Cellular Signalling 26 (2014) 1717–1724

Contents lists available at ScienceDirect

Cellular Signalling

j ourna l homepage: www.e lsev ie r .com/ locate /ce l l s ig

The Drosophila tankyrase regulates Wg signaling depending on theconcentration of Daxin

Ying Feng a,b,1, Xue Li c,d,1, Lorraine Ray e, Haiyun Song f, Jia Qu b, Shuyong Lin a,⁎, Xinhua Lin c,e,⁎⁎a State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, Fujian 361102, Chinab School of Optometry and Ophthalmology and Eye Hospital, Wenzhou Medical University, Wenzhou, Zhejiang 325027, Chinac State Key Laboratory of Biomembrane and Membrane Biotechnology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, Chinad University of the Chinese Academy of Sciences, Beijing 100049, Chinae Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USAf Laboratory of Food Safety, Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, CAS, Shanghai 200031, China

⁎ Corresponding author. Tel.: +86 592 2184687; fax: +⁎⁎ Correspondence to: X. Lin, State Key Laboratory ofBiotechnology, Institute of Zoology, Chinese Academy of STel.: +86 10 64807978; fax: +86 10 64807970.

E-mail addresses: linsy@xmu.edu.cn (S. Lin), xinhua.li1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.cellsig.2014.04.0140898-6568/© 2014 Published by Elsevier Inc.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 29 March 2014Accepted 19 April 2014Available online 25 April 2014

Keywords:TankyraseWg signalingDaxinDrosophila

The canonicalWnt signaling pathway plays critical roles during development and homeostasis. Dysregulation ofthis pathway can lead tomany human diseases, including cancers. A key process in this pathway consists of reg-ulation of β-catenin concentration through an Axin-recruited destruction complex. Previous studies have dem-onstrated a role for tankyrase (TNKS), a protein with poly(ADP-ribose) polymerase, in the regulation of Axinlevels in human cells. However, the role of TNKS in development is still unclear. Here, we have generated a Dro-sophila tankyrase (DTNKS) mutant and provided compelling evidence that DTNKS is involved in the degradationof Drosophila Axin (Daxin). We show that Daxin physically interacts with DTNKS, and its protein levels are ele-vated in the absence of DTNKS in the eye discs. In S2 cells, DTNKS suppressed the levels of Daxin. Surprisingly,we found that Daxin in turn down-regulated DTNKS protein level. In vivo study showed that DTNKS regulatedWg signaling and wing patterning at a high Daxin protein level, but not at a normal level. Taken together, ourfindings identified a conserved role of DTNKS in regulating Daxin levels, and thereby Wg/Wnt signaling duringdevelopment.

© 2014 Published by Elsevier Inc.

1. Introduction

Wingless (Wg)/Wnt signaling is an evolutionarily conserved sig-naling pathway from invertebrates to vertebrates which plays criti-cal roles during embryonic development, stem cell self-renewal,tissue homeostasis, adipogenesis, and neuronal maturation [1–3].The key process in the canonical Wg/Wnt signaling pathway is theregulation of the concentration of β-catenin/Armadillo by a destruc-tion complex composed of Axin, GSK3/Shaggy, APC and CKI [4–8]. Inthe absence of the Wg/Wnt ligand, the destruction complex associateswith β-catenin/Armadillo and induces its degradation through theubiquitin–proteasome mechanism [9–12]. When the ligand is present,β-catenin/Armadillo dissociates from the destruction complex and

86 592 2184687.Biomembrane and Membraneciences, Beijing 100101, China.

n@ioz.ac.cn (X. Lin).

translocates to the nucleus. Within this destruction complex, Axinserves as a central scaffold protein and binds the components of the de-struction complex through different domains [5–8,13]. Previous studyshowed that Axinwas present at a lower concentration than other com-ponents of the complex, and overexpression of Axin in cultured cellspromoted degradation of β-catenin [14]. Thus, Axin is considered tobe a limiting factor during the destruction complex formation, and itsconcentration is tightly regulated [14].

Tankyrases (TNKSs) are proteinswith poly(ADP-ribose) polymeraseactivity and are evolutionarily conserved in human, mouse, rat, chicken,Caenorhabditis elegans, and Drosophila [15]. Two human TNKSs,hTNKS1 and hTNKS2, share an 85% amino acid identity [16–18]. BothhTNKSs contain an ankyrin repeat domain, a SAM domain, and a PARPdomain [16–18]. hTNKSs have been shown to be essential in regulatingtelomere length. In human cells, hTNKS1 binds to the telomeric-repeat-binding-factor 1 (TRF1), a negative regulator of telomere length main-tenance [19], removes TRF1 from telomeres and further inducesits ubiquitination and degradation [16,20–23]. In addition, hTNKSs arealso involved in GSV trafficking [24–26], spindle structure regulation[27], resolution of sister telomere association [28], and centrosomeregulation and maturation [29,30]. In human cells, hTNKSs mediate

1718 Y. Feng et al. / Cellular Signalling 26 (2014) 1717–1724

PARsylation of Axin1 and Axin2 to regulate the Axin protein at appro-priate levels. Knocking-down TNKSs significantly increased the Axinprotein levels, and thereby suppressed Wnt signaling [31]. A recentstudy showed that both human and Drosophila TNKSs modulatedthe activity of the proteasome regulator PI31, and were involved inproteasome assembly [32].

It is less clear about the role of TNKS in development. HomozygousTNKS1 mice and TNKS2 mice are viable, but double mutant mice areembryonic lethal, suggesting that mouse TNKS1 and TNKS2 are func-tionally redundant [33]. Interestingly, TNKS1−/− mice fail to show anyeffect on telomere maintenance, and appear to develop normally [33].Similar results were obtained from TNKS2−/− mice regarding telomereregulation [22,34]. Thus, the role of TNKS during development remainslargely unknown and needs to be further examined.

To elucidate the function of TNKS in development, we have generat-ed a Drosophila tankyrase (DTNKS) mutant and examined its role in Wgsignaling. We provide compelling evidence that DTNKS is involved inthe degradation of Daxin. We show that DTNKS interacts with Daxinand suppresses Daxin protein levels in S2 cells. Daxin levels are in-creased in the absence of DTNKS in the eye disc. Importantly, wefound that Daxin in turn down-regulated protein levels of DTNKS. Invivo study showed DTNKS regulated Wg signaling and wing patterningat a high Daxin protein level, but not at a normal level. Taken together,our findings identified a conserved role of DTNKS in regulating Daxinlevels, and thereby Wg/Wnt signaling during development.

2. Material and methods

2.1. Drosophila strains

All Drosophila stocks weremaintained and crossed at 25 °C accordingto standard procedures. The En-gal4, ywhsflp;FRT82B-ubiGFP, ywhsflp;FRT 82B-hsCD8GFP and SalE-gal4 lines were obtained from the Blooming-ton Stock Center. The UAS-DTNKS-RNAi and UAS-V5-DTNKS transgenicfly lines were generated using the PhiC31 integrase-mediated site-specific transgenesis system. The DTNKSm250 and DTNKSm23 were gen-erated from fly strain P{EPg}HP37069 (BL#22129). The SalE-gal4,UAS-Axin/TM6B line was a gift from Dr H. Song's lab.

2.2. Generation of transgenic constructs

To generate N-terminal V5-tagged full-length and PARP-domain truncated DTNKS constructs, we amplified the DTNKS cDNA(DGRC#LD22548) by PCR and sub-cloned it into the pUAST-attB-V5vector with XhoI and XbaI sites. The primers were as follows:

Tank forward: 5′-CCGCTCGAGATGGCCAACAGCAGCCGAAG-3′

Tank reverse: 5′-GCTCTAGATCATCTTGTATCCTCCGTTCC-3′TankΔPARP forward: 5′-CCGCTCGAGATGGCCAACAGCAGCCGAAG-3′TankΔPARP reverse: 5′-GCTCTAGATCAATTCACGTTGTTACCAATGC-3′.

To obtain the N-terminal V5-tagged, ankyrin-domain truncatedDTNKS construct, we amplified the cDNA fragments from the full-length cDNA by bridge PCR and sub-cloned it into the pUAST-attB-V5vector with XhoI and XbaI sites. The primers were as follows:

TankΔANK forward-1: 5′-CCGCTCGAGATGGCCAACAGCAGCCGAAG-3′

TankΔANK reverse-1: 5′-TCCCGCCGTATCCCTGGCGTTC-3′TankΔANK forward-2: 5′-GATACGGCGGGA GAGGGGCAGA-3′TankΔANK reverse-2: 5′-GCTCTAGATCATCTTGTATCCTCCGTTCC-3′.

The PARP-domain truncated construct has a deletion of 961–1181aa,and the ankyrin-domain truncated construct has a deletion of56–770aa.

A similar strategy was used to generate the pUAST-Flag-Daxin andpUAST-Flag-Daxin (Δ19–27aa) constructs, which were sub-cloned

into the pUAST-Flag vector with BglII and XbaI sites. The primers wereas follows:

Daxin forward: 5′-GAAGATCTGATGAGTGGCCATCCATCGGGAATC-3′Daxin reverse: 5′-GCTCTAGATTA ATCGGATGGCTTGACAAGACC-3′Daxin (Δ19–27aa) forward: 5′-GAAGATCTGATGAGTGGCCATCCATCGGGAATCCGGAAACATGATGATAATGAGTGT GTTAAAAAGATGACCGAAGG-3′Daxin (Δ19–27aa) reverse: 5′-GCTCTAGATTA ATCGGATGGCTTGACAAGACC-3′.

To generate DTNKS shRNA constructs, the following primers wereannealed at 95 °C for 5 min in annealing buffer (10 mM Tris–HCl,pH 7.5, 100mMNaCl, 1 mM EDTA), and slowly cooled to room temper-ature. The oligos were sub-cloned into the pWALIUM20 vector withNheI and EcoRI sites. The primers were as follows:

tank-RNAi-1 forward: 5′-CTAGCAGTCGTGCTGTGTCGAACCAAAGATAGTTATATTCAAGCATATCTTTGGTTCGACACAGCACGGCG-3′tank-RNAi-1 reverse: 5′-AATTCGCCGTGCTGTGTCGAACCAAAGATATGCTTGAATATAACTA TCTTTGGTTCGACACAGCACG ACTG-3′tank-RNAi-2 forward: 5′-CTAGCAGTCGGAGTACTTGATAACCTACCTAGTTATATTCAAGCATA GGTAGGTTATCAAGTACTCCG GCG-3′tank-RNAi-2 reverse: 5′- AATTCGCCGGAGTACTTGATAACCTACCTATGCTTGAATATAACTA GGTAGGTTATCAAGTACTCCG ACTG-3′.

2.3. Generation of DTNKS mutant clones

The DTNKS mutant clones were generated by the FLP–FRT method.The flies were heat shocked at 37 °C for 1 h at the 1st and 2nd instarlarval stages to induce mitotic clones.

2.4. Drosophila imaginal disc preparation, immunostaining andmicroscopy

Drosophila imaginal discs were dissected from the 3rd instar larvaein cold PBS solution, fixed in 4% formaldehyde for 15 min at room tem-perature and rinsed in PBS containing 0.1% Triton X-100 (PBST). For im-munostaining experiments, imaginal discs were blocked in blockingbuffer (PBST with 5% serum) for 15 min and incubated with indicatedantibodies. The imaginal discs were photographed using the ZeissLSM710 Laser Scan Confocal Microscope. The antibodies used inthis study were as follows: rabbit anti-Vg (1:25), mouse anti-Dll(1:500), guinea pig anti-Sens (1:200), goat anti-Daxin (dT-20, SantaCruz, 1:10), mouse anti-Eya (DSHB, 1:20), and guinea pig anti-Daxin(1:500). The primary antibodies were detected by fluorescent-conjugated secondary antibodies (Invitrogen). The adult wing imageswere obtained using OLYMPUS BX41 microscope.

2.5. The total RNA isolation and real-time quantitative PCR

Adult wild-type and DTNKSm250flies were used to isolate RNA with

RNAprep pure tissue kit (Tiangen). cDNAs were produced with theRT-PCR kit (K1005s, Promega) in a 10 μl reaction volume. QuantitativeRT-PCR was performed using Applied Biosystems 7500 Real-Time PCRSystem. Three pairs of primers were used to detect DTNKS expression.The transcription levels of DTNKSwere normalized to Ribosomal proteinL32 (rp49). The primers were as follows:

tank-1 forward: 5′-GTGTAGGACGGGCAGAGCAACT-3′tank-1 reverse: 5′-CATGACCGCATCGAGATTAACG-3′tank-2 forward: 5′-ATGGGCACTATGAGGTAACCGAACT-3′tank-2 reverse: 5′-TGCAACATCGTGATCAGATTCCTTA-3′tank-3 forward: 5′-CTATGCACATTGTTGGTGGACTT-3′tank-3 reverse: 5′-GGACTACCGTGGAAGAGCATAC-3′Rp49 forward: 5′-ATGCTAAGCTGTCGCACAAA-3′Rp49 reverse: 5′-GTTCGATCCGTAACCGATGT-3′.

1719Y. Feng et al. / Cellular Signalling 26 (2014) 1717–1724

2.6. Luciferase assay

Drosophila Schneider 2 (S2) cells were seeded in 6-well plates,cotransfected with plasmids expressing pWALIUM20-DTNKS-shRNA(or pWALIUM20 vector), 12× dTCF Firefly luciferase, Dfz2, and Renillaluciferase by Effectene (Qiagen) or treated with XAV939 (Sigma Al-drich). After 36 h transfection, the medium containing secreted wing-less was added to the cultured cells, and luciferase assays were carriedout 4 h later. The activity of Wg signaling was determined by the ratioof Firefly/Renilla luciferase activity.

2.7. Cell culture and transfection

S2 cells were cultured in Schneider's medium supplementedwith 1 U/ml penicillin and 1 μg/ml streptomycin at 25 °C. Plasmid trans-fection was performed using Effectene (Qiagen) according to themanufacturer's instructions.

2.8. Immunoblotting and immunoprecipitation

Cell lysateswerepreparedwithRIPAbuffer (Beyotime). Total proteinswere resolved by SDS-PAGE, transferred onto PVDFmembrane (BioRad),and probed with indicated antibodies. For co-immunoprecipitationexperiments, cells were lysed in lysis buffer (20 mM Tris–HCl, pH 7.6,150 mM NaCl, 1 mM EDTA, 0.1% NP-40, with 1 mM protein inhibitor).Precleared cell lysates were incubated with the indicated antibodiesand Protein G-sepharose beads (GE Healthcare) for 4 h at 4 °C. Beadswere washed with lysis buffer 3 times. The bound proteins were elutedby SDS buffer, and monitored by western immunoblotting. The resultsof western blots were analyzed by LICOR Odyssey Imager. The antibodiesused in this study were as follows: rabbit-anti-V5 (Sigma, 1:1000),mouse-anti-V5 (Invitrogen, 1:2000), mouse-anti-Flag (Sigma, 1:1000),mouse-anti-GFP (Invitrogen, 1:1000), and rabbit-anti-DTNKS (1:300).

3. Result

3.1. Drosophila tankyrase (DTNKS) is not required for viability

Drosophila CG4719 encodes the Drosophila tankyrase (DTNKS). TheDTNKS gene is localized on the 3rd chromosome and encodes two poly-peptides, one contains 1181 amino acids and the other contains 1520amino acids. Both polypeptides contain three protein domains: an ankyrin

Fig. 1.Generation of DTNKSmutant. (A) DTNKS is highly conservedwith human TNKS1. It sharedomain, and the PARP domain, respectively. (B) Schematic diagram of the genomic region of Dexon sequences. P{EPg}HP37069 indicates the insertion site of the P-element. Straight lines shand ATG of DTNKS. (C) Quantitative RT-PCR using total RNAs from adult DTNKSm250 homozygocontrol rp49. The primer pair tank-1 is located at deleted region, and serves as a negative colevel of DTNKS in DTNKSm250 mutant is as low as negative control. Error bars represent standar

repeat domain, a PARP domain, and a SAM domain. DTNKS shares highidentity with hTNKS within these domains. The ankyrin repeat domainof DTNKS shares 71.6% identity with hTNKS1 (Fig. 1A). The PARP do-main and SAM domain share 75% and 51.5% identity, respectively,with those of hTNKS (Fig. 1A), indicating that DTNKS is an evolutionarilyconserved protein.

To examine the functions of DTNKS in development, we generatedDTNKS mutants through P element-mediated knockout technique. TheP element, P{EPg}HP37069 (BL#22129), was inserted in the 5′-UTR ofDTNKS gene. The imprecise excision of this P element generated two al-leles of DTNKS: DTNKSm23 and DTNKSm250. Segments of 1635 bp and1924 bp of genomic DNA were deleted in DTNKSm23 and DTNKSm250, re-spectively (Fig. 1B). Both deletions covered the first exon of DTNKS.Moreover, DTNKSm250 covered part of the regulatory region in front ofthe transcription starting site (Fig. 1B). Both alleles were homozygousviable. To determine whether our generated mutants are null, we per-formed real-time PCR to detect DTNKSmRNA transcription level in theDTNKSm250 mutant with three pairs of primer (tank-1, tank-2 andtank-3). The region covered byprimer pair tank-1was located at the de-leted region, which served as a negative control. The regions covered byprimer pairs tank-2 and tank-3 were located at the non-deleted region,detecting the transcription level of DTNKS. The results from RT-PCR re-vealed that DTNKS mRNA level in DTNKSm250 mutant was as low as thenegative control (Fig. 1C), suggesting that DTNKSm250 was a null allele.The DTNKSm250 homozygousmutant was fertile and had no obvious de-velopmental defects, indicating that DTNKS was not required forviability.

3.2. DTNKS interacts with Daxin, and their protein levels are mutuallyinterdependent

A previous study showed that hTNKS interacted with Axin and in-duced the degradation of Axin [31]. To explore whether DTNKS regu-lates Daxin in Drosophila, we examined the interaction between Daxinand DTNKS in Drosophila S2 cells. Using co-immunoprecipitation exper-iments, we found DTNKS Co-IPed with Daxin, and vice versa (Fig. 2A).Axin contains an N-terminal tankyrase binding domain (TBD), whichis conserved in different species and has been shown to mediate theinteraction between hTNKS and Axin [31]. Deletion of this domain inDaxin (mapped to 17th–29th amino acids) also disrupted the interac-tion between DTNKS and Daxin (Fig. 2A, lanes 2 and 5), confirmingthat Daxin binds to DTNKS via its N-terminal TBD. DTNKS contains

s 71.6%, 51.5% and 75% identity with human TNKS1 at the ankyrin repeat domain, the SAMTNKS locus. Red boxes represent coding sequences and gray boxes indicate untranslatedow intron sequences and broken lines indicate deleted sequences covering the first exontes or wild- type flies. The expression level of DTNKS of each line was normalized to thentrol. The primer pairs tank-2 and tank-3 are located at non-deleted region. The mRNAd error of the mean.

Fig. 2.DTNKS interacts with Daxin and modulates protein levels of each other in S2 cells. (A) DTNKS interacts with Daxin in S2 cells. V5-tagged DTNKS and Flag-tagged Daxin expressionvectors were transfected into S2 cells (lanes 1, 4). V5-DTNKS and Flag-Daxin are co-precipitatedwith each other (lanes 1, 4). TBD of Daxin (mapped to 17th–29th amino acids) is requiredfor Daxin to bind to DTNKS (lanes 2, 5). A construct lacking this domain does not interact with DTNKS. (B) The ankyrin repeat domain, but not the PARP domain, of DTNKS is required forDTNKS binding to Daxin. DTNKS lacking the ankyrin repeat domain does not bind to Flag-Daxin. (C) Exogenous expression of DTNKS causes reduction of Daxin protein levels. The proteinlevel of Flag-Daxin was significantly reduced with increased amount of V5-DTNKS. (D) Exogenous expression of Daxin results in down-regulation of the DTNKS protein level. The proteinlevel of V5-DTNKSwas significantly reducedwith increased amounts of Flag-Daxin. (E) Thediagramof theDTNKSmutant constructs. The PARP-domain truncated construct, DTNKSΔPARP,has a deletion of 961–1181aa. The ankyrin repeat domain truncated construct, DTNKSΔANK, has a deletion of 56–770aa.

1720 Y. Feng et al. / Cellular Signalling 26 (2014) 1717–1724

an N-terminal ankyrin repeat domain, a middle SAM domain, and aC-terminal PARP domain. We next examined which domain in DTNKSmediated the interaction between DTNKS and Daxin. We generated twotruncated DTNKS constructs, one deleting the PARP domain (961st–1181st amino acids) and the other deleting the ankyrin repeat domain(56th–770th amino acids) (Fig. 2E). Using co-immunoprecipitationexperiment, we found that the ankyrin repeat domain, but not thePARP domain, was required for DTNKS binding to Daxin (Fig. 2B). Thesedata indicated that DTNKS physically interacted with Daxin, and thisinteraction was mediated via the TBD domain of Daxin, and the ankyrinrepeat domain of DTNKS.

We found that the protein level of Daxin was much lower than thatof Daxin (Δ17–29aa) when co-expressed with DTNKS (Fig. 2A, lanes 1

and 4 compared to lanes 2 and 5), suggesting that the binding ofDTNKS might affect Daxin protein levels. We then examined theDaxin protein level in the presence of increasing amounts of DTNKS.Co-transfection of DTNKS dramatically decreased protein levels ofDaxin in a dosage-dependent manner (Fig. 2C), suggesting a conservedrole of DTNKS in the regulation of Daxin protein levels.

Surprisingly, we found that the protein level of DTNKS was alsoreduced in the presence of co-expressed full-length Daxin, but not inthe presence of Daxin (Δ19–27aa) (Fig. 2A, lane 1 compared to lane2). Indeed, co-expression of increasing amounts of Daxin down-regulated DTNKS protein levels in a dosage-dependent manner(Fig. 2D). These data suggest that DTNKS and Daxin can regulate theprotein levels of each other.

Fig. 3. DTNKS regulates Wg signaling and wing patterning. (A) Paracrine activationluciferase assay. Knock-down of DTNKS by two independent shRNAs inhibits Wg reporterin S2 cells (***p b 0.001, n = 5). (B) Paracrine activation luciferase assay as in figure (A).Suppression of DTNKS activity by XAV939 inhibits Wg reporter in S2 cells (***p b 0.001,n= 6). (C) Knock-down of DTNKS by RNAi driven by SalE-gal4 has no effect on wing pat-terning. (D) Overexpression of Daxin driven by SalE-gal4 led to wing margin and bristledefects. (E) The defects in (D) were enhanced when DTNKS shRNA was coexpressedusing SalE-gal4. (F) The wing defects in (D) were rescued by ectopic expression of V5-DTNKS.

1721Y. Feng et al. / Cellular Signalling 26 (2014) 1717–1724

3.3. DTNKS regulates wing patterning depending on the concentrationof Daxin

Daxin (Axin) acts as a scaffold protein in the destruction complex toregulate the stability of Armadillo (β-catenin), and works as a negativeregulator in Wg/Wnt signaling [5–8,13,35,36]. The aforementionedexperiments showed that DTNKS was involved in the degradation ofDaxin in S2 cells. To determine whether DTNKS is required for Wgsignaling, we generated two independent shRNAs targeting DTNKS toexamine DTNKS′ function in theWg signaling pathway. We first exam-ined theWg-stimulated luciferase activity in S2 cells. The result showed

Fig. 4.Daxin is increased in DTNKSmutant clones. (A-C) Protein levels of Daxin were increasedEndogenous Daxin was increased in DTNKS mutant cells in the eye discs.

that depletion of DTNKS using DTNKS-shRNA1 or DTNKS-shRNA2 sig-nificantly reduced theWg reporter activity (p b 0.001) (Fig. 3A). Similarresult was also obtained after treating S2 cells with XAV939, a smallmolecule inhibitor of hTNKS (p b 0.001) (Fig. 3B). These results indicatethat DTNKS regulates Wg signaling in S2 cells. To confirm this findingin vivo, we generated UAS-DTNKS-RNAi transgenic flies expressingDTNKS-shRNA and used genetic approaches to test the function ofDTNKS during wing patterning. Wing margin bristles are a particularlysensitive indicator for proper levels of Wg signaling. Excessive Wg sig-naling causes ectopically expressed bristles, whereas low levels of Wgsignaling lead to loss of bristles [37,38]. However, we found thatknocking-down DTNKS by DTNKS-shRNA-mediated RNAi using SalE-gal4 or En-gal4 (data not shown) had no obvious defects in wing pat-terning (Fig. 3C). Axin works as a negative regulator in Wg signaling,and a high concentration of Axin protein inhibits Wg signaling. Thus,we speculated that the elevated Daxin protein level in the absence ofDTNKS was not high enough to influence Wg signaling. We tested thispossibility by knocking-down DTNKS in a genetic background withhigh levels of Daxin. During wing patterning, ectopic expression ofDaxin in the wing pouch by SalE-gal4 generated wing-margin and bris-tle defects (Fig. 3D). This phenotype was enhanced when DTNKS wasknocked-down simultaneously (Fig. 3E). We also found that ectopic ex-pression of DTNKS in thewing significantly rescued the defect caused byoverexpression of Daxin (Fig. 3F). Taken together, these results indicatethat DTNKS regulates Daxin protein levels, and affects wing patterningat a high Daxin protein level.

3.4. DTNKS is required for Daxin degradation, but has no obvious effect onWg signaling

To understand further the function of DTNKS inWg signaling in vivo,we examined Daxin protein levels and expression levels of Wg targetgenes through RNAi-mediated DTNKS knockdown and mosaic clonalanalysis on DTNKS mutant in Drosophila imaginal discs. Consistentwith our results in S2 cells, we found that Daxin protein levels wereincreased in DTNKS mutant cells (Fig. 4A–C). We then monitored Wgtarget genes in the wing imaginal discs, including senseless (sens),Distal-less (Dll), and vestigial (vg). Endogenous Sens protein is expressedin cells receiving high levels of Wg signaling (Fig. 5C). Knocking-downDTNKS in the posterior compartment of the wing imaginal discs byen-gal4 did not affect sens expression, when compared to control discs(Fig. 5C and D). Dll and Vg are expressed in cells receiving both highand low levels of Wg signaling (Fig. 5A-A'''). Knocking down DTNKSalso had no effect on their expression, when compared to control discs(Fig. 5A-A''' and B-B''').

Similar to the observations by shRNA-mediated DTNKS knockdown,the expression of endogenous sens,Dll, and vgwasnot affected inDTNKSmutant clone cells (Fig. 5E-F'). We also examined the role of DTNKS inthe eye disc, another organ system in Drosophila where Wg signaling

in DTNKSmutant cells. (A) The absence of GFP signals labeled the DTNKSmutant cells. (B)

Fig. 5. Expression ofWg target gene is not affected inDTNKSmutant. All wing imaginal discs are oriented dorsal top-left and posterior top-right. (A–D') Thewing imaginal discs expressedUAS-GFP alone or together with DTNKS shRNA by en-gal4. The target gene expression regionwas labeled by GFP signals. (A–A‴) The expression pattern of Vg (A′) and Dll (A″) in thewingimaginal discs. (B–B‴) The expression of Vg (B′) and Dll (B″) was not affectedwhenDTNKSwas knocked-downbyRNAi in the posterior compartment. (C–C′) Expression pattern of Sens inwild-type wing imaginal discs. (D–D′) Expression level of Sens was not affected when DTNKS was knocked-down by RNAi in the posterior compartment. (E–E‴) The wing imaginal disccontainingDTNKSmutant cells was stained by anti-Vg (E′) and anti-Dll (E″) antibodies. The absence of GFP signals labeled themutant cells. Expression level of Vg and Dll was not affectedinmutant cells. (F–F′) The wing imaginal disc containingDTNKSmutant cells was stained by anti-Sens antibody. Expression level of Sens was not affected inmutant cells. (G–G′) The eyeimaginal disc containing DTNKS mutant cells was stained by anti-Eya antibody. Expression of Eya was not affected in DTNKS mutant cells.

1722 Y. Feng et al. / Cellular Signalling 26 (2014) 1717–1724

1723Y. Feng et al. / Cellular Signalling 26 (2014) 1717–1724

plays pivotal roles. In the eye imaginal disc, Wg signaling functions torestrict the area of the eye field, which is dependent upon the activitiesof various transcription factors, including eyeless (eye), eyes absent(eya), sine oculis (so), and dachshund (dac) [39–44]. However, the ex-pression of eya, an eye specification gene regulated by Wg signaling[44], was not affected in the absence ofDTNKS (Fig. 5G). Taken together,these results suggest that DTNKS regulates Daxin protein levels, but hasno obvious function for Wg signaling in Drosophila wing and eye discsunder normal conditions.

3.5. DTNKS regulates the expression ofWg target genes at a high Daxin pro-tein level

As DTNKS regulated Daxin protein levels and affected wing pattern-ing at a high Daxin protein level, we speculated that the regulation ofWg target genes by DTNKS also depended on the concentration ofDaxin. To test this hypothesis, we examined the expression of Dll andvg in wing discs in which Daxin was ectopically expressed. As expected,we found that the expression of Dll and vg was decreased when Daxinwas expressed by Sal-gal4 in the wing imaginal discs (Fig. 6A-A''). Thisreductionwas dramatically enhancedwhen DTNKSwas simultaneouslyknocked-down in the wing imaginal discs (Fig. 6B-B''). Taken together,these data suggest that DTNKS regulates Wg signaling depending onthe concentration of Daxin.

4. Discussion

4.1. The conserved role of DTNKS in the regulation of Daxin degradation

Wg/Wnt signaling is a conserved signaling pathway and plays im-portant roles during many developmental processes and homeostasis.A tight regulation on the concentration of Axin is critical for Wg signal-ing transduction [14]. Although previous studies have demonstrated arole for TNKS in the regulation of Axin levels and Wnt signaling in

Fig. 6. Loss of DTNKS suppressesWg signaling at a high level of Daxin. (A–B″) Thewing imaginatarget gene expression regionwas labeled by immunostaining of Daxin (green). (A–A″) Ectopicinal discs. (B–B″) The wing imaginal discs expressing UAS-Daxin with DTNKS shRNA by SalE-g

human cells, its functions during development remain largely un-known. By generating Drosophila tankyrase (DTNKS) mutant, we dem-onstrated a role for DTNKS in the regulation of Daxin levels duringimaginal disc development (Fig. 4A–C). In addition, we also show thatDTNKS physically interacts with Daxin and regulates protein levels ofDaxin in S2 cells (Fig. 2A, C). These results indicate that the function ofTNKS in regulating Axin protein levels is conserved among differentspecies [31].

Surprisingly, we found that Daxin was also involved in the regula-tion of DTNKS protein levels (Fig. 2D). Coexpression of Daxin candramatically reduce protein levels of DTNKS (Fig. 2D). With increasingamounts of Daxin, this effect on DTNKS was enhanced. Daxin is a scaf-fold protein without any known catalytic activity. Thus, we speculatethat Daxin mediates degradation of DTNKS by recruiting other compo-nents and forming a destruction complex for DTNKS. A preview studysuggests that RNF146, one of the E3 ligases, forms a complex withAxin and TNKS and regulates the degradation of both Axin and TNKSin human cells [45,46]. Therefore, we propose that degradation ofDTNKS by Daxin may depend on the Drosophila RNF146-mediatedubiquitination pathway. Since endogenous levels of Daxin are low, theincreased levels of Daxin may recruit more RNF146 and promoteDTNKS degradation in S2 cells.

4.2. The role of DTNKS in Wg signaling

Our genetic studies showed that depletion of DTNKS has no obviouseffect on wing patterning (Fig. 3C) or expression of Wg target genes(Fig. 5A–G′), suggesting the limited function of DTNKS forWg signalingunder normal developmental conditions. However, the luciferase assayshowed that knock-down of DTNKS by shRNA, or suppression of DTNKSactivity by XAV939 significantly reducesWg reporter activity in S2 cells(Fig. 3A–B). Consistent with this finding, knock-down of DTNKS causeddramatic defects inwing patterning (Fig. 3E) and reduction ofWg targetgene expression under a genetic background with a high Daxin protein

l discs expressed UAS-Daxin alone (A) or together with DTNKS shRNA (B) by SalE-gal4. Theexpression of Daxin by SalE-gal4 caused reduction of Dll (A′) and Vg (A″) in thewing imag-al4 display further reduction of Dll (B′) and Vg (B″).

1724 Y. Feng et al. / Cellular Signalling 26 (2014) 1717–1724

level (Fig. 6B–B″), indicating that DTNKS can regulate Wg signalingunder certain conditions. A previous study showed that tubulinpromoter-driven Daxin protein level was expressed ~4.3 fold higherthan that of endogenous Daxin, and caused no obvious defect duringwing patterning [47]. According to this result, a potential explanationfor our findings is that the increase of Daxin caused by depletion ofDTNKS is within the physiological range required for normal develop-ment, and is not enough to disrupt Wg signaling. Thus, we speculatethat DTNKS plays important roles in Wg signaling in certain situationswhere Daxin protein levels reach a certain threshold.

4.3. The role of DTNKS in other developmental and cellular processes

A critical function of human tankyrase (hTNKS) is the maintenanceof telomere length. In human telomerase-positive cells, overexpressionof hTNKS protects the telomere from degradation. hTNKS removesTRF1, a negative regulator of telomere length maintenance, fromthe telomere and subsequently triggers its ubiquitination and degra-dation [16,20,23,48,49]. However, knocking out mouse TNKS1 orTNKS2 showed no effect on telomere length maintenance [22,33,34].Moreover, mouse TRF1 lacks a tankyrase binding consensus motif,RXXG/PDG, that is shared by all TNKS partners, and does not interactwith mouse TNKS [15,50–52]. As a result, TNKS does not removemouse TRF1 from the telomere, or maintain the telomere length inmouse. Therefore, the function of TNKS on telomere length mainte-nance is not conserved between human and mouse. We propose thatDTNKS is unlikely to be involved in regulation of Drosophila telomerelength. This hypothesis is supported by two pieces of evidence. First,TRF1, the negative regulator of telomere length maintenance, is not aconserved protein between human andDrosophila.We failed to identifya TRF1 homologue in Drosophila. Secondly, the structure of telomereand the maintenance of telomere length are different between humanandDrosophila. In humans, telomeres are composed of TTAGGG tandemrepeat sequences. The maintenance of telomere length requirestelomerase. Drosophila lacks telomerase and the maintenance oftelomere length depends on transposition of three specialized retro-transposons TART, HeT-A, and TAHRE, rather than telomerase activi-ty [53]. Previous study showed that the regulation of telomeres byTNKS only occurred in telomerase-positive cells [49], indicatingthat the regulation of telomere by TNKS requires telomerase activity.Therefore, we speculate that the function of TNKS in telomere lengthmaintenance is not conserved in Drosophila.

Conflict of interest statement

The authors declared no conflict of interest.

Acknowledgments

We thank Y. Lin for fly injection assistance, Developmental StudiesHybridoma Bank (DSHB) for the antibodies and Bloomington StockCenter for stocks. We thank the TRiP at Harvard Medical School(NIH/NIGMS R01-GM084947) for providing the pWALIUM20 vector.We gratefully acknowledge the comments on the manuscript byDr T.Y. Belenkaya. This work is supported by grants from the NationalBasic Research Program of China (2011CB943901 and 2011CB943802),the National Natural Science Foundation of China (31030049), the Re-search Foundation for Advanced Talents ofWenzhouMedical Univer-sity (QTJ08012), the Wenzhou Medical University research grant(XNK07005), the Programme of Introducing Talents of Discipline toUniversities (no. B06016) and the NIH grants (2R01 GM063891).

References

[1] M.L. Johnson, N. Rajamannan, Rev. Endocr. Metab. Disord. 7 (2006) 41–49.[2] H. Clevers, Cell 127 (2006) 469–480.[3] H. Clevers, R. Nusse, Cell 149 (2012) 1192–1205.[4] D. Kimelman, W. Xu, Oncogene 25 (2006) 7482–7491.[5] T. Nakamura, F. Hamada, T. Ishidate, K. Anai, K. Kawahara, K. Toyoshima, T. Akiyama,

Genes Cells 3 (1998) 395–403.[6] S. Kishida, H. Yamamoto, S. Ikeda, M. Kishida, I. Sakamoto, S. Koyama, A. Kikuchi, J.

Biol. Chem. 273 (1998) 10823–10826.[7] M.J. Hart, R. de los Santos, I.N. Albert, B. Rubinfeld, P. Polakis, Curr. Biol. 8 (1998)

573–581.[8] S. Ikeda, S. Kishida, H. Yamamoto, H. Murai, S. Koyama, A. Kikuchi, EMBO J. 17

(1998) 1371–1384.[9] S. Yanagawa, Y. Matsuda, J.S. Lee, H. Matsubayashi, S. Sese, T. Kadowaki, A. Ishimoto,

EMBO J. 21 (2002) 1733–1742.[10] C. Liu, Y. Li, M. Semenov, C. Han, G.H. Baeg, Y. Tan, Z. Zhang, X. Lin, X. He, Cell 108

(2002) 837–847.[11] C. Yost, M. Torres, J.R. Miller, E. Huang, D. Kimelman, R.T. Moon, Genes Dev. 10

(1996) 1443–1454.[12] H. Aberle, A. Bauer, J. Stappert, A. Kispert, R. Kemler, EMBO J. 16 (1997) 3797–3804.[13] L. Zeng, F. Fagotto, T. Zhang, W. Hsu, T.J. Vasicek, W.L. Perry III, J.J. Lee, S.M. Tilghman,

B.M. Gumbiner, F. Costantini, Cell 90 (1997) 181–192.[14] E. Lee, A. Salic, R. Kruger, R. Heinrich, M.W. Kirschner, PLoS Biol. 1 (2003) E10.[15] S.J. Hsiao, S. Smith, Biochimie 90 (2008) 83–92.[16] S. Smith, I. Giriat, A. Schmitt, T. de Lange, Science 282 (1998) 1484–1487.[17] R.J. Lyons, R. Deane, D.K. Lynch, Z.S. Ye, G.M. Sanderson, H.J. Eyre, G.R. Sutherland, R.

J. Daly, J. Biol. Chem. 276 (2001) 17172–17180.[18] P.G. Kaminker, S.H. Kim, R.D. Taylor, Y. Zebarjadian, W.D. Funk, G.B. Morin, P.

Yaswen, J. Campisi, J. Biol. Chem. 276 (2001) 35891–35899.[19] B. van Steensel, T. de Lange, Nature 385 (1997) 740–743.[20] S. Smith, T. de Lange, Curr. Biol. 10 (2000) 1299–1302.[21] J.I. Sbodio, H.F. Lodish, N.W. Chi, Biochem. J. 361 (2002) 451–459.[22] S.J. Hsiao, M.F. Poitras, B.D. Cook, Y. Liu, S. Smith, Mol. Cell. Biol. 26 (2006) 2044–2054.[23] W. Chang, J.N. Dynek, S. Smith, Genes Dev. 17 (2003) 1328–1333.[24] N.W. Chi, H.F. Lodish, J. Biol. Chem. 275 (2000) 38437–38444.[25] T.Y. Yeh, J.I. Sbodio, Z.Y. Tsun, B. Luo, N.W. Chi, Biochem. J. 402 (2007) 279–290.[26] H.L. Guo, C. Zhang, Q. Liu, Q. Li, G. Lian, D.Wu, X. Li, W. Zhang, Y. Shen, Z. Ye, S.Y. Lin,

S.C. Lin, Cell Res. 22 (2012) 1246–1257.[27] P. Chang, M. Coughlin, T.J. Mitchison, Nat. Cell Biol. 7 (2005) 1133–1139.[28] J.N. Dynek, S. Smith, Science 304 (2004) 97–100.[29] Y. Ozaki, H. Matsui, H. Asou, A. Nagamachi, D. Aki, H. Honda, S. Yasunaga, Y.

Takihara, T. Yamamoto, S. Izumi, M. Ohsugi, T. Inaba, Mol. Cell 47 (2012) 694–706.[30] M.K. Kim, C. Dudognon, S. Smith, EMBO Rep. 13 (2012) 724–732.[31] S.M. Huang, Y.M. Mishina, S. Liu, A. Cheung, F. Stegmeier, G.A. Michaud, O. Charlat, E.

Wiellette, Y. Zhang, S. Wiessner, M. Hild, X. Shi, C.J. Wilson, C. Mickanin, V. Myer, A.Fazal, R. Tomlinson, F. Serluca, W. Shao, H. Cheng, M. Shultz, C. Rau, M. Schirle, J.Schlegl, S. Ghidelli, S. Fawell, C. Lu, D. Curtis, M.W. Kirschner, C. Lengauer, P.M.Finan, J.A. Tallarico, T. Bouwmeester, J.A. Porter, A. Bauer, F. Cong, Nature 461(2009) 614–620.

[32] P.F. Cho-Park, H. Steller, Cell 153 (2013) 614–627.[33] Y.J. Chiang, S.J. Hsiao, D. Yver, S.W. Cushman, L. Tessarollo, S. Smith, R.J. Hodes, PLoS

One 3 (2008) e2639.[34] Y.J. Chiang, M.L. Nguyen, S. Gurunathan, P. Kaminker, L. Tessarollo, J. Campisi, R.J.

Hodes, Mol. Cell. Biol. 26 (2006) 2037–2043.[35] K. Willert, C.Y. Logan, A. Arora, M. Fish, R. Nusse, Development 126 (1999)

4165–4173.[36] F. Hamada, Y. Tomoyasu, Y. Takatsu, M. Nakamura, S. Nagai, A. Suzuki, F. Fujita, H.

Shibuya, K. Toyoshima, N. Ueno, T. Akiyama, Science 283 (1999) 1739–1742.[37] S. Baig-Lewis, W. Peterson-Nedry, M. Wehrli, Dev. Biol. 306 (2007) 94–111.[38] K.M. Cadigan, M.P. Fish, E.J. Rulifson, R. Nusse, Cell 93 (1998) 767–777.[39] J. Curtiss, M. Mlodzik, Development 127 (2000) 1325–1336.[40] G. Halder, P. Callaerts, S. Flister, U. Walldorf, U. Kloter, W.J. Gehring, Development

125 (1998) 2181–2191.[41] G. Halder, P. Callaerts, W.J. Gehring, Science 267 (1995) 1788–1792.[42] F. Pignoni, S.L. Zipursky, Development 124 (1997) 271–278.[43] J.D. Lee, J.E. Treisman, Development 128 (2001) 1519–1529.[44] A. Baonza, M. Freeman, Development 129 (2002) 5313–5322.[45] M.G. Callow, H. Tran, L. Phu, T. Lau, J. Lee, W.N. Sandoval, P.S. Liu, S. Bheddah, J. Tao, J.R.

Lill, J.A.Hongo,D.Davis, D.S. Kirkpatrick, P. Polakis,M. Costa, PLoSOne6 (2011) e22595.[46] Y. Zhang, S. Liu, C. Mickanin, Y. Feng, O. Charlat, G.A. Michaud, M. Schirle, X. Shi, M.

Hild, A. Bauer, V.E. Myer, P.M. Finan, J.A. Porter, S.M. Huang, F. Cong, Nat. Cell Biol. 13(2011) 623–629.

[47] W. Peterson-Nedry, N. Erdeniz, S. Kremer, J. Yu, S. Baig-Lewis, M. Wehrli, Dev. Biol.320 (2008) 226–241.

[48] J.F. Rippmann, K. Damm, A. Schnapp, J. Mol. Biol. 323 (2002) 217–224.[49] B.D. Cook, J.N. Dynek, W. Chang, G. Shostak, S. Smith, Mol. Cell. Biol. 22 (2002)

332–342.[50] J.I. Sbodio, N.W. Chi, J. Biol. Chem. 277 (2002) 31887–31892.[51] Y. Muramatsu, T. Ohishi, M. Sakamoto, T. Tsuruo, H. Seimiya, Cancer Sci. 98 (2007)

850–857.[52] J.R. Donigian, T. de Lange, J. Biol. Chem. 282 (2007) 22662–22667.[53] G.D. Raffa, G. Cenci, L. Ciapponi, M. Gatti, Front Oncol. 3 (2013) 112.