s3-eu-west-1.amazonaws.com · web viewsupplemental material. microsatellite . methods. next...
TRANSCRIPT
![Page 1: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/1.jpg)
SUPPLEMENTAL MATERIAL
Microsatellite Methods
Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed on a CTAB DNA extraction (Saghai-Maroof et al. 1984) of an individual mussel (C.478062.008). RNAse A treatment was used after the pellet from the initial precipitation with ethanol was re-suspended. This solution was re-extracted once with phenol/chloroform/iso-amyl alcohol 25:24:1 and once with chloroform/iso-amyl alcohol 24:1) following which DNA was precipitated from the supernatant with an equal volume of iso-propanol. The pellet was washed with 70% ethanol and air dried. Sequencing was performed at the Australian Genomics Research Facility. After quality checking with FastQC (Andrews 2016), the raw reads were assembled into contigs with CLC Genomics Workbench on a local installation using a variety of parameter values in different runs. The assembly used here had the largest value for N50 (the length shorter than 50% of the contigs) and was based on a word length of 20, bubble size of 30 and the ‘fast’ algorithm.
Initially, amplifications were made at several annealing temperatures using single oligonucleotide pairs to determine the optimum for each. Six of the pairs produced weak or no products during these trials and were not further tested for this report. For reasons of economy, the other pairs were amplified in various multiplex reactions containing three or four primer sets as follows (with annealing temperature in parentheses):
A (50o C): 166169, 163859, 225107, 264118
B (52o C): 236938, 230140, 224480
C (52o C): 36946, 185220, 226696
D (54o C): 609874, 714132, 520541, 531786
E (50o C): 163859, 225107, 520541, 226696
Five of the tested primer pairs produced phenotypes that were variable and interpretable as alleles at a single locus. These were 163859, 166169, 225107, 609875 and 714132. Pair 226696 produced one band in all amplification products and displayed no variation in the four specimens that were sequenced - one from clade A (EBU65323), one from clade E (EBU65326) and two from clade H (EBU59408 and C.478057.016). Locus 224480 had variant phenotypes but the variation was not interpretable as the product of a single locus. Details of the microsatellites’ scoring for individual specimens are presented in Table SII.
The remaining microsatellite pairs either produced phenotypes that were not interpretable as single-locus products or that did not amplify with sufficient success to be routinely scored. In particular, there appeared to be preferential amplification for the two shorter products in combination D when the results were compared to those from single primer pair amplifications.
![Page 2: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/2.jpg)
Table SI: Microsatellite primer sequences. Labelled sequences are indicated by the figure 5 signifying that the label is attached to the 5’ end of the oligonucleotide. The value for meting temperature (TM) is that provided by the manufacturer. The optimal annealing temperature found for PCR for specified primers is written in the second last column. Primer pairs that could not be successfully amplified are indicated by “n.s.”. The value in the last column is the expected size based on the Batch Primer 3 results.
Primer Name
Sequence Length TM (oC)
Label Repeat Length
Anneal Temp.
Size
128004L 5GCTGAGTAACTTTGCTTTTCAG
22 51 HEX 2 n.s. 123
128004U TTGTTCGGAGATACCAATGA
20 48
163859L 5CCCATATCAATTCAGGCTAT
20 48 FAM 3 50 180
163859U AGGGTGAAAGTTTGGGTCTA
20 50
166169L 5GGCCTGTTGTCAAAGAAGAT
20 50 TAMRA 2 50 125
166169U TGAGATGCAGAGAGTGAAAGA
21 50
185220L 5CCATTAGGTCATTTGTAGCA
20 48 HEX 2 52 180
185220U TCAGAAAAACGGGAGAAAAC
20 48
222046L 5TTGTATTGTTGAAGGCCACA
20 48 FAM 2 n.s. 223
222046U CAGGAAGACATTGATGACAA
20 48
224480L 5ACCCAAGGTAGAAGCCTAAA
20 50 FAM 2 52 224
224480U CATTTCTCCTTCTTTCACCA
20 48
225107L 5CCTACAGAGGTGACATTTGC
20 52 TAMRA 2 50 180
225107U GCGGAGACAAGATACACAGA
20 52
225341L 5GAACTGCAGACCTAGAGCAG
20 54 HEX 4 n.s. 244
225341U TTTAAGGCGTTTACTGATGC
20 48
226696L 5ACAGCAAAACAGAACAGACC
20 50 TAMRA 5 52 237
226696U CCCTAAAACCCGTATTTCAT
20 48
228952L 5GGTTGAAATCTGTTCAGTGG
20 50 FAM 3 n.s. 181
228952U TGTTTACCGAGCGACTTTTA
20 48
230140L 5CAGTCCTGGCATAGCATATT
20 50 HEX 3 52 116
230140U CATTCATCCCTTTTTCTGGT
20 48
236938L 5CCAAAGATCATTGCGACTT
19 47 TAMRA 3 52 110
236938U TTCCAAAGGGAAAGACCTAC
20 50
![Page 3: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/3.jpg)
Primer Name
Sequence Length TM (oC)
Label Repeat Length
Anneal Temp.
Size
244904L 5CGTTTGCACATCTCCTTTAG
20 50 FAM 3 n.s. 233
244904U TCTCACAGTCAGTTTCATGC
20 50
264118L AGAAAGCCATCAAAATAGCC
20 48 HEX 3 50 231
264118U ATCTTTCCCAAGTAGCCATC
20 50
36946L 5GCTCGCAATGGCAATTCT 18 48 FAM 3 52 13036946U TGGTGACCTACCCACATA
CA20 52
520541L 5TTTGGCTTTCCCTTCGTTTT
20 48 FAM 2 56 280
520541U CGAACATGTCGTCGGATTTT
20 50
531786L 5GCCATTTTGACCATTTGCTT
20 48 HEX 2 56 290
531786U ACGAGGAACAGTGAAATAGGG
21 52
576350L 5CGTGCAATTGGTTGTACTCA
20 50 FAM 2 n.s 207
576350U AACATGCCAACGCAACAATA
20 48
609874L 5GAGTCGCTGTCGGTTCATC
19 53 FAM 2 56 140
609874U TGGAAAACAAGTTGGTTGTAGG
22 51
714132L 5TGGAGGTGCTCATCAAACTT
20 50 HEX 3 56 190
714132U CAGTGGAACCTGTCTAATCCAA
22 53
![Page 4: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/4.jpg)
Table SII: Details of the genetic results for individual specimens. The first two columns indicate the individual’s population and Registration number. The next specifies the identified lineage for the COI sequence (“ug” = ungrouped). An asterisk in this column indicates a sequence in only one direction and a hatch mark that the individual was also sequenced for an amplification product from primers searching for M-type sequences. The remaining columns give the microsatellite scoring for the specified loci. The value “n.s.” indicates that the specimen was not able to be scored although the appropriate amplification was made to attempt this.
Population Registration COI 163859 166169 225107 609874 714132Allele 1 2 1 2 1 2 1 2 1 2
1 EBU 59566 B 194 203 224 224 n.s. n.s. 123 131 n.s. n.s.1 EBU 59567 N 197 197 224 224 181 181 138 138 183 1861 EBU 59568 N 182 203 n.s. n.s. 185 185 137 138 183 1861 EBU 59569 N 194 197 255 255 159 181 130 138 183 1831 EBU 59570 J 179 194 224 255 191 191 140 147 174 1831 EBU 59571 N 200 200 224 224 171 171 138 165 177 1831 EBU 59572 N 200 200 224 255 169 169 123 140 183 1861 EBU 59573 N 200 211 n.s. n.s. 185 185 138 138 174 1831 EBU 59574 N 185 203 224 228 177 191 138 161 183 1861 EBU 59575 N 182 203 228 255 191 191 n.s. n.s. n.s. n.s.1 EBU 59576 N 200 200 228 228 n.s. n.s. 136 138 171 1711 EBU 59577 N 194 197 n.s. n.s. 171 171 122 136 183 1831 EBU 59578 N 197 212 224 224 191 1911 EBU 59579 N 197 197 228 255 n.s. n.s. 132 148 183 1831 EBU 59580 I 197 200 214 214 185 191 138 139 183 1831 EBU 59581 N 200 206 n.s. n.s. 177 1851 EBU 59582 D 200 203 224 224 191 191 130 132 n.s. n.s.1 EBU 59583 N 200 200 255 255 179 179 138 151 173 1831 EBU 59584 N* 200 203 224 224 175 191 138 140 183 1831 EBU 59585 N* 200 200 n.s. n.s. 177 191 123 131 n.s. n.s.1 EBU 59586 N* 200 203 228 228 191 191 141 143 183 1861 EBU 59587 N 200 200 224 224 181 181 133 133 173 1831 EBU 59588 N 206 212 n.s. n.s. 185 185 136 141 193 1931 EBU 59589 N 203 212 224 255 191 191 141 141 173 1732 EBU 65302 J2 EBU 65304 A2 EBU 65306 A
![Page 5: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/5.jpg)
Population Registration COI 163859 166169 225107 609874 714132Allele 1 2 1 2 1 2 1 2 1 2
2 EBU 65308 D2 EBU 65310 D2 EBU 65312 J3 EBU 65099 179 179 125 141 174 1833 EBU 65322 A 185 185 125 129 171 1713 EBU 65323 A 167 167 116 132 160 1833 EBU 65324 C 187 191 128 141 183 1833 EBU 65325 C 179 191 137 138 174 1803 EBU 65326 E 177 177 127 127 n.s. n.s.3 EBU 65327 I 187 191 n.s. n.s. n.s. n.s.3 EBU 65328 177 177 n.s. n.s. n.s. n.s.3 EBU 65329 123 132 183 1863 EBU 65330 A 177 177 136 150 183 1833 EBU 65331 A 179 191 123 141 174 1743 EBU 65332 A 181 181 183 1864 C.478062.002 H 228 228 191 191 n.s. n.s. 171 1834 C.478062.011 A#4 C.478062.013 E4 C.478062.014 H4 C.478062.016 A4 C.478062.017 B#4 C.478062.018 E4 C.478062.019 H4 C.478062.003 H 203 203 n.s. n.s. 171 175 126 132 183 1834 C.478062.004 143 1524 C.478062.005 A 203 203 234 234 191 191 135 147 183 1834 C.478062.006 B 203 203 248 248 191 1914 C.478062.007 A 197 203 269 269 191 1914 C.478062.008 C 224 224 177 181 132 140 186 1864 C.478062.009 A 248 248 177 1774 C.478062.010 E5 EBU 59515 D 197 200 255 255 177 181 138 147 183 1835 EBU 59516 N 185 191 n.s. n.s. n.s. n.s. 126 126 n.s. n.s.5 EBU 59517 179 179 n.s. n.s. 179 179 131 148 183 1835 EBU 59518 A 194 194 n.s. n.s. 177 177 129 141 183 183
![Page 6: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/6.jpg)
Population Registration COI 163859 166169 225107 609874 714132Allele 1 2 1 2 1 2 1 2 1 2
5 EBU 59519 194 194 n.s. n.s. 191 191 136 138 183 1835 EBU 59520 H 203 203 n.s. n.s. 189 189 132 138 168 1685 EBU 59521 I 206 209 n.s. n.s. 179 185 138 141 183 1835 EBU 59522 A 176 182 214 255 191 191 123 141 183 1865 EBU 59523 I 197 203 n.s. n.s. 191 191 131 131 183 1835 EBU 59524 I 197 197 n.s. n.s. 191 191 131 132 n.s. n.s.5 EBU 59525 I 185 206 n.s. n.s. 191 191 138 157 183 1835 EBU 59526 209 212 n.s. n.s. 177 1855 EBU 59527 M5 EBU 59528 H5 EBU 59529 H5 EBU 59530 B5 EBU 59531 H5 EBU 59532 H5 EBU 59533 H5 EBU 59534 H5 EBU 59535 M5 EBU 59536 C5 EBU 59537 H6 C.478069.002 F6 C.478069.003 F6 C.478069.004 F6 C.478069.005 F6 C.478069.006 F6 C.478069.007 F7 EBU 59477 F 185 212 n.s. n.s. 177 177 119 127 183 1837 EBU 59478 F 209 209 n.s. n.s. 177 177 132 140 177 1777 EBU 59479 F 209 212 228 228 177 177 132 140 n.s. n.s.7 EBU 59480 F 185 209 255 255 171 191 n.s. n.s. 183 1837 EBU 59481 197 197 n.s. n.s. 177 186 126 156 183 1837 EBU 59482 F 188 191 n.s. n.s. 171 191 124 140 174 1837 EBU 59483 F 203 203 224 224 191 191 124 132 n.s. n.s.7 EBU 59484 F 197 197 n.s. n.s. 171 171 122 126 174 1837 EBU 59485 F 212 215 224 224 171 177 126 126 186 1867 EBU 59486 I 188 203 228 228 181 191 132 132 174 183
![Page 7: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/7.jpg)
Population Registration COI 163859 166169 225107 609874 714132Allele 1 2 1 2 1 2 1 2 1 2
7 EBU 59487 F 224 224 179 179 n.s. n.s. 171 1837 EBU 59488 F 194 212 228 255 191 191 128 138 171 1717 EBU 59489 F 197 203 n.s. n.s. 179 191 127 129 183 1837 EBU 59490 F 182 197 n.s. n.s. 171 171 139 141 186 1867 EBU 59491 F 188 211 n.s. n.s. 171 177 132 132 n.s. n.s.7 EBU 59492 F 200 206 224 224 179 191 123 132 183 1837 EBU 59493 F 194 200 224 224 171 189 132 158 183 1837 EBU 59494 F 197 215 238 238 185 191 132 146 174 1748 C.478070.002 A8 C.478070.003 E8 C.478070.004 I8 C.478070.005 A9 C.478057.002 I 177 185 138 138 171 1719 C.478057.003 H 203 203 234 234 175 175 141 145 183 1839 C.478057.004 I 200 203 248 248 n.s. n.s. 135 137 186 1869 C.478057.005 191 191 130 132 171 1719 C.478057.006 H 185 206 228 228 177 177 126 126 n.s. n.s.9 C.478057.007 H 248 248 177 177 141 147 183 1839 C.478057.010 203 203 n.s. n.s. n.s. n.s. 130 144 177 1779 C.478057.008 H9 C.478057.017 H9 C.478057.018 H9 C.478057.019 H9 C.478057.009 H 194 203 n.s. n.s. 191 191 152 152 186 1869 C.478057.011 H 224 2249 C.478057.012 H 203 203 248 248 181 191 n.s. n.s. n.s. n.s.9 C.478057.013 M 203 203 234 234 177 177 123 146 183 1869 C.478057.014 H 194 203 234 269 177 177 134 137 171 1719 C.478057.015 D 203 203 224 248 177 185 144 144 171 1839 C.478057.016 H# 248 248 179 179 131 147 n.s. n.s.9 C.478057.018 M10 EBU65380 177 177 141 173 183 18610 EBU 65381 183 189 183 18310 EBU 65382 H 185 185 123 145 183 18310 EBU 65383 H n.s. n.s. 136 148 183 183
![Page 8: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/8.jpg)
Population Registration COI 163859 166169 225107 609874 714132Allele 1 2 1 2 1 2 1 2 1 2
10 EBU 65384 H 177 177 129 131 171 18310 EBU 65385 181 188 135 137 183 18310 EBU 65386 H* n.s. n.s. 123 137 186 18610 EBU 65387 H 179 191 130 134 183 18310 EBU 65388 Ug n.s. n.s. 126 126 186 18610 EBU 65389 H 177 179 131 146 174 18310 EBU 65390 H 177 177 126 143 183 18310 EBU 65391 H 187 187 126 126 183 18310 EBU 65392 177 185 150 152 165 18310 EBU 65393 H 177 191 133 143 165 18311 C.478065.002 B#11 C.478065.003 H11 C.478065.004 H11 C.478065.005 H11 C.478065.007 H*11 C.478065.008 H11 C.478065.009 M11 C.478065.011 I11 C.478065.012 H11 C.478065.013 H11 C.478065.014 E11 C.478065.015 H11 C.478065.016 H11 C.478065.017 I12 C.478066.002 H12 C.478066.004 I12 C.478066.005 A13 EBU 59406 H* 177 177 140 140 186 20113 EBU 59407 H* n.s. n.s. 120 137 183 18313 EBU 59408 H 191 191 144 155 183 18313 EBU 59409 H* 177 177 148 152 183 18313 EBU 59410 191 191 137 146 183 18313 EBU 59411 H 191 191 136 148 183 18613 EBU 59412 177 177 123 134 183 18613 EBU 59413 H 191 191 138 138 183 183
![Page 9: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/9.jpg)
Population Registration COI 163859 166169 225107 609874 714132Allele 1 2 1 2 1 2 1 2 1 2
13 EBU 59414 177 191 138 148 177 18613 EBU 59415 H 185 185 137 158 183 18313 EBU 59416 H 191 191 122 138 174 17413 EBU 59417 B# 191 191 132 132 183 18313 EBU 62716 H 197 203 n.s. n.s. 177 177 132 142 183 18313 EBU 62717 H 194 215 n.s. n.s. 181 181 141 148 180 18313 EBU 62718 H* 182 194 228 228 191 191 130 148 174 18313 EBU 65024 A 206 206 n.s. n.s. n.s. n.s. 135 137 183 18613 EBU 65025 H 203 203 n.s. n.s. 181 181 139 141 183 18313 EBU 65026 H 191 197 224 224 179 179 123 130 183 18313 EBU 65027 H 197 197 224 224 191 191 126 132 183 18613 EBU 65028 H 194 197 224 255 191 191 132 148 183 18313 EBU 65029 197 206 n.s. n.s. 179 179 131 152 183 18314 EBU 59437 123 142 183 18314 EBU 59438 K n.s. n.s. n.s. n.s. 183 18914 EBU 59439 H 132 141 171 17114 EBU 59440 A14 EBU 59441 H 177 191 183 18614 EBU 59442 D 177 177 123 123 183 18614 EBU 59443 H n.s. n.s. 123 140 177 17714 EBU 59444 H* n.s. n.s. 128 12814 EBU 59445 H 175 17514 EBU 59446 A 191 191 183 18314 EBU 59447 H 189 191 123 12314 EBU 59448 191 191 137 142 n.s. n.s.15 EBU 59465 H 197 200 n.s. n.s. 175 175 132 132 183 18315 EBU 59466 H 188 206 224 224 179 179 123 132 183 18615 EBU 59467 K 194 194 n.s. n.s. 185 191 125 134 183 18315 EBU 59468 B 197 203 224 224 191 191 123 123 171 17115 EBU 59469 H 194 217 n.s. n.s. 191 191 137 148 174 18315 EBU 59470 194 197 n.s. n.s. 177 19515 EBU 59471 E 182 191 224 255 185 20115 EBU 59472 B 200 203 n.s. n.s. 191 191 121 121 174 18315 EBU 59473 255 255 191 191 132 135 n.s. n.s.15 EBU 59474 H 203 209 228 228 177 189
![Page 10: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/10.jpg)
Population Registration COI 163859 166169 225107 609874 714132Allele 1 2 1 2 1 2 1 2 1 2
15 EBU 59475 H 194 194 n.s. n.s. 177 177 137 142 171 18615 EBU 59476 A* 194 200 228 228 177 185 132 156 183 18316 EBU 59401 A 197 209 228 228 n.s. n.s. 131 138 177 18316 EBU 59402 C 122 141 177 18616 EBU 59403 194 209 224 255 177 18516 EBU 62713 A* 200 200 228 255 177 179 132 135 177 17716 EBU 6271416 EBU 6271517 EBU 59404 A 185 185 n.s. n.s. 187 187 147 157 186 18617 EBU 59405 E 195 195 224 255 187 187 134 135 183 18318 C.478068.002 F18 C.478068.003 F19 EBU 59551 F 200 203 n.s. n.s. 177 179 132 146 174 18319 EBU 59552 F 194 194 n.s. n.s. 179 179 127 132 183 18319 EBU 59553 F 176 209 n.s. n.s. 179 179 124 141 183 18319 EBU 59554 F 212 212 n.s. n.s. 171 177 116 140 183 18619 EBU 59555 F 200 215 n.s. n.s. 177 177 124 141 183 18319 EBU 59556 F 194 194 n.s. n.s. 177 177 126 152 183 18319 EBU 59557 F 209 212 n.s. n.s. 171 171 126 132 183 18319 EBU 59558 F 128 134 n.s. n.s.19 EBU 59559 n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s.19 EBU 59560 F 188 209 n.s. n.s. 177 183 n.s. n.s. n.s. n.s.19 EBU 59561 F 209 209 212 228 179 179 124 138 183 18919 EBU 5956219 EBU 59563 F 194 194 n.s. n.s. 191 191 124 131 174 17419 EBU 59564 F 200 200 n.s. n.s. 171 171 n.s. n.s. n.s. n.s.19 EBU 59565 F 197 197 228 228 183 183 120 120 n.s. n.s.20 EBU65340 177 17920 EBU65349 136 136 183 18320 EBU65350 D 203 209 228 228 130 135 171 17120 EBU65351 G 122 127 171 17120 EBU65352 G 203 203 228 234 177 18520 EBU65353 G n.s. 228 228 177 177 141 143 171 18620 EBU65354 ug n.s. 228 234 177 17720 EBU65355 130 140 183 183
![Page 11: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/11.jpg)
Population Registration COI 163859 166169 225107 609874 714132Allele 1 2 1 2 1 2 1 2 1 2
20 EBU65356 G 197 203 228 234 177 179 150 152 171 18620 EBU65357 G 191 197 234 234 177 177 141 149 180 18320 EBU65358 G n.s. 228 228 183 183 127 141 183 18620 EBU65341 G 234 234 177 17720 EBU65359 L 197 197 228 228 177 17720 EBU65360 G 197 197 238 234 177 18320 EBU65361 E n.s. 228 228 177 17720 EBU65362 G 197 197 228 228 177 17720 EBU65363 G20 EBU65342 G 191 203 228 234 177 19120 EBU65343 G 203 203 228 228 177 17920 EBU65344 G 191 203 n.s. n.s. 161 16120 EBU65345 G 203 203 228 234 177 18720 EBU65346 n.s. n.s. n.s. 177 17720 EBU65347 L 203 203 228 228 177 17720 EBU65348 G 203 203 n.s. n.s. 185 185 123 134 183 18321 C.478064.002 Ug
![Page 12: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/12.jpg)
Table SIII Frequencies of microsatellite alleles within populations. Loci are designated by number and alleles by size in base pairs. The values in rows labelled “N” are the numbers of individuals scored for the locus in the specified population.
Population 1 2 4 5 7 9 10 13 14 15 16 17 19 20Locus Allele163859 N 22 0 4 9 16 8 0 8 0 10 2 2 12 13
176 0.056 0.042179 0.023182 0.023 0.056 0.031 0.063 0.050185 0.023 0.111 0.063 0.063 0.500188 0.094 0.050 0.042191 0.056 0.031 0.063 0.050 0.115194 0.068 0.111 0.063 0.125 0.188 0.300 0.250195 0.500197 0.159 0.125 0.222 0.156 0.313 0.100 0.250 0.083 0.308200 0.409 0.056 0.063 0.063 0.150 0.500 0.167203 0.159 0.875 0.167 0.125 0.688 0.188 0.150 0.042 0.538206 0.045 0.111 0.031 0.063 0.125 0.050209 0.056 0.125 0.050 0.250 0.208 0.038211 0.023 0.031212 0.068 0.125 0.125215 0.063 0.063 0.042217 0.050
166169 N 17 0 6 2 10 10 0 4 0 5 2 1 2 16212 0.250214 0.059 0.250224 0.529 0.167 0.500 0.150 0.625 0.500 0.500228 0.176 0.167 0.250 0.100 0.250 0.400 0.750 0.750 0.656234 0.167 0.250 0.313238 0.100 0.031248 0.333 0.450255 0.235 0.750 0.150 0.125 0.100 0.250 0.500269 0.167 0.050
![Page 13: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/13.jpg)
Population 1 2 4 5 7 9 10 13 14 15 16 17 19 20Locus Allele225107 N 19 9 7 8 17 10 7 15 5 10 1 2 12 17
159 0.026161 0.059167 0.111169 0.053171 0.053 0.071 0.265 0.208175 0.026 0.071 0.100 0.200 0.100177 0.079 0.222 0.214 0.188 0.235 0.500 0.429 0.200 0.300 0.200 0.500 0.292 0.647179 0.053 0.111 0.063 0.118 0.100 0.143 0.067 0.100 0.500 0.292 0.059181 0.132 0.111 0.071 0.063 0.029 0.050 0.133183 0.125 0.088185 0.211 0.111 0.063 0.029 0.100 0.143 0.067 0.150 0.088187 0.111 0.143 1.000 0.029189 0.125 0.029 0.100 0.050191 0.368 0.222 0.571 0.500 0.294 0.150 0.143 0.533 0.400 0.350 0.083 0.029201 0.050
714132 N 17 7 4 7 14 8 10 17 6 8 3 2 9 7160 0.071165 0.050168 0.143171 0.059 0.143 0.125 0.107 0.313 0.050 0.167 0.188 0.429173 0.118174 0.059 0.214 0.179 0.050 0.088 0.125 0.167177 0.029 0.071 0.167 0.667180 0.071 0.029 0.071183 0.529 0.429 0.625 0.786 0.500 0.375 0.650 0.735 0.417 0.563 0.167 0.500 0.722 0.286186 0.147 0.071 0.250 0.071 0.143 0.313 0.200 0.118 0.167 0.125 0.167 0.500 0.056 0.214189 0.083 0.056193 0.059201 0.029
609874 N 20 7 3 9 15 10 10 17 5 8 3 2 11 7116 0.071 0.045
![Page 14: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/14.jpg)
Population 1 2 4 5 7 9 10 13 14 15 16 17 19 20Locus Allele
119 0.033120 0.029 0.091121 0.125122 0.033 0.029 0.167 0.143123 0.075 0.071 0.056 0.033 0.050 0.100 0.029 0.500 0.188 0.071124 0.067 0.182125 0.071 0.063126 0.167 0.111 0.100 0.100 0.250 0.029 0.091127 0.143 0.067 0.045 0.214128 0.071 0.033 0.200 0.045129 0.071 0.056 0.033 0.050130 0.050 0.050 0.059131 0.050 0.167 0.050 0.100 0.167 0.045132 0.050 0.071 0.333 0.111 0.333 0.147 0.100 0.250 0.167 0.136133 0.050 0.050134 0.050 0.050 0.063 0.250 0.045 0.071135 0.167 0.050 0.029 0.167 0.250136 0.050 0.071 0.050 0.029
137 0.025 0.071 0.100 0.050 0.088 0.125138 0.300 0.071 0.222 0.033 0.100 0.088 0.167 0.045139 0.025 0.033 0.029140 0.075 0.167 0.100 0.059 0.100 0.045141 0.100 0.143 0.167 0.033 0.100 0.059 0.100 0.167 0.091 0.214142 0.029 0.063143 0.025 0.100 0.071144 0.100 0.029145 0.050 0.050146 0.033 0.050 0.050 0.045147 0.025 0.167 0.056 0.100 0.250148 0.025 0.050 0.147 0.063149 0.071
![Page 15: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/15.jpg)
Population 1 2 4 5 7 9 10 13 14 15 16 17 19 20Locus Allele
150 0.071 0.071151 0.025152 0.100 0.029 0.045 0.071155 0.029156 0.063157 0.056 0.250158 0.033 0.029161 0.025165 0.025
![Page 16: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/16.jpg)
Table SIV Alignment of sequences for microsatellite loci. Gaps are indicated by “-“ and missing data by “?”. Matching bases are signified by a dot. The COI haplotype of the individual is written at the end of each sequence (n.s. = not sequenced).
Locus 163859
10 20 30 40 50 60 ....|....|....|....|....|....|....|....|....|....|....|....|EBU59405 ACTGTCTCTTTCATTTTGTTAATGTTTGTCATCATCATCATCCATC-------------- EBU59404 ..........................................-...ATCATCATC----- EBU59467 ??????????????????????????????............-...-------------- EBU59475 ..........................................-...-------------- EBU59478 ......................?...................-...ATCAT--------- EBU59481 .......T..................................-...ATC----------- EBU59520 ..........................................-...ATCGTCATC----- EBU59524 .......T..................................-...ATC----------- EBU59552 ..........................................-...-------------- EBU59554 .......T..................................-...ATCATCATCATCAT EBU59556 ..........................................-...-------------- EBU59561 .......T..................................-...ATCATCATCATCAT EBU59563 ..........................................-...-------------- EBU59564 .......T..................................-...ATCATC-------- EBU59571 .......T..................................-...ATCATC-------- EBU59572 ..........................................-...ATCATC-------- EBU65027 .......T..................................-...ATC-----------
70 80 90 100 110 120 ....|....|....|....|....|....|....|....|....|....|....|....|EBU59405 ----AACATTTGAGTTATGCTAAAATTCTTAAATCTGAGATGTTTTATAAAACTGAGACC EBU59404 ----....................................??????????????????.. EBU59467 ----.........................AT............................. EBU59475 ----........................................................ EBU59478 -----------------------------............................... EBU59481 ----........................................................ EBU59520 ----........................................................ EBU59524 ----........................................................ EBU59552 ----........................................................ EBU59554 CATC........................................................ EBU59556 ----.......................A................................ EBU59561 C---........................................................ EBU59563 ----........................................................ EBU59564 ----........................................................ EBU59571 ----........................................................ EBU59572 ----........................................................ EBU65027 ----........................................................
130 140 150 160 170 COI Locality ....|....|....|....|....|....|....|....|....|....|...EBU59405 TGGTTTAAAAAAAGTACATATAAACTGTA?AAACAGGTTTTAAACATTTTTAC F 17EBU59404 .......................?????????????????????????????? A 17EBU59467 ..........?..................................T....... K 15EBU59475 ..................................................... H 15EBU59478 ..................................................... F 7EBU59481 ..................................................... n.s. 7EBU59520 ..................................................... H 5EBU59524 ..................................................... I 5EBU59552 ..................................................... F 19EBU59554 ...................................................C. F 19
![Page 17: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/17.jpg)
EBU59556 .............................................T....... H 19EBU59561 ...................................................C. F 19EBU59563 ..................................................... F 19EBU59564 ..................................................... F 19EBU59571 ..................................................... H 1EBU59572 ..................................................... H 1EBU65027 ..................................................... H 13
![Page 18: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/18.jpg)
Locus 225107
10 20 30 40 50 60 ....|....|....|....|....|....|....|....|....|....|....|....|EBU59517 ?CACCGGGTATTCACACACACACACACACA------GAACCAGGACAGACACAACGAACG EBU59573 ???????.......................CACACA........................ EBU59472 A............G........?------?------.......CC.G..GCAG..AC.AC EBU59515 A.............................------........................ EBU59484 A.............A.......--------------........................ EBU65361 A...........................--------...............N........ EBU65353 A...........................--------........................ EBU65326 ??????????????????....--------------........................ C.478057.003 ???????????????????????????????????????????................. EBU65323 ????????????????????????????????????........................
70 80 90 100 110 120 ....|....|....|....|....|....|....|....|....|....|....|....|EBU59517 C???????????????????ATCAGCTGGTTATTCCGAAGGTTATCATTGGTTGAATTTG EBU59573 .???????????????????........................................ EBU59472 GAACGAGGGTTAAGTTGTTG..............TT........................ EBU59515 .???????????????????........................................ EBU59484 .???????????????????........................................ EBU65361 .???????????????????........................................ EBU65353 Y???????????????????........................................ EBU65326 .???????????????????........................................ C.478057.003 .???????????????????........................................ EBU65323 .???????????????????........................................
130 140 150 160 COI Locality
....|....|....|....|....|....|....|....|...EBU59517 AAATTTTGGACAATACCAACCGCGGAGATTCCGAAAACCGCGT n.s. 5EBU59573 ............T.............................. H1 1EBU59472 ........................................... B 15EBU59515 .....?????????????????????????????????????? D 5EBU59484 ......................A......C......C....C. F 7EBU65361 ........................................... E 20EBU65353 ........................................... G 20EBU65326 ........................................... E 3C.478057.003 ............T.............................. H 9EBU65323 ............T...........??????????????????? A 3
![Page 19: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/19.jpg)
Locus 609874
10 20 30 40 50 60 ....|....|....|....|....|....|....|....|....|....|....|....|C.478057.002 GGTGTGTGTGTGTGAGGGTGTGTGTGTGTGTGTGTGGAGGGAAGGGGGCAGATGTAAAAC EBU59465 ..............T.T.............------.........--............. EBU59467 ..............T.T............A...............--............. EBU59468 ..............--------....----------........................ EBU59485 ..............--------........------.........A.............. EBU59516 ..............--------........------.........A.............. EBU59587 ..............--------.............A.C...................... EBU65326 ..............--------.............A.C...................... EBU65391 ..............--------......--------........................
70 80 90 100 COI Locality ....|....|....|....|....|....|....|....|.C.478057.002 -TTTTTTTTGGTTTTTTGTTGT---TGCAATCTTTGAGATA I 9EBU59465 --.....?????????????????????????????????? H 15EBU59467 --......G.........??????????????????????? J 15EBU59468 -.........T...........TGT.....A.......... B 15EBU59485 C.....................TGT.....A.......... F 7EBU59516 -.....................TGT.....A.......... H 5EBU59587 T.........?...........TGT....CA.......... H 1EBU65326 T........T............TGT.....A.......... E 3EBU65391 C.........T...........TGT.....A.......... H 10
![Page 20: s3-eu-west-1.amazonaws.com · Web viewSupplemental Material. Microsatellite . Methods. Next generation Illumina de novo shotgun sequencing using the HiSeq platform was performed](https://reader038.vdocument.in/reader038/viewer/2022100905/5ad5b8197f8b9a48398dea86/html5/thumbnails/20.jpg)
Locus 714132 10 20 30 40 50 60 ....|....|....|....|....|....|....|....|....|....|....|....|EBU59439 TAAGAAAAAAGTTAACGCCGCCGCCG---------------CCGGTAAAGCCATACCTAT EBU59416 ...C......................------------CCGT.................. EBU59443 ...C......................---------TCGCCG................... EBU59465 ...C......................---TCGCCCRCGCCG................... EBU59468 ...C......................------------CCGT.................. EBU59577 ...C......................---TCGCCACCGCCG................... EBU59589 ...C...........T..T...A...------------------................ EBU65388 ...C......................CCGCCGCCGCCGCCG................... EBU65391 ...C......................---TCGCCGCCGCCG................... C.478057.002 ...C......................---------------................... C.478057.004 ??????????????????........------------------................ C.478057.009 ...C......................CCGTCGCCGCCGCCG...................
70 80 90 100 110 120 ....|....|....|....|....|....|....|....|....|....|....|....|EBU59439 GTCTCGCTATGCTTCGCAGGCGAGACAAAAA-----CAGAGTATTCTGACAACCTGCTTA EBU59416 ...............................-----...........ATT.C.TCT.... EBU59443 ...............................-----........................ EBU59465 ...............................-----........................ EBU59468 ...............................-----.......????????????????? EBU59577 .....................R.........-----........................ EBU59589 ...CT...C......................ATAAC.T.T......CAT......A.... EBU65388 ...............................-----........................ EBU65391 ...............................-----......................?? C.478057.002 ...............................-----........................ C.478057.004 ...............................-----........................ C.478057.009 ..........................??????????????????????????????????
130 140 150 COI Locality ....|....|....|....|....|....|.EBU59439 ATTTACC-TCTTTTTCTAGTCCCAGAGTGTG H 14EBU59416 C??.?????A??G?????????????????? H 13EBU59443 .......-....................... H 14EBU59465 .......-....................... H 15EBU59468 ??????????????????????????????? B 15EBU59577 .......-....................... H 1EBU59589 ..C.GA.G.........G....A.....A.. H 1EBU65388 .......-....................... J 1EBU65391 ??????????????????????????????? H 10C.478057.002 .......-....................... I 9C.478057.004 ...CC..-...................???? I 9C.478057.009 ??????????????????????????????? n.s. 9