisation DNA/ComFC 23

total nr. cells: 1749 DNA RecA-YFP co-localisation



percentage co-localisation DNA/RecA 26

total nr. cells: 4538 DNA RecA-YFP co-localisation



percentage co-localisation DNA/RecA 15

total nr. cells: 1252 DNA ParB-GFP co-localisation



percentage co-localisation DNA/ParB-GFP 3

Table 5. Co-localisation of DyLight650-DNA with ComFC-GFP after 10min of incubation with DNA. Co-localisation DNA/ComFC was calculated tot. nr. foci co-localistaion/tot. nr foci ComFC

Table 6. Co-localisation of DyLight650 labelled DNA with RecA-YFP after 15min of incubation with DNA. Co-localisation DNA/RecA was calculated tot. nr. foci co-localisation/tot. nr foci RecA

Table 7. Co-localisation of DyLight650 labelled DNA with RecA-YFP after 1hr of incubation with DNA. Co-localisation DNA/RecA was calculated tot. nr. foci co-localisation/tot. nr foci RecA

Table 8. Co-localisation of DyLight650 labelled DNA with ParB-GFP after 10min of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci co-localisation/tot. nr foci ParB


145

total nr. cells: 1137 DNA ParB-GFP co-localisation



percentage co-localisation DNA/ParB-GFP 7

total nr. cells: 1292 DNA parB-mKate co-localisation


percentage cells with foci 36 24 1.5

percentage overlap DNA/ParB-mKate 4

total nr. cells: 2200 DNA parB-mKate co-localisation

total nr. foci 1205 1173 107


percentage overlap DNA/ParB-makte 9

Table 9. Co-localisation of DyLight650 labelled DNA with ParB-GFP after 1hr of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci co-localisation/tot. nr foci ParB

Table 10. Co-localisation of Fluorescein labelled DNA with ParB-mKate after 10min of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci co-localisation/tot. nr foci ParB

Table 11. Co-localisation of Fluorescein labelled DNA with ParB-mKate after 1hr of incubation with DNA. Co-localisation DNA/ ParB was calculated tot. nr. foci co-localisation/tot. nr foci ParB

university of groningen bacillus subtilis: sporulation

Documents