1

Supporting Information Online

Materials and Methods

Gene expression analysis by RT-PCR

RNA was extracted from spleen or blood obtained from mice as indicated in the text, using the RNeasy

Mini Kit (QIAGEN, Germany), and subsequently converted into cDNA by reverse transcriptase

(Promega, Israel). A total volume of 20μl containing 300ng of total RNA template and 10μl of Power

CYBR Green Master Mix (Applied Biosystems, Israel) was prepared. Reactions were run on a 7000 Real-

Time PCR system (Applied Biosystems). The amounts of target genes were determined from the

comparative threshold cycle (CT) method. The expression level of each gene was further quantified

against the house-keeping HPRT gene using the same treatment and expressed as 2–ΔCT (CT of target

gene–CT of HPRT). The primer sequences were as follows: for mouse IL1β forward,

GCAACTGTTCCTGAACTCAACT; reverse, ATCTTTTGGGGTCCGTCAACT; for mouse HPRT forward,

CGGCTTCCTCCTCAGACC; reverse, GGTTCATCATCGCTAATCACG. All experiments were performed in

triplicates.

MMP9 detection by gelatin zymography

Plasma obtained from mice 24 hours after they were treated with vehicle control as well as PTX and/or

Anakinra were evaluated for MMP9 activity as previously described (1). The samples were resolved on

10% acrylamide Ready Gel Zymogram Gels (Bio-rad, Israel) under non-reducing conditions. The gels

were incubated in 2.5% Triton X-100 for 1 hour and transferred to a solution containing 50mM Tris,

0.2M NaCl, 5mM CaCl2 at pH 7.6 for 16 hours at 37°C . Subsequently, gels were stained with 0.5%

Coomassie Blue for one hour and then destained in methanol/acetic acid/H2O (10:10:80). Intensities of

the bands were quantified by densitometry, using TotalLab Quant software (TotalLab, UK).

Scratch wound assay

Scratch wound assay was performed as previously described (1). Briefly, MDA-MB-231 cells were plated

onto a 60-mm dish (Corning, Corning, NY) to create a confluent monolayer. A p200 pipet tip was used to

scrape the cell monolayer in a straight line to create a "scratch". Cell debris was removed by washing the

plate with DMEM. The cells were then incubated in serum free DMEM supplemented with 10% plasma

obtained from non-tumor bearing BALB/c mice 24 hours after they were treated with PTX, Anakinra, the

2

combination of the two drugs, or vehicle control. Baseline images of the scratch were captured using a

phase-contrast setting on a Leica CTR 6000 microscope (Leica Microsystems) and the Leica Application

Suite Version 3 to create a reference point. Images of the cells that migrated into the ‘scratch’ area were

captured 24 hours later at the same reference points. Invaded area was calculated as the difference

between the initial and final wound area as measured by Image J software( (NIH, USA)). The experiment

was repeated 3 times.

Clodronate liposomes (clodrolip).

A mixture of soy phosphatidylcholine (Avanti polar lipids, Alabaster, AL) and cholesterol (Sigma, St.

Louis, MO), was dissolved in chloroform in a 24:11 molar ratio. Chloroform was removed by rotary

evaporation under a gentle stream of nitrogen, resulting in a thin lipid film. The lipid film was then

dispersed in phosphate buffered saline (PBS), pH=7.4, containing 30mg/ml clodronate (Sigma, St. Louis,

MO). Control “sham” liposomes were prepared similarly, by dispersion in PBS alone. The solution was

then extruded twice through 1 µm polycarbonate membranes (Osmonics Inc., Minnetonka, MN) using

LIPEX® (Northern Lipids, Burnaby, Canada) and ultra-centrifuged for 45 min at 150,000g to remove un-

encapsulated clodronate. The pellet was re-suspended in PBS, and clodronate encapsulation was

assessed. For quantification of clodronate encapsulation, liposome sample was diluted 1:10 with 0.1%

Triton X-100 in order to disrupt the phospholipid bilayer. One ml of the diluted sample was mixed with

2.25 ml of 3mM HNO3 and 2.25 ml of 4mM CuSO4 in DDW. The absorbance of the solution was

determined at 240nm in a quartz cuvette. The blank was prepared by treating non-loaded liposomes

similarly. Standard curve was created using clodronate in DDW at concentrations between 0.5 and 10

mM. The final clodronate concentration of the liposome formulation was within the 3 to 3.5 mg/mL

range. Mice were injected intraperitoneally with 0.15 mL of the Sham or Clodronate containing

liposomes (clodrolip) 48 hours before injection of PTX chemotherapy.

Quantitation and visualization of microvessel density and vessel perfusion

Tissue processing and immunohistochemistry were performed as described previously (2). Briefly, tumor

cryosections (10 μm) were used to analyze blood vessel perfusion by the DNA-binding dye Hoechst

33342 (40 mg/kg; Sigma-Aldrich). Vessels were immunostained with endothelial cell specific antibody

(anti-CD31, 1:200 ratio, BD Biosciences), and the number of vessel structures per field were counted and

plotted (5 fields/tumor; n > 20 fields per group). The quantification of perfusion was performed after

intravenous injection of 5mg 150KDa FITC-conjugated dextran by analyzing the number of positive pixels

3

from the total pixels in a micrograph using Photoshop CS2 Version 2 software (Adobe Systems). Tumor

sections were visualized under a Leica CTR 6000 microscope (Leica Microsystems) using Leica

Application Suite Version 3.

Supplemental Figures

Supplemental Figure 1: The impact of plasma from mice treated with paclitaxel, Anakinra or the

combination of the two drugs on tumor cell invasion and motility. (A-B) Eight-to-ten week old BALB/c

mice were treated with paclitaxel (PTX), Anakinra or a combination of the two drugs (n=5 mice/group).

After 24 hours, mice were sacrificed and plasma was collected and either (A) pooled for the evaluation

of IL-1β protein expression by ELISA, or (B) loaded on zymography gel to evaluate MMP9 activity

followed by densitometry analysis. The experiment was repeated three times. (UD- undetectable). (C)

BALB/c mice were treated with vehicle (Control) or PTX (n=4 mice/group) and organs such as lungs,

kidney, brain, liver, and bone marrow were removed at 0, 6, 12, 24, and 48 hours post-treatment for the

assessment of IL-1β expression by ELISA. (D) Relative IL-1β transcript levels were assessed in the spleens

of BALB/c and C57Bl/6 mice treated with the same drug combinations as above using quantitative RT-

PCR. HPRT served as the internal control (n=3 repeats /group). Error bars ±SD. (E) The invasion

properties of LLC and MDA-MB-231 cells were assessed in response to 10% FCS in the presence of

Anakinra in escalating doses as indicated in the figure (left panel), and in the presence of IL-1β-depleted

plasma from control or PTX-treated mice (right panel) (Magnification X100, scale bar = 200 μm). (F)

Plasma was extracted from 8-10 week old BALB/c mice 24 hours after treatment with PTX and/or

Anakinra. The plasma was used in a scratch wound assay performed on MDA-MB- 231 cells, as detailed

in Materials and Methods. Images of the initial and final wound area are presented accompanied by a

graph calculating the differences in the invaded area at the initial and final wound area. Error bars ±SD.

*, p<0.05 ; **, p<0.01 ; ***, p<0.001.

Supplemental Figure 2: The invasion properties of tumor cells expressing IL-1R-I in the presence or

absence of IL-1β. Eight-ten week-old BALB/c mice underwent macrophage depletion using Clodronate-

containing liposomes (clodrolip), as described in Materials and Methods. Sham liposome injection was

set as control (n=5 mice/group). Forty-eight hours later, the mice were treated with vehicle (Control) or

paclitaxel (PTX) chemotherapy. After 24 hours, mice were sacrificed and spleens and plasma were

obtained. (A) Spleens were prepared as single cell suspensions and were then evaluated for macrophage

4

depletion. Representative flow cytometry plots are provided. (B) The effect of the plasma samples on

the invasion properties of MDA-MB-231 cells was assessed by the modified Boyden chamber assay

(magnification X100, scale bar = 200 μm), and a summary of the number of cells per field is provided. (C)

The expression level of IL-1R in LLC and MDA-MB-231 cells were assessed was assessed by flow

cytometry. Histograms of flow cytometry data represent the expression of IL-1R (green line). Cells

incubated with secondary antibody were used as negative control for background staining (black line).

(D) The invasive properties of LLC and MDA-MB-231 cells were evaluated using the modified Boyden

chamber assay, with different concentrations of recombinant IL-1β with or without peritoneal

macrophages cultured in the lower chamber. Quantification of invading cells was performed using

Image-J software (NIH). Error bars ±SD. Not significant (ns); *, p<0.05 ; **, p<0.01 ; ***, p<0.001.

Supplemental Figure 3: Tumor cell invasion and metastasis in IL-1β-deprived mice following treatment

with paclitaxel. (A) An illustration of the experimental plan using lethally irradiated C57Bl/6 mice that

were transplanted with bone marrow cells from either WT or IL-1β-/- donor mice to generate WT BM WT

or WT BM IL-1β-/- mice. After bone marrow reconstitution, the mice were used either for tail vein injection

of LLC-GFP+ cells in an experimental lung metastasis, or for subcutaneous LLC tumors implanted in the

flanks. (B) Confirmation of IL-1β depletion in bone marrow cells obtained from eight-week-old donor

C57Bl/6 WT and C57Bl/6 IL-1β-/- mice (n=6 mice/group). The bone marrow cells were transplanted by

tail vein injection into lethally irradiated C57Bl/6 WT recipients (1000 rad). After bone marrow cell

reconstitution, recipient mice were bled from the orbital sinus to evaluate bone marrow transplantation

efficiency using RT- PCR for the detection of relative IL-1β transcript levels. Analysis of HPRT served as

the internal control. (C) Eight-to-ten week old C57Bl/6 mice were implanted with LLC-GFP+ cells. When

tumors reached a size of 500mm3, the mice were treated with PTX. A day later, tumors were removed

and prepared as single cell suspension. Tumor cells (GFP+) were sorted by FACS, and an equal protein

amount of tumor cell lysates was analyzed for IL-1β expression using ELISA. (D) Chimeric mice

transplanted with either WT IL-1β or IL-1β -/- bone marrow cells (n=4-5 mice/group) were treated with

PTX, 24 hours prior to intravenous injection of LLC cells. A Kaplan Meier survival curve is presented

(p>0.05). (E) In a different experiment, plasma from non-tumor bearing chimeric mice treated with PTX

was used to test LLC and MDA-MB-231 cell invasion as evaluated by the Boyden chamber assay, and

quantifications of the number of cells invaded to the lower compartment are presented in the graph. In

a separate set of experiments, LLC and 4T1 tumor bearing mice (n=7mice/group) were treated with

paclitaxel (PTX), Anakinra or PTX+Anakinra. Anakinra was injected intraperitoneally for 3 sequential days

5

starting one day prior to chemotherapy administration. Control mice received the relevant vehicles. (F)

Tumors were measured regularly using Vernier calipers, and tumor growth (volume) was evaluated.

Tumor growth curves were not statistically different. (G) At end point, lungs were removed for the

evaluation and quantification of metastatic lesions and presented as metastasis number/field.

Representative image of 4T1 metastasis lesions in lung sections (H&E staining)(magnification x50, scale

bar = 500µm) are also presented. Error bars ±SD. **, p<0.01 ; ***, p<0.001.

Supplemental Figure 4: The relative perfusion area of 4T1 tumors, and the phenotype analysis of M1

and M2 macrophages. (A) 4T1 tumor bearing mice (n=7mice/group) were treated with paclitaxel (PTX),

Anakinra or the combination of the two drugs. Anakinra was injected intraperitoneally starting one day

prior to chemotherapy administration following daily administrations to the experiment’s end point in a

long-term experiment setting. When tumors reached 500mm3, the tumors were removed and evaluated

for vessel perfusion (green) using fluorescein isothiocyanate (FITC)-conjugated dextran as described in

Materials and Methods (magnification x100, scale bar=200 μm). (B) Percentage of perfusion was

calculated. “(C) Flow cytometry dot plots of the percentage of gated M1 (F4/80+/CD11c+/CD206-) and

M2 (F4/80+/CD11c-/CD206+)-like macrophages colonizing tumors from mice treated with PTX or

PTX+Anakinra. The number of macrophages was calculated as a percentage per total 106 cells acquired

by flow cytometry. Error bars ±SD* *, p<0.01; * * *, p<0.001.

6

REFERENCES 1. Gingis-Velitski S, Loven D, Benayoun L, Munster M, Bril R, Voloshin T, et al. Host response to short-term, single-agent chemotherapy induces matrix metalloproteinase-9 expression and accelerates metastasis in mice. Cancer Res. 2011;71:6986-96. 2. Shaked Y, Henke E, Roodhart JM, Mancuso P, Langenberg MH, Colleoni M, et al. Rapid chemotherapy-induced acute endothelial progenitor cell mobilization: implications for antiangiogenic drugs as chemosensitizing agents. Cancer cell. 2008;14:263-73.

Supplemental Figure 1

A

D BALB/c C57Bl/6

B

C

Control Anakinra PTXPTX +

Anakinra

0

50000

100000

150000

200000

Control Anakinra PTX PTX+Anakinra

Intensity

 (Arbitrary un

its) Pro‐MMP9

Active‐MMP9

0100200300400500600700800

IL‐1β (pg/ml)

Time (Hours)

Lung

0

50

100

150

200

250

300

IL‐β (p

g/ml)

Time (Hours)

0

20

40

60

80

100

IL‐1β (pg/ml)

Time (Hours)

Kidney Brain

0100200300400500600700800900

1000

IL‐β (p

g/ml)

Time (Hours)

0510152025303540

IL‐β (p

g/ml)

Time (Hours)

Liver Bone marrow

Pro‐MMP9Active‐MMP9

E F

LLC

MDA‐MB‐231

A

C D

B

Supplemental Figure 2

Supplemental Figure 3

A

p>0.05

B

D

EC

0

10

20

30

40

50

Control PTX

IL‐1 β (p

g/ml)

ns

LLC

LLC 4T1

4T14T1

vv

Supplemental Figure 3

F

G

A

B C

Supplemental Figure 4