THE JOURNAL. OF BIOLOGICAL CHEM~~Y Vol. 251, No. 7, Issue of April 10, pp. 1902-1912. 1976

Printed in U.S.A.

Site-specific Interaction of Qp Host Factor and Ribosomal Protein Sl with Q@ and R17 Bacteriophage RNAs*

(Received for publication, July 21, 1975)

ALLEN W. SENEAR$ AND JOAN ARGETSINGER STEITZ

From the Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, Connecticut 06.510

We have studied the interaction of the host factor (HF) required for bacteriophage Q@ RNA replication and of ribosomal protein Sl, a subunit of Qj3 replicase, with QB and R17 RNA. Both proteins bind to both Q/3 and R17 RNA; HF has a higher affinity than Sl for these phage RNAs. HF binds to a single site in R17 RNA located in the replicase cistron, and to two sites of QP RNA, one of which is located approximately 60 nucleotides from the 3’ end of Qp RNA. The three HF binding sites all have portions rich in adenylate residues; all are bound by HF when contained in oligonucleotides which are predicted to exist only in single-stranded form. Sl selects a single site in Q@ RNA, also near the 3’ end, but binds to a large number of sites in R17 RNA. These results suggest that HF and possibly Sl, through their interaction with the

3’-terminal region of Q/3 RNA, are directly involved in the recognition of the 3’ end of Q/3 RNA by Q@ replicase.

Under conditions where specific protein.Rl7 RNA complexes are formed, we have also tested host factor and Sl for cistron-specific interference with ribosome binding to R17 RNA. Although Sl and HF lower the efficiency of initiation complex formation as described previously, we detect no discrimination against any particular cistron. We therefore conclude that translational interference exhibited by the two proteins probably reflects simply their high affinity for RNA and certain defined polynucleotides.

Bacteriophage Q@ RNA is replicated by a complex of phage- and host-coded proteins. The system has been intensively

investigated as a model for both specificity in protein-nucleic acid interactions and the redirection of host cell machinery by an infecting virus (for a review, see Ref. 1).

Purified Qp replicase itself contains four subunits (2,3). One is phage-coded; the other three are host proteins identified as 30 S ribosomal protein Sl (4, 5) and protein synthesis elongation factors EF-Tu and EF-Ts (6). Although Q/3 repli- case can synthesize poly(G) in the presence of poly(C) tem- plate or QP plus strand RNA from Qp minus strand RNA, alone it cannot produce progeny plus strands starting with a plus strand template.

Synthesis of QP minus strand RNA, and thus the complete replication reaction, was shown by Franze de Fernandez et al. (7, 8) to require an additional Escherichia coli protein they called Host Factor I. (A requirement for a second host factor, HFII,’ has since been shown to be due to an inhibitor present in certain Q@ RNA preparations (9).) HF appears to be required (10) for a step at or prior to initiation of minus strand synthesis. Anti-HF blocks Q@ RNA-directed synthesis if the antibody is added to the reaction before initiation, but has no effect on the rate of elongation (11). Silverman (12) found that

*This work was supported by Grant AI10243 from the National Institutes of Health.

$ National Science Foundation predoctoral fellow. ‘The abbreviation used is : HF, host factor.

the formation of a tight complex between Q@ replicase and Qa RNA requires HF and GTP; addition of Mg*+ allows this complex to initiate synthesis. HF is a hexamer of identical subunits each having a molecular weight of about 12,000 (10). One hexamer is required per template RNA molecule for maximal synthesis. HF binds tightly to a variety of single- stranded RNAs (10). Although several hundred HF hexamers are present in an E. coli cell, its function in the uninfected host

is unknown (11). Sl, the largest subunit of Q/3 replicase itself, has also been

shown to interact strongly with RNA. Sl is the protein originally described by Groner et al. (13, 14) as protein synthesis “interference factor.” Under at least some conditions in vitro it inhibits translation both of natural mRNAs (includ-

ing RNA phage genomes) and of poly(U) and other synthetic polyribonucleotides rich in uridylate residues (13, 15-18). How- ever, Sl, which is present in the cell in amounts approximately equimolar to ribosomes (5, 19), also appears to be required for

normal functioning of the translational machinery (19-23). Since recent work (20, 21) suggests that all the above interfer- ence effects of Sl are observed only when the protein is added in excess beyond the amount required to saturate the ribosome, the significance of in uitro observations on its interference ac- tivity is not clear.

The role of Sl in Q/3 replication, like that of HF, is likely to be in recognition of the plus strand template. Q@ replicase lacking Sl is almost as active as holoenzyme on poly(C) and Qp minus strand templates, but has little or no activity on Qp plus

1902

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Binding of Host Factor and Sl to QP and RI 7 RNA 1903

strand RNA (24). Moreover, on synthetic RNA templates the phage-coded subunit alone is sufficient for the elongation phase of the reaction (25, 26). Sl is also required for the translational repression activity of Qp replicase (27) which has been traced to the ability of the enzyme to bind to Qfl RNA at a site overlapping the initiator region of the coat protein cistron (28).

Initial studies of f2 replicase (f2, like R17, is a group I RNA phage, whereas Qp is a group III phage (29)) by Fedoroff and Zinder (30) have shown that this enzyme has a similar subunit structure to QP replicase; it contains the same host subunits, Sl, EF-Tu, and EF-Ts. However, the phage-coded subunits of the two enzymes are different, and this apparently is sufficient to alter radically the template specificities of the two enzymes. Like the QP enzyme, f2 replicase also has a requirement for an additional host factor, here for activity on both plus and minus strand RNA (31). However, it is not clear whether this protein is HF.

To further characterize the role of HF and Sl in RNA bacteriophage replication and in host cell metabolism, we have studied in detail the interaction of these proteins with Qp and R17 RNA. We find that HF binds very strongly and specifically to two sites in Q/3 RNA (one near the 3’ end) and to one site in R17 RNA (located in the replicase cistron). Sl also interacts with both RNAs; however, it binds specifically at only one site in Q/3 RNA, also near the 3’ end, while exhibiting nearly random binding to R17 RNA. Under these conditions, neither protein produces significant cistron-specific effects on forma- tion of R17 RNA-directed protein synthesis initiation com- plexes.

EXPERIMENTAL PROCEDURE

Materials

Reagents-Acrylamide, N,N’-methylenebisacrylamide, and N,N,- N’,N’-tetramethylenediamine were purchased from Kodak and l- cyclohexyl-3-(Z-morpholinoethyl)carbodiimide method-p-toluene sul- fonate from SchwarzMann. RNase T, was from Calbiochem and pancreatic RNase, venom phosphodiesterase, and spleen phosphodies- terase were from Worthington. A more highly purified preparation of spleen phosphodiesterase was the kind gift of E. Niles. RNase U, was the gift of Sankyo Co. Ltd., Tokyo. DE81 and No. 3MM papers were from Whatman, PEI-cellulose plates from Machery-Nagel, and cellu- lose acetate strips from Schleicher and Schuell.

Filters-Nitrocellulose filters were Millipore (HAWP 02400) and Scheicher and Schuell (B6). HF.RNA complexes bind to Schleicher and Schuell filters with higher efficiency than to Millipore filters; conversely, Sl.RNA complexes bind more efficiently to Millipore filters.

Buffers-Buffer A is 80 mM Tris-HCl, pH 7.5/100 rnM KCl/lO rnM MgClJl mM EDTA. Buffer B is 100 mM Tris-HCl, pH 7.5/100 mM KCl/O.l mM EDTA.

Proteins-HF was the kind gift of G. Carmichael, Harvard Univer- sity (11). Sl was the gift of A. Wahba, Sherbrooke University (15), and P. B. Moore, Yale University (32), for preliminary experiments, and later from G. Carmichael (33).

Viral Growth and RNA Preparations

Q@ and R17 were grown on Escherichia coli M27 (a Q&specific strain) and S26, respectively, in PGM (34) to a concentration of 2 x 10’ cells/ml. Carrier-free 32P0, from New England Nuclear was added at the time of infection (multiplicity of infection = 5 to 10) at approxi- mately 0.1 mCi/ml. The virus particles were purified and RNA extracted as described by Steitz (34).

Quantitatioe Binding Experiments

3zP-Labeled RNA was incubated with HF or Sl in 100 pl of either Buffer A or Buffer B for 10 min at 37”. The sample was then poured through a nitrocellulose filter (Millipore for Sl, Schleicher and Schuell for HF) under rapid filtration (10 s/ml), and the filters were washed

with 2.5 ml of ice-cold buffer, dried, and counted. To examine the lifetime of protein.RNA complexes, after complex formation at 37”. a 20.fold excess of unlabeled viral RNA was added and samples were further incubated for times indicated at either 4’ or 25” before filtering.

Protection Experiments

In a typical experiment, 10 to 106 ng of 32P-labeled RNA was incubated with HF at a HF:RNA molar ratio of 3 to 4:l (2 pg HF/lO Kg RNA) or Sl at a molar ratio of 5 to 1O:l (4 to 7 ng Sl/lO rg RNA) in 200 to 500 ~1 of Buffer A or B for 10 min at 37”. Then a 20-fold excess of unlabeled viral RNA and either RNase T, or pancreatic RNase were added. Incubation was continued at 25” for 15 min in experiments with HF, or for 8 to 10 min in experiments with Sl. The reaction mix- ture was poured through a nitrocellulose filter and washed with 4 ml of the binding buffer. RNA was recovered by blending on a Vortex mixer the filter in a mixture containing 2 ml of phenol and 2 ml of extrac- tion buffer (28). The phases were separated and the phenol phase (in- cluding the filter) was re-extracted with 1.5 ml of extraction buffer. The RNA fragments were collected from the combined aqueous phases by ethanol precipitation.

When the JzP-labeled phage RNA was to be digested with RNase before binding by HF or Sl, 10 to 100 ng of 3ZP-labeled RNA in 100 to 200 yl of Buffer A or B was first incubated for 30 min at 37” with T, or pancreatic RNase at a 2O:l weight ratio. HF or Sl was then added in the usual amounts and incubation continued for 5 min at 37”. The samples were filtered and bound fragments extracted as above. If an incomplete RNase T, digest was desired, the amount of nuclease and time of incubation were decreased as indicated below.

Polyacrylamide Gel Electrophoresis

HF- and Sl -bound RNA fragments were analyzed by electrophoresis in 12% polyacrylamide slab gels as described by DeWachter and Fiers (35). Gels of either 14 cm or (for better resolution, especially of larger fragments) 40 x 15 x 0.15 cm were used. Gels of 14 cm were run at 100 to 140 volts for approximately 4 to 6 hours and 40 cm gels at 250 to 306 volts overnight. In either case the bromphenol blue marker was run about two-thirds of the length of the gel since some of the smaller RNA fragments migrate faster than the dye. Some gels were dried before autoradiography (36); wet gels were wrapped in Saran Wrap and directly exposed to film. The desired regions were excised from wet gels and the RNA eluted either electrophoretically (37) or by extruding the gel slice through a syringe into a high salt buffer and blending on a Vortex mixer intermittently for several hours as described by Guthrie et al. (38). For the larger RNA fragments the two methods give comparable yields; for the smaller bands the second method is preferable.

RNA Sequence Analysis

Standard Sanger techniques, as described by Barrel1 (39), were used. Special details are noted where appropriate.

Cistron-specific Interference Experiments

R17 RNA-directed protein synthesis initiation complexes were formed in reaction mixtures (either 30 or 50 ~1) containing: 0.1 M Tris-HCl, pH 7.4, 0.05 M NH&l, 5 mM magnesium acetate, 5 mM @-mercaptoethanol, 0.2 rnM GTP, 20 A 1eo units/ml of charged formyl- ated mixed E. coli tRNA (34), 100 A,,, units/ml of low salt ribo- somes from MREGOO (40), 12 to 15 A,,, units/ml of J2P-labeled RI7 RNA (1 to 5 x 10’ cpm/pg), and HF or Sl as indicated. Molar ratios of protein to RNA were calculated assuming molecular weights of 72,006 for HF (11) and 65,000 (5) for Sl; ribosomes were at a 3- to 4-fold molar excess over RNA. After incubation for 8 min at 38”, complexes were trimmed with pancreatic ribonuclease, and fractionated on 5-ml sucrose gradients as previously described (34, 40, 41). Aliquots (2 ~1) from each 21&d fraction were then counted in Bray’s solution, and the five fractions representing the 70 S peak were pooled. Samples were T,-fingerprinted and the ratio of the three ‘R17 sites present in the 3T-labeled RNA analyzed as previously described (40, 41). All oligonu- cleotides indicated in Fig. 2 of Ref. 40 were routinely counted, even though ratios were calculated from the counts per min per szPO, observed in the initiator AUG-containing spots: ACCUAUG for the A site, CAUG for the coat site, and AUUACCCAUG for the replicase site.

To test for nuclease contamination of protein preparations, R17 RNA was preincubated with Sl or HF alone in the same buffer and under the same conditions as described for initiation reactions above.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1904 Binding of Host Factor and Sl to Q/3 and RI 7 RNA

The RNA was then phenol-extracted, precipitated twice with 2.5 volumes of ethanol, and introduced as template into an initiation reaction mixture not containing Sl or HF.

Because message and Sl-deficient ribosomes appear to compete for Sl binding (16, 20, 22, 42, 43). we checked our ribosome prepara- tions for Sl content using the gel system described by Dahlberg (42). At least 70% of the ribosomes appeared to contain Sl (results not shown); therefore we assume that exogenously added protein will remain largely available for interaction with the mRNA.

RESULTS

HF Interacts Strongly with RI 7 and QP RNA-HF binds Q@ RNA to nitrocellulose filters (Fig. 1A). At HF (hexamer): RNA molar ratios of less than 1, the amount of RNA bound to the filter is proportional to the amount of HF. A plateau is reached at molar ratios of 1 to 2. This same ratio of HF to RNA gave maximal synthetic activity in a QB RNA-directed Q/3 replicase assay’ as originally observed by Franze de Fernandez et al. (10). Comparable binding experiments with R17 RNA (not shown) likewise indicate that about one HF hexamer is required for quantitative retention of this RNA molecule on nitrocellulose filters.

The HF.Qj3 RNA complex is very stable. At O”, in the presence of competing unlabeled phage RNA, the complexes remaining after a rapid initial decay appear to be stable indefinitely (Fig. 1B). At 25” the complexes decay slowly (Fig. 1B). Experiments with HF and R17 RNA (not shown) indicate comparable stabilities for this protein.RNA complex.

HF Binds to One Site in R17 RNA-To investigate the specificity of’ HF binding, complexes formed at a HF:R17 RNA

ratio of 1 to 3 were digested with RNase T, and the HF-bound fragments collected on nitrocellulose filters. Polyacrylamide gel electrophoresis (Fig. 2a) reveals that two small oligonucleo- tides comprise the major fraction of the bound RNA. In addition, a complex pattern of larger RNA fragments appears in much lower yields.

The smallest product, Band I of Fig. 2a, was identified as one of the large T, oligonucleotides of R17 previously analyzed by Jeppesen (Table 3g of Ref. 44). It remains intact upon further RNase T, digestion and yields the predicted products after treatment with pancreatic RNase (Table I). Two cleavages resulting from overdigestion with RNase T1 provided an unambiguous ordering of the pancreatic RNase products, giving the sequence AAUAAUAAAAUAG (Table I).

Upon RNase T, digestion, Band II (Fig. 2a) was found t,o contain the Band I oligonucleotide plus AAG. The loss of 1 mol of AAU and the appearance of AAGAAU after treatment with pancreatic RNase places the AAG at the 5’ end of Band II. The sequence of Band II is thus AAGAAUAAUAAAAUAG (Table I).

The relative yields of the Band I and II oligonucleotides vary from one experiment to the next, but the combined yield is relatively constant at 35 to 50%. As might be expected, higher HF:R17 RNA ratios and milder digestion conditions give relatively more of the larger Band II. The sequence from which Bands I and II are derived has been located in the replicase cistron of R17 RNA.$

Some of the more slowly migrating RNAs in the gel of I-IF-protected material contain the Band I sequence. Others are a nearly random mixture of fragments from other parts of the R17 RNA molecule. No clean and simple RNase T, fingerprints of these bands have been obtained. The only prominent spot in

2 G. Carmichael, personal communication. 3 W. Fiers, personal communication.

I I ,

8 A’

t 0 0. I 0.2 0.3 0.4 0.5 b - ~9 HF

, -

; 1 I

0”

4, B I -

3-

2 0°C - h h

P

0' I I 1 I 0 5 IO 15 20

Decay time (min) FIG. 1. Formation and stability of complexes between HF and QB

RNA. A, 0.66 pg of Q/3 Is*P] RNA (1.7 x 10’ cpm/pg) was incubated with increasing amounts of HF in 100 pl of Buffer A and filtered as described under “Experimental Procedure.” B, 0.33 pg of Qfi Is*P] RNA (1.7 x lo5 cpm/pg) and 0.1 pg of HF were incubated in 100 ~1 of Buffer A for 10 min at 37”, 5 rg of unlabeled Q@ RNA was added, and incubation was continued for various times at 25” (A) or 0” (A) before filtering. 0 indicates counts per min retained when no competing RNA was added.

a RNase T, fingerprint of the total bound material is that cor- responding to Band I. Increasing the HF:RNA molar ratio be- yond 1 to 2 results in the binding of more of the larger, ap- parently nonspecific fragments (Fig. 2 c and d).

We have also digested the HF-R17 RNA complex with pancreatic RNase. Several small RNA fragments are bound to filters (Fig. 2b). These products are all found to overlap the Band I sequence in the Rl7 RNA molecule (Table I).

Requirements for HF. RI 7 RNA Binding-To ask whether all of the information required for the specific interaction of HF with RI7 RNA is contained within the Band I oligonucleotide, the phage RNA was digested to completion with RNase T, before HF was added to the binding mixture. In this experi- ment, only Band I, in a yield of about 50%, was retained by HF on a nitrocellulose filter (not shown). HF does not bind any oligonucleotides generated by complete digestion of R17 RNA with pancreatic RNase.

To investigate possible Mg’+ requirements for HF binding, results from experiments using Buffer A, containing 10 mM Mg*+, and Buffer B, containing no Mg’+, were compared. When HF is bound to R17 RNA that has previously been digested to completion with RNase T,, Mg*+ has no effect on the interaction; in either buffer only Band I is bound to filters

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Binding of Host Factor and Sl to Q8 and RI 7 RNA

HF: R 17 Mcj2+ 2 IO + -

1905

(not shown). Thus Mg*+ does not directly affect the interaction of HF with the R17 Band I fragment. However, when HF*R17 complexes are digested with RNase T1 in the presence of Mg*+, there is a marked increase in both the Band II:Band I ratio and in the yield of larger fragments relative to those obtained in the absence of Mg*+ (Fig. 2, e and fi.

T, Pant

BPB-

BondII-

Bond I -

-Band II -Band I

Band Band

cd ef

FIG. 2. Specific binding of HF to R17 RNA. a, b, 50 fig of R17 RNA (1.8 x lo* cpm/pg) and 12 pg of HF were incubated for 5 min in 200 pl of Buffer B at 37”. 400 sg of cold R17 RNA, and 5 pg of RNase T, (a) or 3 pg of pancreatic (Pant) RNase (b) were added and the samples were incubated for 15 min at 25” before filtering. c, d, 3.5 pg (c) or 17.5 jtg (d) of HF and 24 pg of RI7 [“‘PI RNA (5 x 10’ cpm/pg) were incubated in 206 ~1 of Buffer A for 5 min at 37”, 200 ccg of cold R17 RNA, and 5 pg of RNase T, were added, and incubation was continued for 16 min at 25” before filtering. e, f, 8 fig of R17 [“T] RNA (5 x 106cpm/pg) and 0.7 pg of HF were incubated in 500 ~1 of Buffer A (e) or Buffer B (fj for 5 min at 37”, 240 pg of cold R17 RNA and 10 pg of RNase T1 were added, and incubation was continued for 15 min at 25” before filtering. BPB indicated the position of the bromphenol blue dye marker.

TABLE I Sequence analysis of HF. RI 7 oligonucleotides

HF Binds to Two Sites in Q@ RNA-HF also interacts very specifically with Q/3 RNA, binding to two sites, one very near the 3’ end. Polyacrylamide gel analysis of the fragments obtained by digesting HFoQj3 RNA complexes with RNase T, gives a pattern containing two prominent small oligonucleo- tides (in 10 to 50% molar yields) and a mixture of larger frag- ments (Fig. 3, a and 5). When HF is bound to Q/3 RNA which has been digested to completion with RNase T,, only the two small bands, each in 50 to 75% yields, are obtained (Fig. 3, c and d).

Analysis (Table II) of Q/3 Band I shows its sequence to be ACCAAUACUAAAAAG. The products of pancreatic RNase digestion of Band I after carbodiimide modification locate the 2 uridylic acid residues and provide the partial sequence (AC, C, AAUAC)UAAAAAG. RNase U, yields CUA and CUAA (plus other products), implying that the UAAAAAG is preceded by an AC rather than CC, giving either (AC, C)AAUA- CUAAAAAG or (AAUAC,C)ACUAAAAAG. Partial spleen phosphodiesterase products 10 and 11 place AAU directly before ACUAAAAAG, giving (C,AC)AAUACUAAAAAG. RNase US analyses also yielded both CA and CCA, in varying relative yields, leaving the 5’-terminal sequence ambiguous. However, a sample of this oligonucleotide kindly provided by M. A. Billeter and C. Weissman, both of Universitit Zurich, yielded almost exclusively (90%) CCA. ’ Thus, we conclude that the sequence of Band I is ACCAAUACUAAAAAG. Billeter and Weissman” have independently obtained this sequence for this oligonucleotide using nearest neighbor analysis of in vitro syn- thesized Q/3 RNA. The other partial spleen phosphodiesterase products and products released from Band I by partial diges- tion with pancreatic RNase are also consistent with this se- quence. This oligonucleotide is located in the Q/l replicase cis- tron, several hundred residues from the 3’ ends of the RNA.

Analysis of Q/3 Band II (Fig. 3) by alkali and pancreatic RNase digestion (Table III), as well as ita inclusion in the Band III fragment (below) identifies it as a very large T, oligonucleo- tide with the sequence AAUAAAUUAUCACAAUUACUCU- UACG. This oligonucleotide is located near the 3’ end of the Q@ RNA molecule at residues -63 to -38 (Fig. 4, Ref. 45). A third fragment, Band III, is obtained when HF is bound to an incomplete RNase Tr digest of Q@ RNA (Fig. 3e). Band III contains Band II and extends to the 3’ end of Q@ RNA, with one TI oligonucleotide missing (Table IV). The two noncovalently linked sections presumably are held together by hydrogen bonding (Fig. 4).

Larger fragments are also seen on gel analysis of the products of RNase T1 digestion of HF.Qfl complexes (Fig. 3, a and b). However, due to low yields and poor resolution, it has not been possible to obtain detailed information about any of these fragments. Nonetheless, T, fingerprints of material eluted from these higher molecular weight regions usually contain either the Band I or Band II oligonucleotide or both, and often the 3’-terminal oligonucleotide of Q@ RNA (CCCUCUCUCCU-

‘Presumably CA was generated from CGA by an exonucleolytic activity known to be a contaminant of our RNase U,.

5 M. A. Billeter and C. Weissmann, personal communication.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1906 Binding of Host Factor and Sl to Q/3 and RI 7 RNA

a b c d e FIG. 3. Specific binding of HF to Q/3 RNA. a, b, 100 pg of ($3 [“*PI

RNA (9 x 10’ cpm/Ng) and 30 clg of HF were incubated in 500 ~1 of Buffer A (a) or Buffer B (b) for 5 min at 37”. Cold R17 RNA (1.2 mg) and 20 ag of RNase T, were added and incubation was continued for 15 min at 25” before filtering. c, d, 50 fig of Qj3 [“‘PI RNA (9 x 10’ cpm/pg) and 5 pg of RNase T, were incubated for 35 min at 37” in 250 nl of Buffer A (c) or Buffer B (d), 30~8 of HF was added and incubation was continued for 5 min before filtering. e, 60 pg of QB [“‘PI RNA (4 x 10’ cpm/pg) and 3 pg of RNase T, were incubated in 300 ~1 of Buffer B for 20 min at 37”, 15 ag of HF was added, and incubation was continued for 5 min at 37’ before filtering. BPS indicates the position of the bromphenol blue dye marker.

CCCA,,). Thus this region of the gel contains RNA segments which include Band I or Band II as well as unrelated oligo- nucleotides representing either m$uch weaker secondary HF binding sites or fragments generated by nonspecific HF bind- ing.

Digestion of HF*QB RNA complexes with pancreatic RNase yields a single protected RNA fragment approximately 40 nucleotides long (not shown). This oligonucleotide is obtained in low yield (no more than 5%); thus we have not been able to identify it further. No products generated by complete pan- creatic RNase digestion of Q@ RNA are bound by HF.

Mgp+ Modulates HF. Q@ RNA Complex Formation--Mg2+ has a greater effect on the interaction of HF with QB RNA than with R17 RNA. The binding of HF to Q/3 RNA which has been previously digested to completion by RNase T, is the same in

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Binding of Host Factor and Sl to Q@ and RI 7 RNA 1907

TABLE III

Sequence analysis of HF. Q/3 Band II

Molar yields” Digestion products

Experimental Theoretical

Alkaline hydrolysis UP 9.3 9

CP 4.1 5

AP 10.5 11 GP 1.0 1

Pancreatic RNase AAAU 0.9 1

AAU 1.8 2 AU 1.1 1 AC 3.1 3

G 1.0 1 C 2.1 2 U 4.8 5

Partial pancreatic RNase producW

Composition Sequence

U,AU,AAU,AAAU AAAUAAUUAU AAU,AAAU AAAUAAU

C,AC,AU AUCAC U,AC,AAU AAUUAC or ACAAUU U,,C,GAC UCUUACG

U,,G,AC UUACG

“Molar yields (average of three experiments) were determined by direct scintillation counting.

b These products were obtained by digestion of the Band II oligonu- cleotide with RNase T, that was contaminated with a small amount of pancreatic RNase. Products were separated by two-dimensional elec- tmphoresis and analyzed by complete digestion with pancreatic RNase. The sequences shown were not determined directly but are contained in the Band II oligonucleotide sequence (45). No products were obtained in this experiment which could not have been generated from the Band II sequence.

Buffer A and Buffer B; in both cases Band I and II are obtained in high yields (50%) (Fig. 3, c and d). However, MgZ+ does affect the products generated by RNase T, digestion of HF.Q/3 RNA complexes. First, HF.Q/3 RNA complexes formed and digested in the presence of Mg*+ (Buffer A) yield more Band II than Band I (Fig. 3a), while those formed without MgZ+ yield much more Band I than Band II (Fig. 3b). Second, in the presence of Mg’+, both the overall yield of the larger fragments and the general background in the gel (perhaps due to nonsequence-specific binding) are increased. Finally, the frag- ment obtained from pancreatic RNase digestion of HF*Qo complexes is generated only in the absence of Mg2+ (Buffer B).

Sl Binds RI 7 and Q(I RNA to Nitrocellulose Filters-We have investigated the interaction of Sl with R17 and Q@ RNA using the same techniques as described above for HF. In each case, several molecules of Sl are required to bind 1 phage RNA molecule to a Millipore filter (Fig. 5) as was reported earlier (15). (In contrast to the results with HF, Sl .RNA complexes are bound more efficiently to Millipore HAWP filters than to Schleicher & Schuell B6 filters.) Saturation is not reached even at Sl:Q/3 RNA molar ratios of 15:l (Fig. 5A). Sl binding appears independent of Mg’+; in fact, Sl binds significantly more RNA (about 4-fold) to filters in Buffer B (no Mg*+) than in Buffer A (10 mM Mg*+) (Table V). Sl also binds more Qj3 RNA at 0” than it does at 37” (Table V).

The Sl.Qj3 RNA complex is much less stable than the HF.Qj3 complex. At 25”, at least 90% of the RNA initially bound in the absence of Mg ‘+ is released within 1 min of the addition of competing unlabeled RNA (Fig. 5B). Only a small amount of complex can be detected at later times. At 0”, the amount of complex detectable at both zero time and later is much higher than at 25”; a significant fraction of the initial complex decays slowly (Fig. 5B). Similar stabilities are found for Sl.Rl7 RNA complexes.

Thus Sl binds both R17 and Qp RNA, but the binding is of

TABLE IV

Sequence analysis of HF. QP Band III Sequence of the 63 3’-terminal residues of Q@ RNA (45): AAUAAAUUAUCACAAUUACUCUUACGAGUGAGAGGGGGAUCUGCUUUG

CCCUCUCUCCUCCCA,,,. Band III is this oligonucleotide with the CUUUG missing.

Product Composition Sequence Molar yields”

Experimental Theoretical

RNase T,

1 GU,,WU, Band I 1.1 1 AC,.S,AAU,,AAAU

2 u-*O,C-.Ao”* CCCUCUCUCCUCCCA,, 1.1 1 3 U,C,G,AU AUCUG 1.0 1 4 U,G UG 0.9 1 5 AG AG 3.0 3 6 G G 3.7 4

Pancreatic RNase 1 Gs.,,AG,U GAGAGGGGGAU 0.5 1 2 G,AG,U GAGU 1.2 1 3 AAAU AAAU 1.0 1 4 AAU AAU 2.1 2 5 AU AU 1.0 1 6 AC AC 3.8 3 7 G G 0.6 1 8 C C 10.9 13 9 U U 9.6 10

“The yields of the primary products were determined by direct scintillation counting of the spots from the paper fingerprint. Yields of secondary analysis products were estimated from autoradiograms.

b The bH was determined by digestion with venom phosphodiesterase.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1908

-1.6 kcal

Binding of Host Factor and Sl to Qfi and RI7 RNA

-6.0 kca I

Au ‘A UCACAA

A II III II Ill II I AGUGUU

I.SOI~U A 1

GnC CZG G=C G=C

U A

AUA (SO)

-18.2 kcal

FIG. 4. Possible secondary structure at the 3’-terminal region of Qfl RNA (45). AG values for formation of the hairpin loops were calculated according to the rules of Tinoco et al. (46). A similar structure has been proposed by Flavell et al. (47). Qfl Band II extends from residues -63 to -38. Band III extends from residue -63 to the 3’ end, with residues -16 to -20 missing.

much lower affinity and is much less stable than the binding of HF to Q/3 and R17 RNA.

Sl Recognizes One Site in Qp RNA--To investigate the specificity of Sl interaction with R17 and Q/3 RNA, we have modified the approach used for HF somewhat. Since Sl does not appear to interact as strongly as HF with viral RNAs (see Fig. 5), binding experiments were generally performed at high Sl:RNA molar ratios (5 to 10). Also Sl .RNA complexes were

exposed to RNase digestion for shorter times. Nonetheless, yields of protected RNA fragments were reduced severalfold.

Sl exhibits a specific interaction with Q/3 RNA. When a Sl.Q@ RNA complex formed in Buffer B at 37” is digested with RNase T,, several discrete fragments are generated (Fig. 6a). These oligonucleotides co-migrate on polyacrylamide gel elec- trophoresis with several of the HF-protected fragments, the smallest with HF.QB Band II (Fig. 6b). Analysis of the smallest band by pancreatic RNase digestion shows that it is identical with the HF-bound Band II of Q@ RNA. The larger fragments seen in Fig. 6a may represent longer sequences including this region, but these have not been obtained in high enough yields for further analysis. Comparable results but 2- to 3-fold lower yields were obtained in the presence of Mg’+.

When Sl is mixed with a total RNase T, digest of Q@ RNA in Buffer B at 37”, only Band II is bound (not shown), indicating that Band II contains all the information required for the specific binding of Sl to Qj3 RNA. The yield of Band II both from this type of experiment and from RNase T, digestion of Sl .Q/3 RNA complexes is generally about 5 to 10%. Sl has never been observed to bind the HF. Q/? Band I sequence in either type of experiment; thus the binding of Band II cannot be due to contamination by HF.

As might be predicted for a protein which interacts with pyrimidine-rich regions (15, 16, 22, 23, 33), Sl does not bind to any oligonucleotides generated by complete digestion of Q/3 RNA by pancreatic RNase. No regions of Q/3 RNA are protected from pancreatic RNase by Sl (not shown).

Sl Binds R17 RNA Nonspecifically-Although Sl binds R17 RNA to nitrocellulose filters with an affinity similar to that for Q@ RNA (Fig. 5A), the interaction appears nonspecific. Poly- acrylamide gel analysis of R17 RNA fragments bound and protected from RNase T, by Sl reveals a larger number of bands in the size range of 40 to 100 nucleotides. These are

-0 I 2 3 4 i> - /.LLB Sl x I I I I 1 E 40 B

0”

30

20 L

IO

0 0 15 30 45 60

Time (min) FIG. 5. Formation and stability of complexes between Sl and Q,3

and R17 RNAs. A, 2.5 pg (145,ooO cpm) of R17 [“‘PI RNA (0) or 6.25 Kg (373,060 cpm) of Qfl [“‘PI RNA (0) were incubated with increasing amounts of Sl in 100 ~1 of Buffer A. B, 3.1 Kg (80,000 cpm) of Qj3 [“‘PI RNA and 4 (A) or 5 (A) pg of Sl in 100 ~1 of Buffer B were incubated for 10 min at 37”. 100 ag of cold Q@ RNA was added, and incubation was continued for times indicated of 0” (A) or 25” (A). (No cold Qfi RNA is added to the zero times samples.)

TABLE V

Effect of temperature and Mg” on binding of SI to viral RNA For Experiment 1, 4 pg of Sl and 2.5 rg (145,000 cpm) of R17

[‘T]RNA or 6.25 pg (373,000 cpm) of Q@ [‘*P]RNA were incubated in 100 al of Buffer A (+Mg*+) or Buffer B (-MgZ+) for 10 min at 37” before filtering. For Experiment 2, 5 c(g of Sl and 3.1 pg of Q@ [S’P]RNA (180,000 cpm) were incubated in 100 ~1 of Buffer B for 10 min at 37” or 0” before filtering.

RNA Mg2+ Temperature Total corn Cpm bound

Experiment 1 R17 + 37 145,000 4,264 R17 - 37 145,000 17,805 :; + - 37 37 373,000 373,000 18,383 4,928

Experiment 2 37 180,000 49,546

- 0 180,000 86,989

superimposed on a high background, and few smaller frag- ments are seen (Fig. 6~). This pattern is similar to that generated by protection of R17 RNA with excess (5-fold molar ratio) HF (Fig. 6d), except that HF Band I and II are not prominent components. RNase T1 fingerprint analysis of the

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Binding of Host Factor and Sl to Q/3 and RI 7 RNA 1909

SI :0/3 HF:Q/3 SI:R17 HF: RI7

Band It- BPB-

Band I-

BPB

Band I

a b C d FIG. 6. Specificity of binding of Sl to Q/3 and RI7 RNA. a, 75 pg of

Qfl [“‘PI RNA (9 x 10’ cpm/pg) and 60 erg of Sl were incubated in 500 ~1 of Buffer B for 5 min at 37”, 750 gg of cold R17 RNA and 10 fig of RNase T1 were added, incubation was continued for 15 min at 25”, and the sample was filtered, extracted, and run on a polyacrylamide gel as described under “Experimental Procedure.” b, 100 rg of Q@ [“‘PI RNA (9 x 10’ cpm/pg) and 30 rg of HF were incubated in 500 ~1 of Buffer B for 5 min at 37O, 1.2 mg of cold R17 RNA and 20 gg of RNase T, were added, and incubation was continued for 15 min at 25’ before filtering. c, 50 fig of RI7 [“‘PI RNA (4 x 10’ cpm/Ng) and 25 pg of Sl were incubated in 200 ~1 of Buffer A for 5 min at 37”, 250 pg of cold R17 RNA and 10 rg of RNase T, were added, and incubation was continued for 13 min at 25” before filtering. d, 50 pg of R17 [“‘PI RNA (4 x 10” cpm/pg) and 20 pg of HF were incubated in 200 pl of Buffer B for 5 min at 37”. 250 pg of cold R17 RNA and 10 pg of RNase T, were added, and incubation was continued for 13 min at 25’ before filtering.

total Sl-protected RNA gives a very complex pattern, indicat- ing that the sequences bound by Sl are chosen either randomly or originate from a large number of sites within the R17 RNA molecule. This nonspecific interaction was observed in both the presence and absence of Mg*+.

Sl does not bind anv olieonucleotides generated bv complete RNase T1 digestion of R17 RNA to nitrocellulose filters. Likewise, no binding of Sl to pancreatic oligonucleotides is seen, nor are any regions of R17 RNA protected by the protein from pancreatic RNase. These results reinforce that idea that binding of Sl to the R17 genome is nonspecific and may involve interactions with large regions of the RNA molecule.

Effect of Sl and Host Factor on Initiation Complex Forma- tion with R17 RNA-Primarily because of confusion concern- ing the contrasting roles of Sl as an interference factor on the one hand (14-18) and as an integral ribosomal protein on the other (4, 5, 19, 23, 42, 43, 48, 49) we decided to re-examine possible cistron-specific effects of both HF and Sl on initiation complex formation directed by R17 RNA. We assayed initia- tion by fingerprint analysis of the ribosome-protected regions of S*P-labeled R17 RNA (34, 40, 41) (see Table VI). The RNA used was somewhat fragmented; but only in this state are all three phage cistrons available for ribosome recognition (40,41, 50), making possible a direct analysis of cistron specificity.

lnitiation car

Moles of protein added/mole RNA

Experiment I Control 5 x s,

1.5 x HF 7xHF

Experiment II Control 4x s,

16x S, 2xHF 10xHF

Experiment III Control 7 x s, 7xHF

Experiment IV Control 10 x s,

‘mtein’ sou*ce

GC GC GC

GC PBM GC GC

AW GC

AW

TABLE VI

dex formation with RI7 RNA

I lc Cpm inb

70 S peak

Ratio of sites (A

Reaction containing

protein

natlreplicase’)

Preincubated with protein

2ooo (260) 1:3.7:1.5 1600 1362) 1:2.3:1.4

1600 (190) 1:2.1:0.7

600 (81) 1: <0.4:0.

(93) 1:2.3:1.3

2soo (990) 1:2.0:0.6 2200 (921) 1:1.5:0.7 1500 (534) 1:l.S:l.l 2300 1226) 1:1.1:0.4 1300 (938) 1:O.l:O.l

5600 (401) 1:4.7:2.3 3400 (535) 1:1.8:1.6 3000 (25a 1:0.4:1.0

1800 (130) 1:3.5:4.0

1900 (162) 1:5.5:3.7 418) 1:4.3:0.8

“GC = G. Carmichael, Harvard University; PBM = P.B. Moore. Yale University; AW = A. Wabba, Sherbrooke University.

b Total counts per min in aliquots (see “Experimental Procedure”) of pooled fractions from 70 S region of the sucrose gradient.

‘Relative counts per min per s*PO, in initiator AUG-containing oligonucleotides; the number in parentheses is the actual counts per min per “TO,observed in ACCUAUG (from the A site).

Initiation complexes formed in the presence or absence of defined amounts (Column 1) of each of Sl or HF were trimmed with rihonuclease and fractionated on sucrose gradients. The amount of szP sedimenting at 70 S provides a measure of the overall efficiency of complex formation (Column 3). The ratios of the three R17 initiation sites bound in each reaction were calculated from the relative yields of the three initiator AUG-containing oligonucleotides in RNase T, fingerprints (Column 4). Column 5 presents data obtained by preincubat- ing the same R17 RNA with various isolates of Sl or HF followed by re-extraction of the RNA and binding to ribosomes in the absence of protein; since this procedure did not significantly alter the ratio of the three sites bound, we conclude that the results di!xwssed helnw cannot he asrrihwl tn

fragmentation of the RNA (40) by ribonuclease contamination of the protein preparations.

In agreement with previous results (14, 15, 17, 18), we observe that Sl does lower the overall binding of R17 RNA to rIbosomes (Table VI, Column 3). Depending on the experj- ment, with 5-fold or greater excess of Sl over RNA up to 2-fold reduction in the formation of initiation complexes is evident. On the other hand, when cistron specificity was examined (Column 4), less than 2-fold changes in the ratios of the three R17 sites were apparent even with up to 16 mol of Sl/mol of RNA. Since we consider S-fold variation to be within the reproducibility limits of the assay, we conclude that Sl does not exert cistron-specific effects on initiation complex forma- tion. Note that protein preparations obtained from several different sources, but all of which were active in binding specifically to Q@ RNA, gave comparable results (Column 2).

At 1 to 2 molar ratios of HF:RNA (the amount required to form the specific complex with R17 analyzed above) I-IF,

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1910 Binding of Host Factor and St to Q/3 and RI 7 RNA

like Sl, diminishes somewhat the overall efficiency of ribosome binding to the phage message (Table VI, Column 3). Under these conditions, there is little effect on the relative recognition of the three initiator regions (Column 4). However, by contrast to Sl, addition of HF at 5fold or greater molar excess does produce a preferential and significant (about lo-fold) inhibi- tion of ribosome binding to the beginning of the R17 coat protein cistron (Column 4).

DISCUSSION

HF Binds to Adenylnte-rich Sequences in Viral RNAs--We have found that HF binds to intact Qp RNA at two specific sites and to one site in R17 RNA (Fig. 7). Since the protein binds equally strongly and selectively to the same three T,

oligonucleotides in complete digests of the phage RNAs, we conclude that these fragments contain all of the information necessary for recognition by HF. None of the three isolated fragments can engage in stable internal secondary structure formation (46); thus HF recognizes regions that are indeed single-stranded as suggested by the results of Franze de Fernandez et al. (10).

All three of the unique HF binding sites investigated here contain adenylate-rich regions. Carmichael et al. (11) based their poly(A)-cellulose purification scheme on this observation. However, it would be misleading to suggest that HF merely counts adenylate residues. Jeppesen’s catalog of large R17 T, products (44) contains the sequence AACAAA (his Table 3a) and AUAAAA (his Table 3b). However, these sites are not bound by HF, although the first differs from the AAUAAA sequence in the Q@ Band II site only by a U + C substitution,

and the second is a sequence isomer. Carmichael (33) also found that HF binds to poly(U)-cel-

lulose somewhat less strongly than to poly(A)- and weakly to poly(C)-cellulose. We have found no HF-bound fragments rich in uridylic acid although Q/3 RNA, for example, contains the sequence UUUUUAUUAA (28) and R17 AUUUUUAAU (44). On the basis of competition binding experiments, Hori and Yanazaki (51) suggested that HF binds to QP RNA within uridylate-rich regions. We have no explanation for their results.

Unlike many proteins which interact with nucleic acids, HF is not dependent on MgZ+ for its specific binding to Qp or R17

RNA. When present in total RNase T, digests, the three oligonucleotides containing the Qfl and R17 binding sites are bound equally strongly and specifically in the presence or absence of Mg’+. Nonetheless, Mg’+ does have some effects on HF interaction with the intact phage RNA molecules. It increases the average size of the protected fragments contain- ing the primary R17 and Q/3 binding sites and changes the relative yield of the two Qfl sites, probably indirectly through effects on the secondary and tertiary structure of the RNA. With both viral RNAs, the higher background seen in gel patterns and in fingerprints of HF.RNA complexes formed and digested in the presence of Mg*+ suggests that Mg*+ may also have a stabilizing effect on nonspecific binding of HF to RNA. Alternatively, Mg’+ may affect the susceptibility of the pro- tein . RNA complexes to nuclease digestion.

Interaction of Sl with Viral RNA-As previously observed, 30 S ribosomal protein Sl binds both R17 and Q@ RNA to nitrocellulose filters (15, 22). With R17 RNA, Sl appears to interact with similar affinity at a large number of sites, displaying little specificity. On the other hand, in our protec- tion experiments Sl specifically selects a single site in Q6 RNA

QB Band I ACCAAUACUAAAAAG

QB Band II AAUAAAUUAUCACAAUUACUCUUACG

R17 AAUAAUAAAAUAG

FIG. 7. Sequence of the smallest HF-bound T, oligonucleotides from Q/3 and R17 RNA. R17 Band II is Band I with an additional AAG at the 5’ end. QB Band II is contained in Qj3 Band III. Sl binds only to Qj3 Band II. The sequences are aligned to show the maximum homology between the three oligonucleotides.

which is located in the HF-bound Q/3 Band II oligonucleotide (Fig. 7). (Other regions may also be bound by Sl but with a lower affinity, and thus not be detected under our conditions.)

As in the case of HF, Band II must contain all the information required for recognition by Sl, since the protein selectively binds this single Q@ region even when it is contained in the isolated oligonucleotide. Isolated Band II cannot form any internal secondary structure (see Fig. 4); thus Sl appar- ently binds single-stranded regions in RNA. The previously reported affinity of Sl for pyrimidine-rich polynucleotides (15, 16, 22, 23, 33) suggests that the protein may be interacting most strongly with the pyrimidine-rich sequence located near the 3’ end of Band II. Dahlberg and Dahlberg (52) have reported that Sl binds to the 3’ end of 16 S rRNA, which has the sequence AUCACCUCCUUA,,,. This sequence also is very pyrimidine-rich and some homology with the Band II oligonu- cleotide exists. There are a number of other equally pyrimi- dine-rich regions in the QP RNA (45) which are not protected and bound by Sl to filters under our conditions. Thus there must be other unidentified features that are responsible for specific binding of Sl to RNA.

As was the case with HF, Mg2+ is not required for interaction of Sl with viral RNA. Sl binds only one-fourth as much R17 or Qp RNA to filters in the presence of Mg’+ as in its absence, and the yield of the specific Sl binding site in Q/3 RNA is lowered substantially by the addition of Mg’+. It seems likely that these effects result from Mg ‘+-induced stabilization or altera- tion of the Q/3 RNA secondary or tertiary structure, rendering the Sl recognition site less available to the protein.

HF and Sl are Involved in Template Recognition by Q(3 Replicase-Previous work has suggested that Sl is required for

the functioning of QP replicase only in recognition processes involving Q/3 plus strand RNA (1, 24, 25). Weissmann and co-workers (1) found that the Qp replicase binds specifically to two sites in Qfi RNA, neither of which includes the 3’ terminus. Attachment of the enzyme to one of these two sites, which overlaps the coat protein ribosome binding site, is entirely dependent on the presence of Sl in the enzyme. We have found no evidence for specific binding of Sl alone to this site under similar conditions; however, it does contain a pyrimidine-rich sequence which may be related to the ability of Sl to facilitate the binding of Q/3 replicase to this region.

HF also appears to be required by the QP replicase system for utilization of the Q@ plus strand as a template (7, 8, lo), suggesting that HF acts during initiation (probably in a recognition process) rather than during elongation. Since Qp replicase itself exhibits no affinity for the 3’ end of QP RNA (53), a likely role for HF is to facilitate the interaction of Q@ replicase with the 3’ terminus of QP RNA. This could be ac- complished in either of two general ways, with Sl possibly playing a role in either scheme. In one model HF would bind to the Q/?l Band II site (near the 3’ end) and through a direct interaction with Qj3 replicase would pull the enzyme to the 3’ end. Evidence for an interaction between HF and Qfl replicase

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Binding of Host Factor a

is provided by the observation that only highly purified preparations of Qj3 replicase require added HF for activity (7, 8). In the second model, binding of HF would perturb the structure of the RNA either to make the 3’ end available to the replicase or to change the conformation of this region so that it would become recognizable by the enzyme. Binding of HF to the Band II site, near the 3’ end of Qp RNA, could directly effect such a change; interaction of HF with the Band I site might also be important. In either model, the ability of Sl also to interact with the Band II site could provide additional stability, or specificity, or both, in initiation complex forma- tion between replicase and the 3’ end of QP RNA.

On the basis of evidence presented here, we cannot distin- guish between the two models. Whatever the detailed role of HF, the finding that HF interacts with specific sites of Q/3 RNA suggests that it may be utilized by the phage replication machinery to provide a recognition check in addition to that performed by Qp replicase. Such a mechanism could further ensure that neither other competing RNA species, nor, for example, defective Q/3 RNA molecules could compete with Qp RNA for Qp replicase.

lnd Sl to Q/3 and RI 7 RNA 1911

adenylate-rich site in the R17 replicase gene, we likewise observe no convincing cistron-specific effects on the interaction of the phage RNA with ribosomes. Only at much higher HF concentrations does inhibition of initiation at the coat cistron become apparent. This result could reflect previously docu- mented structural requirements for efficient ribosome recogni- tion of the coat initiation site (40); certainly high concentra- tions of a protein which binds RNA as tenaciously as HF (10, 11, 33) would be expected to disrupt the native folding of the phage RNA genome. On the other hand, since the number of HF hexamers in an Escherichia coli cell is less than one-tenth the number of Sl molecules (ll), it seems unlikely that the phenomenon has physiological significance.

Role of Sl and HF in Replication of Other RNA Phages -Our studies have interesting implications for the mechanism of group I RNA phage replication. First, our inability to demonstrate a specific Sl binding site in R17 RNA suggests that Sl fulfills different roles in the R17 and the Q/3 systems. Likewise, the role of HF, if any, appears to be different, since the HF binding site in R17 RNA is located in the R17 replicase cistron, several hundred residues from the 3’ end.’ Nonethe- less, it is interesting that the R17 Band II sequence is conserved identically in MS2 RNA and at least the R17 Band I sequence is also identical in f2 RNA (54).

Acknowledgments-We are grateful to A. Wahba, P. Moore, and especially G. Carmichael for generous gifts of S 1 and HF, to M. A. Billeter and C. Weissmann for their assistance in the sequencing of Qfi Band I, and to A. Wahba, G. Carmichael, and K. Weber for many valuable discussions.

Nishihara et al. (55) have described differing template specificities for QB and SP replicase (SP phage is a group IV RNA phage (29)) I Part of this difference is accounted for by the differing requirements for a host cell component. Since it is not clear whether this component is Sl, HF, or some other protein, we conclude only that their findings are consistent with the observation that host components can play important roles in template recognition.

Lack of Cistron-specific Interference by Sl or Host Factor on Protein Synthesis Initiation Complex Formation with R17 RNA-Using well characterized protein preparations at known molar ratios of Sl to mRNA, we fail to detect significant cis- tron-specific interference with R17 RNA-directed initiation complex formation. The absence of effects on initiation at any one cistron is consistent with our finding that no particular re-

gion of purified RI7 RNA is selectively protected by associa- tion with Sl. A reduced efficiency of ribosome binding to the R17 RNA. protein complex seems reasonable when we consider that Sl has affinity for all polynucleotides (15, 21, 33), particularly those rich in uridylate residues. Nonspecific bind- ing probably also suffices to explain the previous observations of Lee-Huang and Ochoa (18), of Miller et al. (15, 16), and of Jay and Kaempfer (17). The last authors, because they used intact R17 RNA in initiation reactions, in fact had no way of distinguishing between nonspecific reduction of ribosome bind- ing by Sl and direct interference with initiation of coat protein synthesis. In the experiments where cistron-specific interfer- ence was first observed (14) with i factor, the effects, like ours,

Function of HF and Sl in Uninfected E. coli-Evidence is accumulating that Sl plays an essential role in normal ribosomal function, apparently at some step in mRNA binding and the initiation of protein synthesis (19-23, 42). As yet nothing is known about the function of HF in uninfected E. coli. Carmichael et al. (11) found that HF is associated with ribosomes, probably with the 30 S subunit,6 but is not an inte- gral ribosomal protein. We have observed that HF binds 23 S and 16 S rRNA (but not 5 S rRNA and tRNA) to nitrocellulose filters, and are presently investigating its interaction with other cellular RNA species. It seems not unlikely that a protein with such highly sequence-specific RNA binding capabilities as HF could be used as a recognition or control element in a variety of RNA metabolic processes such as RNA processing, translation, and degradation.

were minimal; although they may be real, we believe they

1. 2. 3.

4.

5.

6.

8.

9.

10.

11.

12. 13.

14.

15.

16.

REFERENCES

Weissmann, C. (1974) FEBS Lett. 40, SlO-S18 Kamen. R. (1970) Nature 228.527-533 Kondo, M., Gallerani, R., and Weissmann, C. (1970) Nature 228,

525-527 Wahba, A. J., Miller, M. J., Niveleau, A., Landers, T. A.,

Carmichael, G. G., Weber, K., Hawley, D. A., and Slobin, L. I. (1974) J. Biol. Chem. 249, 3314-3316

Inouye, H., Pollack, T., and Petre, J. (1974) Eur. J. Biochem. 45, 109-117

Blumenthal, T., Landers, T. A., and Weber, K. (1972) Proc. N&l. Acad. Sci. CJ. S. A. 69, 1313-1317

Franze de Fernandez, M. T., Eoyang, L., and August, J. T. (1968) Nature 219.588-590

August, J. T., Banerjee, A. K., Eoyang, L., Frame de Fernandez, M. T., Hori, K., Kuo, C. H., Rensing, U., and Shapiro, L. (1968) Cold Spring Harbor Symp. Quant. Biol. 33, 73-81

Kamen, R. I., Monstein, H. J., and Weissmann, C. (1974) Biochin. Biophys. Acta 366, 292-299

Frame de Femandez, M. T., Hayward, W. S., and August, J. T. (1972) J. Biol. Chem. 247.824-831

Caimiciael, G. G., Weber, .K., Niveleau, A., and Wahba, A. J. (1975) J. Biol. Chem. 250,3607-3612

Silverman, P. H. (1973) Arch. Biochem. Biophys. 157,222-233 Groner. Y., Pollack. R.. Berissi, H.. and Revel, M. (1972) FEBS

L&:21, 223-228’ Groner, Y., Pollack, R., Berissi, H., and Revel, M. (1972) Nature

New Biol. 239,16-19 Miller, M. J., Niveleau, A., and Wahba, A. J. (1974) J. Biol. Chem.

249,3803-3807 Miller, M. J., and Wahba, A. J. (1974) J. Biol. Chem. 249,

3808-3813 should be interpreted cautiously.

At protein:RNA ratios where HF specifically binds to the * R. Young and T. Blumenthal, personal communication.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

1912 Binding of Host Factor and Sl to Q/3 and RI 7 RNA

17. Jay, G., and Kaempfer, R. (1974) J. Mol. Biol. 82, 193-212 36. Lee-Huana. S.. and Ochoa, S. (1972) Biochem. Biophys. Res. 37. 18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

Comnu~. 49, 371-376 38. Van Duin, J., and Van Knippenberg, P. H. (19’74) J. Mol. Biol. 84,

185-195 39. Van Diejen, G., Van der Laken, C. J., Van Knippenberg, P. H.,

and Van Duin, J. (1975) J. Mol. Biol. 93, 351-356 Sobura, J., Gabiself, P., Hawley, D., and Wahba, A. (1975)

Biochem. Biophys. Res. Commun, in press Hermoso, J. M., and Szer, W. (1974) Proc. N&l. Acad. Sci. U. S. A.

71, 4708-4712

40. 41. 42. 43.

Tal, M., Aviram, M., Kanarek, A. J., and Weiss, A. (1972) Biochim. Bioohvs. Acta 281, 381-392

Kamen, R., Kc&o, M., Riimer, W., and Weissmann, C. (1972) Eur. J. Biochem. 31, 44-51

Landers, T. A., Blumenthal, T., and Weber, K. (1974) J. Biol. Chem. 249, 5801-5808

44. 45.

46.

Hori, K., Harada, K., and Kuwano, M. (1974) J. Mol. Biol. 86, 699-708 47.

Kolakofsky, D., and Weissmann, C. (1971) Nature New Biol. 231, 42-46 48.

Weber. H.. Billeter. M. A., Kahane. S., Weissmann. C., Hindley, J., and Porter, A: (1972) Nature New Biol. 237, 166-170

Mivaki. T., Haruna. I., Shiba, T., Itoh. Y. H., Yamane, K., and 49.

Watanabe, I. (1971) Proc. Natl. Acad. Sci. U. S. A. 68, 2022- 2024

30. Fedoroff, N. V., and Zinder, N. (1971) Proc. N&l. Acad. Sci. U. S. A. 68, 1838-1843

50. Kozak, M., and Nathans, D. (1972) Bacterial. Reu. 36, 109-134 51. Hori, K., and Yanazaki, Y. (1974) FEBS Lett. 43, 20-22 52. Dahlberg, A. E., and Dahlberg, J. E. (1975) Proc. Natl. Acad. Sci.

31. Fedoroff, N. V., and Zinder, N. D. (1973) Nature New Biol. 241, 105-108

53. Schwvzer. M.. Billeter. M. A.. and Weissmann. C. (1972)

32. Moore, P. B. (1971) J. Mol. Biol. 60, 169-184 33. Carmichael, G. G. (1975) J. Biol. Chem. 250, 6160-6167 34. Steitz, J. A. (1969) Nature 244,957-964 35. DeWachter, R., and Fiers, W. (1971) Methods Enzymol. 21,

54.

55.

167-178

Laemmli, U. K. (1970) Nature 227, 680-685 Sedat, J., Ziff, E., and Galibert, F. (1974) J. Mol. Biol. 87,377-407 Guthrie, C., Seidman, J. G., Altman, S., Barrel& B. G., Smith, J.

D., and McClain, W. H. (1973) Nature New Biol. 246, 6-11 Barrell, B. G. (1971) in Procedures in Nucleic Acid Research

(Cantoni, G. L., and Davies, D. R., eds) Vol. 2, pp. 751-779, Harper and Row, New York

Steitz, J. A. (1973) Proc. Natl. Acod. Sci. U. S. A. 70, 2605-2609 Steitz. J. A. (1973) J. Mol. Biol. 73, 1-16 Dahlberg, A. E. (1974) J. Biol. Chem. 249, 7673-7678 Szer, W., and Leffler, S. (1974) Proc. N&l. Acad. Sci. U. S. A. 71,

3611-3615 Jeppesen, P. G. N. (1971) Biochem. J. 124, 357-366 Weissmann, C., Billeter, M. A., Goodman, H. M., Hindley, J., and

Weber, H. (1973) Annu. Reu. Biochem. 42, 303-328 Tinoco, I., Jr., Borer, P. N., Dengler, B., Levine, M. D., Uhlen-

beck, 0. C., Crothers, D. M., and Gralla, J. (1973) Nature New Biol. 246, 40-41

Flavell, R. A., Sabo, D. L. O., Bandle, E. F., and Weissmann, C. (1975) Proc. Natl. Acad. Sci. U. S. A. 72, 367-371

Van Duin, J., and Kurland, C. G. (1970) Mol. Cen. Genet. 109, 169-176

Noller, H. F., Chang, C., Thomas, G., and Aldridge, J. (1971) J. Mol. Biol. 61, 669-679

U. S. A. 72, 2940-2944

Erierimentia 28, 750 Robertson. H. D.. and JeDDeSen. P. G. N. (1972) J. Mol. Biol. 68.

417-428’ _ _ Nishihara, I., Haruna, I., Yamaguchi, N., and Watanabe, I. (1972)

Nature New Biol. 238, 141-142

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

A W Senear and J A Steitzand R17 bacteriophage RNAs.

Site-specific interaction of Qbeta host factor and ribosomal protein S1 with Qbeta

1976, 251:1902-1912.J. Biol. Chem. 

  http://www.jbc.org/content/251/7/1902Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/251/7/1902.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from