the rna binding protein csra is a pleiotropic regulator of ... · csra, have a putative csra...

INFECTION AND IMMUNITY, Sept. 2009, p. 3552–3568 Vol. 77, No. 90019-9567/09/$08.00�0 doi:10.1128/IAI.00418-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

The RNA Binding Protein CsrA Is a Pleiotropic Regulator of theLocus of Enterocyte Effacement Pathogenicity Island of

Enteropathogenic Escherichia coli�

Shantanu Bhatt,1,2 Adrianne Nehrling Edwards,2 Hang Thi Thu Nguyen,3 Didier Merlin,3Tony Romeo,2,4 and Daniel Kalman1,2*

Department of Pathology and Laboratory Medicine, Emory University, Atlanta, Georgia 303221; Microbiology andMolecular Genetics Program, Emory University, Atlanta, Georgia 303222; Department of Medicine, Division of

Digestive Diseases, Emory University School of Medicine, Atlanta, Georgia 303223; and Department ofMicrobiology and Cell Science, P.O. Box 110700, University of Florida, Gainesville, Florida 32611-07004

Received 15 April 2009/Returned for modification 22 May 2009/Accepted 26 June 2009

The attaching and effacing (A/E) pathogen enteropathogenic Escherichia coli (EPEC) forms characteristicactin-filled membranous protrusions upon infection of host cells termed pedestals. Here we examine the roleof the RNA binding protein CsrA in the expression of virulence genes and proteins that are necessary forpedestal formation. The csrA mutant was defective in forming actin pedestals on epithelial cells and indisrupting transepithelial resistance across polarized epithelial cells. Consistent with reduced pedestal for-mation, secretion of the translocators EspA, EspB, and EspD and the effector Tir was substantially reduced inthe csrA mutant. Purified CsrA specifically bound to the sepL espADB mRNA leader, and the correspondingtranscript levels were reduced in the csrA mutant. In contrast, Tir synthesis was unaffected in the csrA mutant.Reduced secretion of Tir appeared to be in part due to decreased synthesis of EscD, an inner membranearchitectural protein of the type III secretion system (TTSS) and EscF, a protein that forms the protrudingneedle complex of the TTSS. These effects were not mediated through the locus of enterocyte effacement (LEE)transcriptional regulator GrlA or Ler. In contrast to the csrA mutant, multicopy expression of csrA repressedtranscription from LEE1, grlRA, LEE2, LEE5, escD, and LEE4, an effect mediated by GrlA and Ler. Consistentwith its role in other organisms, CsrA also regulated flagellar motility and glycogen levels. Our findings suggestthat CsrA governs virulence factor expression in an A/E pathogen by regulating mRNAs encoding transloca-tors, effectors, or transcription factors.

Enteropathogenic Escherichia coli (EPEC) is a major etio-logic agent of infantile diarrhea in developing countries, caus-ing the deaths of several hundred thousand children per year(13, 71). EPEC and the related bacterium enterohemorrhagicE. coli (EHEC) cause attaching and effacing (A/E) lesions thatare characterized by disruption of the intestinal microvilli andreorganization of the cytoskeleton in infected cells to formactin-filled membrane protrusions, termed “pedestals,” thatemanate beneath bacteria attached to the cell surface (48, 69).

The locus of enterocyte effacement (LEE) of EPEC is apathogenicity island that is necessary and sufficient for theformation of pedestals (63). It consists of five major polycis-tronic operons, including LEE1, LEE2, LEE3, LEE5, andLEE4; the bicistronic operon grlRA; and several monocistronicgenes (21, 26, 67). The LEE1, LEE2, and LEE3 operons en-code the architectural components of a type III secretion sys-tem (TTSS), whereas LEE4 encodes the translocator exporterSepL; the secreted translocators EspA, EspB, and EspD; thechaperones CesD2 and L0017; the needle complex-formingcomponent of the TTSS EscF; and the effector protein EspF.SepL, along with SepD, forms a molecular switch that coordi-nates the hierarchical secretion of EspA, EspB, and EspD over

effectors in response to calcium and other environmental sig-nals (20, 22). EspA is secreted to form a hollow filamentousorganelle that connects the protruding EscF needle of thebacterial TTSS to the host cell membrane (17, 50, 82). EspBand EspD are translocated through this filamentous TTSS andintegrated into the host cell membrane, where they form apore that allows effector molecules to be injected directly intothe host cytosol (39, 96). The LEE5 operon encodes the effec-tor Tir, its ligand, the adhesin intimin, and the Tir chaperoneCesT (67). Tir is translocated into the host cytosol via theTTSS and subsequently integrated into the host cell mem-brane, where it serves as a receptor for intimin, which ispresent on the outer bacterial membrane (44). The interactionof Tir and intimin results in firm attachment of the bacte-rium to the infected cell. Tir recruits cellular factors, such astyrosine kinases, Nck, and N-WASP, that activate theArp2/3 complex and initiate actin polymerization beneaththe attached bacteria (9, 32, 42, 93), culminating with theformation of pedestals.

Coordinated spatiotemporal expression from the LEE iscritical for pedestal formation by EPEC. Such a mode of reg-ulation is achieved by the presence of a plethora of transcrip-tion factors such as Ler, PerC, GrlA, GrlR, QseA, IHF, Fis,and H-NS (21, 29, 30, 67, 83, 94) in response to diverse envi-ronmental conditions, including pH, osmolarity, Fe(NO3)3,Ca2�, temperature, quorum sensing, and HCO3

� (1, 43, 85–90,94). Most of these transcription factors affect the expression

* Corresponding author. Mailing address: Department of Pathology,615 Michael St., Atlanta, GA 30322. Phone: (404) 712-2326. Fax: (404)712-2979. E-mail: [email protected].

� Published ahead of print on 6 July 2009.

3552

on Decem

ber 2, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

from the LEE by activating the transcription of ler, which inturn activates transcription from grlRA, LEE2, LEE3, LEE5,escD, and LEE4 (see Fig. 9) (7, 11, 21, 26, 35, 65, 67).

Whereas our understanding of the mechanisms of transcrip-tional regulation of the LEE is extensive, information aboutposttranscriptional and posttranslational regulation is morelimited. Posttranscriptional control has been suggested in thenegative regulation of espADB mRNA in EHEC strains thatsecrete high levels of EspA. However, the mechanistic basis forthis phenomenon has not been established (78). In terms ofposttranscriptional and posttranslational regulation, the de-tailed molecular mechanisms for only the endoribonucleaseRNase E (60) and the protease ClpXP have been elucidated(40). Whereas in EHEC RNase E generates the sepL andespADB transcripts by splicing at the C-terminal end of sepL inthe precursor sepL espADB transcript (60), the protease ClpXPpositively regulates the LEE posttranslationally by affectingthe expression of RpoS and GrlR (40). The ribosome bindingGTPase BipA and the noncoding RNA DsrA have also beenshown to upregulate the expression of the LEE in EPEC andEHEC, respectively, although the detailed molecular mechanismsinvolved in this regulation have yet to be elucidated (31, 53).

We have identified csrA as a posttranscriptional regulator ofEPEC necessary for paralyzing and killing the nematodeCaenorhabditis elegans (S. Bhatt and D. Kalman, unpublisheddata). Previous studies have demonstrated that genes involved innematode pathogenesis may also facilitate pedestal formation onmammalian cells (3, 66). This latter observation prompted us toinvestigate the possible role of csrA in mammalian pathogenesis.

CsrA and its orthologue RsmA are homodimeric RNA bind-ing proteins (4, 33, 36, 59, 77) that regulate gene expressionposttranscriptionally by binding to sites containing the AGGA/ANGGA motif in the leader segment of transcripts and alter-ing their stability and/or translation (5, 6, 23, 59, 62, 97, 98).Transcripts such as flhDC, whose expression is activated byCsrA, have a putative CsrA binding site(s) located distantlyfrom the Shine-Dalgarno sequence. Binding of CsrA enhancestheir stability and leads to an increase in the steady-state levelsof such transcripts (79, 98). For transcripts that are negativelyregulated, CsrA binds to sequences that overlap or lie in closeproximity to the Shine-Dalgarno sequence, thereby preventingthe 30S ribosomal subunit from binding to the transcript andinhibiting translation and/or facilitating mRNA decay (5, 6,24, 97).

The carbon storage regulation (Csr) system also includes thenoncoding small RNAs CsrB and CsrC, which bind tightly toand sequester 9-10 and 4-5 CsrA dimers, respectively, therebypreventing CsrA from exerting its effect on the mRNAs in itsregulon (58, 99). The expression of CsrB and CsrC is activatedby CsrA through the BarA-UvrY two-component regulatorysystem (74, 92, 99). The last component of the Csr system isCsrD, a protein containing vestigial GGDEF and EAL do-mains, which targets CsrB and CsrC for degradation by theendoribonuclease RNase E, thereby increasing intracellularCsrA activity (91). These negative feedback loops of the Csrsystem demonstrate that CsrA activity is finely tuned and sug-gest that the Csr system functions as a homeostatic circuit (91,92). The role of CsrA and RsmA in regulating virulence factorsand host interactions of mammalian and plant pathogens iswell established in Salmonella enterica serovar Typhimurium,

Erwinia carotovora, Pseudomonas aeruginosa, Helicobacter py-lori, Legionella pneumophila, and Yersinia pseudotuberculosis(2, 8, 10, 16, 27, 37, 47, 56, 75).

In this report, we provide evidence that in EPEC, a func-tional csrA allele is necessary for the formation of pedestalsand for membrane depolarization of epithelial cells. CsrA ex-erts its effect by binding to the leader segment of the sepLespADB mRNA and enhancing the steady-state transcript andprotein levels. In contrast to the csrA mutant phenotype, mod-est overexpression of csrA globally repressed transcriptionfrom the LEE operons by binding to and repressing the ex-pression of the global regulator of the LEE activator GrlA.Furthermore, we also provide evidence that CsrA-mediatedeffects appear through at least one other regulatory factor.Lastly, we show that csrA also regulates other virulence-asso-ciated traits such as motility and glycogen biosynthesis. Ourresults extend the role of csrA as a regulator of virulence of theLEE genes of EPEC and likely other A/E pathogens, whichalso possess highly conserved csrA orthologs and putative CsrAbinding sites in the leader segment of LEE genes.

MATERIALS AND METHODS

Bacterial strains, plasmids, primers, and media. Bacteria were grown inLuria-Bertani (LB) broth or Dulbecco modified Eagle medium (DMEM) con-taining phenol red (for immunofluorescence microscopy) or lacking glutamineand phenol red (for Western blotting and real-time quantitative reverse tran-scription [qRT]-PCR) with appropriate antibiotic supplements when needed.The antibiotics used were streptomycin (100 �g/ml), chloramphenicol (25 or 50�g/ml), kanamycin (50 �g/ml), tetracycline (15 �g/ml), and ampicillin (50 or 100�g/ml).

To determine growth rates, bacterial cultures were grown overnight at 37°C at250 rpm in LB broth or in LB broth supplemented with the appropriate antibi-otic. Overnight cultures were diluted to a starting optical density (OD) of ap-proximately 0.01 in DMEM containing glucose (4.5 g/liter) but lacking phenolred and glutamine. The cultures were grown standing at 37°C in a 5% CO2

incubator, and growth was measured every hour and intermittently at half-hourintervals over a period of 24 h. The growth curve of each strain was determinedat least twice with different experimental samples by assaying each sample induplicate. Growth curves are representative of one such experiment. The strains,plasmids, and oligonucleotides used are listed in Tables 1 and 2.

csrA was disrupted by the one-step gene inactivation method described byDatsenko and Wanner and modified for EPEC by Murphy and Campellone (18,70). Briefly, plasmid pKD3 was used as the template to amplify a chloramphen-icol (cat) resistance cassette flanked on its 5� side with 51 nucleotides (101 to 151nucleotides downstream of the translation initiation codon of the csrA openreading frame [ORF]) and on its 3� side with 49 nucleotides (152 to 186 nucle-otides downstream of the translation initiation codon of the csrA ORF and 14nucleotides downstream of the translation termination codon) by using primers5�csrAP2(Wanner) and 3�csrAP1(Wanner). The PCR product was gel purified,and 250 to 500 ng of the product was electroporated into EPEC expressing thelambda red recombinase proteins Gam, Exo, and Bet from plasmid pTP223under the control of an isopropyl-�-D-thiogalactopyranoside (IPTG)-induciblepromoter (76). Expression of the lambda red recombinase system promotes thesite-specific substitution of the wild-type csrA allele with the mutant csrA::Cmr

PCR product because of the presence of identical flanking sequences in the PCRproduct. Recombinants were selected on LB broth plates containing chloram-phenicol. grlA was tagged in the chromosome with a 3XFLAG tag in a similarmanner by using pKD4 as the template (40, 70, 95). The csrA disruption wasverified by locus-specific PCR with primer pair 5�csrA and c2 or 3�csrA(EPEC)and c1, whereas grlA tagging was verified by using the primer pair 5�grlA(qRT-PCR) and k1 (18). PCR products of the expected size were generated andverified by sequencing.

Construction of pCRA16 has been described previously (91). Briefly, aBamHI-EcoRI fragment of approximately 500 bp containing the K-12 csrA geneunder the control of its putative promoter(s) was restricted from pCSR10 (80),end filled with the Klenow fragment of DNA polymerase I, and cloned into theblunt VspI site of the bla gene of pBR322 to generate pCRA16. The csrA ORFis oriented in the same direction as the bla gene (91).

VOL. 77, 2009 csrA REGULATES EPEC PATHOGENESIS 3553

on Decem


.org/D

ownloaded from

http://iai.asm.org/

EPEC csrA lacZ csrA� is the csrA disruptant expressing the wild-type csrAallele under the control of its putative promoter(s). csrA was amplified fromEPEC by colony PCR with primers 5�csrA-EcoRV and 3�csrA-EcoRV. The685-bp PCR product contains the intergenic sequence spanning the region fromthe last 11 nucleotides of the csrA upstream gene alaS to the �35 region of thecsrA downstream gene serV and includes csrA under the control of its native cisregulatory elements (as determined by qRT-PCR and Western blotting forLEE-encoding genes regulated by CsrA). The PCR product was gel purified,treated with EcoRV, and cloned into the EcoRV site of the lacZ gene in plasmidpJRlacZins (51) to generate pJRcsrA6. The cloned csrA gene is oriented oppo-site to the direction of transcription of the lacZ gene. The csrA sequence inpJRcsrA6 was verified by sequencing with the same set of primers. pJRcsrA6contains the R6K� origin of replication and can only replicate in � protein-expressing strains such as S17-1�pir (84). This plasmid was transferred into thecsrA mutant of EPEC by conjugation as described previously (51). Integrantswere selected by plating dilutions onto LB broth plates supplemented withchloramphenicol, ampicillin, 5-bromo-4-chloro-3-indolyl-�-D-galactopyranoside(X-Gal; 40 �g/ml), and IPTG (5 mM) and incubated overnight at 37°C.Transconjugants that arose on these plates were confirmed to be EPEC deriva-tives and contained both the wild-type and csrA mutant alleles. One such colonywas selectively purified, and serial dilutions were plated onto LB broth platesdevoid of NaCl but supplemented with 5% sucrose to counterselect for loss ofthe sacB gene carried on the plasmid backbone. One such colony that arose wasconfirmed to be ampicillin sensitive, chloramphenicol resistant, sucrose resistant(sacB mutant), and white when plated onto LB broth plates containing X-Galand IPTG (lacZ mutant) and contained both the wild-type and mutant csrAalleles as determined by PCR and was used for all subsequent experiments.

Cell culture and immunofluorescence microscopy. 3T3 cells were maintainedand passaged under standard culture conditions in DMEM supplemented with10% fetal bovine serum and penicillin and streptomycin. Pedestal formation byEPEC and its isogenic derivatives on 3T3 cells was performed as describedpreviously (3).

Preparation of cell lysates, trichloroacetic acid precipitation, and Westernblotting. Synthesis of EspA and Tir and secretion of EspA, EspB, EspD, and Tirwere analyzed by Western blotting. Bacterial cultures were grown under standingconditions at 37°C in a 5% CO2 incubator to an OD of 0.2 to 0.3, 0.5, or 1.0 andpelleted by centrifugation at 3,000 rpm. The proteins in the supernatant wereprecipitated at �20°C by the addition of trichloroacetic acid to a final concen-

tration of 10%. The precipitated proteins were pelleted and washed with acetoneand centrifuged. The pellets were air dried to ensure complete evaporation ofthe acetone prior to suspending them in 100 �l of a 1:1 volumetric ratio of 2Laemmli buffer containing ß-mercaptoethanol (54) and 1 M Tris-HCl (pH6.8). The suspensions were boiled for 10 min prior to 12% sodium dodecylsulfate (SDS)-polyacrylamide gel electrophoresis. To ensure equal loading,the volume of the sample loaded was normalized to the OD of the cultureswhen harvested.

To determine protein levels in the cell lysate, the cell pellets were suspendedin 200 �l of 50 mM Tris-HCl (pH 7.5) and sonicated to disrupt the cellmembrane. Cell debris was pelleted by centrifugation, and the supernatant wastransferred to a fresh Eppendorf tube. Protein concentrations were determinedby the Lowry assay (61) as recommended by the manufacturer (Bio-Rad), afterwhich the lysates were mixed with an equal volume of 2 Laemmli buffercontaining ß-mercaptoethanol. The lysates were boiled at 95°C for 10 min. Equalamounts of protein were subjected to 12% SDS-polyacrylamide gel electrophore-sis. Proteins were electroblotted onto a polyvinylidene difluoride membrane andprobed with one of the following antibodies: mouse monoclonal anti-FLAG M2(F-3165; 10 �g/ml), rabbit anti-Ler (1:2500), rabbit anti-EspA (1:50,000), rabbitanti-EspB (1:10,000), rat anti-EspD (1:500), or rabbit anti-Tir (1:50,000). Theanti-FLAG antibody was purchased from Sigma. Each experiment was repeatedat least three times with similar results each time.

RNA isolation. RNA isolation was performed by using the MasterPure RNApurification kit from EPICENTRE as recommended by the manufacturer,with the exception that the DNase I treatment was performed for 45 min andthen an additional 5 �l of DNase I was added to the samples and the reactionwas allowed to continue for another 45 min prior to inactivation of the DNaseI. The DNase I-treated RNA was subjected to phenol-chloroform extraction,followed by isopropanol precipitation, and the procedure was repeated. Pre-cipitated RNA was resuspended in 50 �l of TE buffer (10 mM Tris-HCl [pH7.8],1 mM EDTA), and 1 �l of ScriptGuard RNase inhibitor was added to theRNA samples.

Real-time qRT-PCR. The iScript One-Step real-time qRT-PCR kit with SYBRgreen (Bio-Rad) was used to determine the transcript levels of genes as recom-mended by the manufacturer, with some modifications. Each reaction mixturehad a total volume of 25 �l. The reaction mixture consisted of 1 SYBR greenRT-PCR mix (12.5 �l of 2 reaction buffer containing 0.4 mM dATP, dCTP,dGTP, and dTTP; magnesium ions; iTaq DNA polymerase, 20 nM fluorescein;

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Relevant genotypea Reference or source

StrainsEPEC Wild-type EPEC 2348/69 serotype O127:H6 Strr June ScottEPEC csrA EPEC 2348/69 csrA::Cmr Strr Cmr This studyEPEC csrA lacZ csrA� EPEC 2348/69 csrA::Cmr lacZ::csrA Strr Cmr This studyEPEC grlA 3XFLAG EPEC 2348/69 �(grlA-3XFLAG) Kanr Strr This studyEPEC csrA grlA 3XFLAG EPEC 2348/69 csrA::Cmr �(grlA-3XFLAG) Cmr Kanr Strr This studyEPEC csrA lacZ csrA� grlA

3XFLAGEPEC 2348/69 csrA::Cmr lacZ::csrA �(grlA-3XFLAG) Cmr Kanr Strr This study

EPEC(pBR322) EPEC 2348/69 transformed with empty vector pBR322 Tetr Ampr Strr This studyEPEC(pCRA16) EPEC 2348/69 transformed with pCRA16 Tetr Strr This studyEPEC grlA 3XFLAG(pBR322) EPEC 2348/69 �(grlA-3XFLAG) containing pBR322 Kanr Tetr Ampr Strr This studyEPEC grlA 3XFLAG(pCRA16) EPEC 2348/69 �(grlA-3XFLAG) containing pCRA16 Kanr Tetr Strr This studyEPEC �ler EPEC 2348/69 ler deletion Jay MelliesEPEC �tir EPEC 2348/69 tir deletion B. Brett FinlayEPEC �espA EPEC 2348/69 espA deletion James B. KaperEPEC �espB EPEC 2348/69 espB deletion James B. KaperEPEC �espD EPEC 2348/69 espD deletion James B. KaperS17-1�pir E. coli pir lysogen of S17-1 (thi pro hsdR hsdM� recA RP4-Tc::Mu-Km::Tn7) Tpr Strr Phil RatherDH5 supE44 �lacU169 �80dlacZ�M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Bettina Bommarius

PlasmidspTP223 gam, bet, and exo genes of phage � cloned under control of lac promoter; Tetr Kenan MurphypBR322 Cloning vector; Tetr Ampr 85pCRA16 csrA gene from K-12 cloned into blunt-ended VspI site of bla of pBR322; Tetr 97pJRlacZIns Suicide vector; Amp r Vanessa SperandiopJRcsrA6 csrA gene from EPEC under its regulatory sequences cloned into EcoRV site of

lacZ in pJRLacZIns; Amp rThis study

a Tetr, tetracycline resistance; Cmr, chloramphenicol resistance; Strr, streptomycin resistance; Ampr, ampicillin resistance; Tpr, trimethoprim resistance.

3554 BHATT ET AL. INFECT. IMMUN.

on Decem


.org/D

ownloaded from

http://iai.asm.org/

SYBR green I dye; and stabilizers), a primer pair (0.75 �l at a final concentrationof 300 nM), nuclease-free water, iScript reverse transcriptase (0.5 �l), andDNase I-treated RNA (50 ng). The reaction conditions were (i) 53°C for 20min, (ii) 95°C for 10 min, (iii) 40 cycles of 95°C for 0.5 min and 60°C for 1 min,and (iv) 4°C for �. Melting curve analysis were done to ensure the specificityof the generated product. The melting curve conditions were (i) 95°C for 1min, (ii) 55°C for 1 min, and (iii) 40 cycles of 55°C for 10 s with an incrementof 0.5°C. Control reactions were conducted to ensure the absence of genomic

DNA contamination in purified RNA and that the observed fluorescence wasnot the result of primer dimer formation. Real-time qRT-PCR was per-formed in duplicate or triplicate with multiple experimental samples. Thecycle threshold method 2��Ct was used to quantify the transcript levels afternormalizing them to the housekeeping gene rrsB. The relative transcript levelfor EPEC or EPEC(pBR322) in the first sample of the first experiment wasdefined as 1, and all other values were determined relative to this. Theunpaired Student t test was used to assay for the statistical significance of

TABLE 2. Oligonucleotides used in this study

Primer Sequence

Knockout/cloning primers5�csrAP2(Wanner) ........................................................................................TAAATGCCCCGAAGGAAGTTTCTGTTCACCGTGAAGAGATC

TACCAGCGTACATATGAATATCCTCCTTA3�csrAP1(Wanner) ........................................................................................GAGACGCGGAAAGATTAGTAACTGGACTGCTGGGATTTTTC

AGCCTGGAGTGTAGGCTGGAGCTGCTTCc1a....................................................................................................................TTATACGCAAGGCGACAAGGc2a....................................................................................................................GATCTTCCGTCACAGGTAGGk1a ...................................................................................................................CAGCCGATTGTCTGTTGTGCCC5�csrA..............................................................................................................GGATAATGCCGGGATACAGAGAGAC3�csrA�EPEC� ................................................................................................ATTTTGAGGGTGCGTCTCACCG5�csrA-EcoRV ...............................................................................................GCGGCCGATATCAATTGCAATAATATAAGCGTCAGGCAATGc

3�csrA-EcoRV ...............................................................................................GCGGCCGATATCGTCAAACAATTTTTCCCACACTTTTATCG5�grlA-3XFLAG ............................................................................................TCTAATATCTGGAACGAAATGATCTTGAGGCGGAAAAAGGA

GAGTGACTACAAAGACCATGACGG3�grlA-3XFLAG ............................................................................................GAGAAAAAGGCTTACCCTGGAAAACAAAACCCTTAAATATA

GCTTCATATGAATATCCTCCTTAG

RT-qRT-PCR primers5�rrsB ..............................................................................................................CTTACGACCAGGGCTACACAC3�rrsB ..............................................................................................................CGGACTACGACGCACTTTATG5�ler .................................................................................................................GCAGTTCTACAGCAGGAAGCA3�ler .................................................................................................................CGAGCGAGTCCATCATCAG5�flhD..............................................................................................................TGCATACCTCCGAGTTGCTG3�flhD..............................................................................................................GCGTGTTGAGAGCATGATGC5�tirb ................................................................................................................GCAGAAGACGCTTCTCTGAATA3�tirb ................................................................................................................CCCAACTTCAGCATATGGATTA5�espAb ...........................................................................................................GCTGCAATTCTCATGTTTGC3�espAb ...........................................................................................................GGGCAGTGGTTGACTCCTTA5�grlR..............................................................................................................TTAGCAATGAAGACTCCTGTGG3�grlR..............................................................................................................AGAGAGAACCCCCTGATACAC5�grlA..............................................................................................................AGGCGGTTCCGATAGAAAGT3�grlA..............................................................................................................GCCTCAAGATCATTTCGTTCC5�escJ...............................................................................................................CCAAAGAAATGGACAAAAGTGG3�escJ...............................................................................................................GCTGGGTGGGAAAATAACCT5�sepL .............................................................................................................GAAAGAAGAGGAAGGCACGAC3�sepL .............................................................................................................CAAACATCGCCAAAGTAGGA5�escD .............................................................................................................CACGCCCTATGAAGCAGATAA3�escD .............................................................................................................CAACGCAAAAGTAGCACCAA5�espD.............................................................................................................GCTGCTACGGCTACTTCAGG3�espD.............................................................................................................GCTGTGGTTCTGTTCCCTCT5�espB .............................................................................................................TAGGCTCTTTTGCTGCCATT3�espB .............................................................................................................TTCGCCAGTGCTTTAGTTGA5�escF..............................................................................................................ACAAATGGGTGAAGTAGGTAAAACG3�escF..............................................................................................................GAACCGCAAACTGCAACTCTAAC

In vitro transcription primers5�-T7p-grlR-EPEC ........................................................................................TAATACGACTCACTATAGGGCATTGCAATCTGGAGAAAAAG3�-T7p-grlR-EPEC ........................................................................................CAGTGATCATATTTCCATTTT5�-T7p-escD-EPEC .......................................................................................TAATACGACTCACTATAGGGGATGTAAGTTCACCATATTTT3�-T7p-escD-EPEC .......................................................................................CGGAAGTTGTAATTCCCGATT5�-T7p-sepL-EPEC........................................................................................TAATACGACTCACTATAGGGGTCTAAGAATAGAGTAGAAAG3�-T7p-sepL-EPEC........................................................................................CATTAGCCATTGGAAACTCACphoB-T7 (E. coli K-12).................................................................................TAATACGACTCACTATAGGGGCATTAATGATCGCAACCTATT

TATTACAACAGGGCAAATCATGGCphoB-T7 (E. coli K-12)...........................................................................CATGATTTGCCCTGTTGTAATAAATAGGTTGCGATCATTAAT

GCCCCTATAGTGAGTCGTATTA

a For primers c1, c2, and c3, see reference 18.b For tir- and espA-specific primers, see reference 57.c Underlining indicates restriction sites for EcoRV.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

differences. A P value of �0.01 was considered statistically significant forreal-time qRT-PCR-based analysis.

In vitro transcription and RNA electrophoretic mobility shift assay (EMSA).The MEGAshortscript kit from Ambion was used for in vitro transcription asrecommended by the manufacturer. Briefly, a PCR product containing the T7promoter at its 5� end and the entire leader segment encompassing the putativeCsrA binding sites of grlR, sepL, and escD was generated. Transcripts were runon a 5% polyacrylamide gel, the band corresponding to the correct-size transcriptwas excised, and the gel fragment was suspended in 250 �l of elution buffer (0.5M ammonium acetate, 1 mM EDTA, 0.2% SDS) along with 2 �l of Superase-in(Ambion) and eluted overnight at 4°C and then at room temperature for 30 min.The eluate was subjected to phenol-chloroform extraction and ethanol precipi-tation and suspended in TE (10 mM Tris-HCl [pH 8.0], 1 mM EDTA) buffer.Five hundred nanograms of the RNA was run on a gel to verify the size andintegrity of the RNA. Thirty to 40 pmol of the RNA was dephosphorylated, andthe RNA was purified by another round of phenol-chloroform extractionand ethanol precipitation. The purified RNA was suspended in 10 �l of nuclease-free water. RNA was radioactively labeled and suspended in 10 �l of TE buffer.Because the csrA ORF and the CsrA protein are identical between EPEC andK-12, C-terminally His-tagged CsrA, purified from E. coli K-12, was used for thebinding reactions. Purification of recombinant His-tagged CsrA has been de-scribed elsewhere (68). His-tagged CsrA was suspended in protein dilution buffer(10 mM Tris-HCl [pH 7.5], 2 mM dithiothreitol, 10% glycerol). RNA wasdenatured at 85°C and slowly cooled to 25°C over 25 min in a Bio-Rad ICyclerprior to addition to the binding reaction mixture. The components of the bindingreaction mixture included 50 pM RNA in TE, 1 binding buffer (10 mM Tris-HCl [pH 7.5], 10 mM MgCl2, 100 mM KCl), 3.25 ng/�l total yeast RNA, 20 mMdithiothreitol, 7.5% glycerol, 0.01 �l of Superase-in (Ambion), and 2 �l ofdifferent concentrations of His-tagged CsrA in a total volume of 10 �l. Thereaction mixtures were incubated at 37°C for 30 min, after which the sampleswere loaded onto a 10% native polyacrylamide gel. The gel was exposed to aPhosphorImager plate overnight, and the bands were detected with aPhosphorImager. ImageQuaNT (Molecular Dynamics) was used to perform densi-tometric analysis. The apparent equilibrium dissociation constant (KD) for CsrA wasdetermined from two independent experiments with the equation Y � {Ymax

[(x/KD)n]}/{1 � [(x/KD)n]}. For competition-based gel shift experiments, unlabeledspecific and nonspecific (phoB) transcripts were added at final concentrations of 500pM, 5 nM, and 50 nM, which represent 10-, 100-, and 1,000-fold excesses relative tothe labeled transcript.

Transepithelial resistance (TER) assay. The resistance of cells in response towild-type and mutant EPEC strains was monitored in real time with the electriccell substrate impedance sensing (ECIS) 1600R device (Applied BioPhysics,Troy, NY). Caco2-BBE cells were seeded into ECIS 8W1E electrodes (5 105

cells/400 �l/electrode) and kept at 37°C in 5% CO2 and 90% humidity. When thecells were confluent, they were washed and changed to serum-free, antibiotic-free DMEM. Cell resistance was measured at a frequency of 500 Hz and avoltage of 1 V. Details of the operation, equivalent resistance-capacitance circuit,and modification of the ECIS system can be found in the manufacturer’s instruc-tions. Bacterial strains were grown overnight in LB broth and transferred toserum-free and antibiotic-free DMEM, and confluent Caco2-BBE monolayerswere infected at a multiplicity of infection of 10. TER was measured continuouslypostinfection. TER assays were conducted at least three times with separateexperimental samples with each sample assayed in triplicate per experiment. Thedepicted results are representative of one such experiment.

Motility assay. Cultures were grown to an OD at 600 nm (OD600) of 1.0, and1 �l of the culture was stabbed onto 0.3% 0.5 DMEM containing glucose (2.25g/liter) and sodium pyruvate (0.5 mM) but lacking phenol red and glutamine.The stabbed agar plates were incubated upright overnight at 37°C, and thediameter of the “diffusion halo” was measured 30 h later to determine the extentof motility of the bacterium. Motility assays were performed on three separateoccasions.

Glycogen biosynthesis assay. A loopful of a bacterial culture grown to anOD600 of 1.0 was streaked onto Kornberg medium (1.1% K2HPO4, 0.85%KH2PO4, 0.6% yeast extract, 2% glucose, 1.5% agar) (83), after which the plateswere incubated overnight at 37°C. The plates were then exposed to iodinecrystals to determine the extent of glycogen biosynthesis in the different bacterialstrains. Iodine forms complexes with glycogen, as a result of which strains pro-ducing glycogen appear blackish-brown whereas strains that do not synthesizeglycogen do not exhibit any color change after exposure to iodine. Glycogenbiosynthesis assays were performed on three separate occasions. The picturesshown are representative of one such experiment.

RESULTS

csrA regulates adherence and pedestal formation on mam-malian cells. Disruption of csrA does not affect the growth ofEPEC, as evident from similar doubling times for the wild type(48.04 � 0.8 min) and the csrA mutant (41.15 � 9.2 min) (Fig.1A, B, and C). Because csrA was necessary for virulenceagainst C. elegans (data not shown, unpublished data), we nextassessed whether disruption of csrA affected virulence in mam-malian cells. To do this, we assessed the capacity of EPEC toadhere to and form pedestals on mammalian 3T3 cells (49) andto disrupt the resistance across polarized epithelial cells (12,34). Although cells were infected with the same number ofbacteria, the csrA mutant exhibited reduced adherence com-pared to that of EPEC or the single-copy complemented strain(n � 4; Fig. 1D, compare 4�,6-diamidino-2-phenylindole [DAPI]staining in column 2, row 3 [csrA mutant], with column 1, row3 [EPEC], or column 3, row 3 [csrA lacZ csrA�]). Furthermore,whereas clustering of the bacteria was evident for the wild-typestrain and the complemented strain (yellow arrows), the csrAmutant primarily appeared as solitary isolated cells.

Using fluorescence microscopy in conjunction with antibod-ies against phosphotyrosine (pY) and Tir and fluorescein iso-thiocyanate-phalloidin to visualize polymerized actin, we nextassessed the formation of actin pedestals. In cells infected withEPEC, �80% of the cells displayed �10 pedestals per cell(Fig. 1E), and Tir and pY staining was evident directly beneathattached bacteria and at the tips of actin pedestals (Fig. 1D,column 1). By contrast, with the csrA mutant, the percentage ofcells displaying pedestals was reduced by 35-fold (Fig. 1E), aswas the number of pedestals per cell (Fig. 1D). Accordingly,pY and Tir staining was diminished in cells infected with thecsrA mutant compared to that in cells infected with wild-typeEPEC (Fig. 1D, column 2). Complementation of the mutantwith csrA in a single copy restored adherence, pedestal forma-tion, and localization of pY and Tir to the levels seen withwild-type EPEC (Fig. 1D, column 3, and E).

Disruption of TER across polarized Caco-2BBe cells dependson csrA. Previous reports have shown that adherence, pedestalformation, and the effectors EspF and Map mediate the ca-pacity of EPEC to disrupt TER across polarized Caco-2BBe

cells (12, 19, 64). Because mutation of csrA diminishes theability of EPEC to adhere and form pedestals, we next exam-ined its effects on TER. For EPEC, the time required to dis-rupt the TER to 50% of the value at the point of infection (t1/2)was 5.5 h, whereas the csrA mutant required approximately2.5 times as long (t1/2 of 14.3 h; Fig. 2). By 9.5 h postinfection,EPEC decreased the resistance across the cells by over 76%(more than fourfold), whereas the csrA mutant reduced theTER by less than 15% during the same period. The comple-mented strain regained the ability to disrupt the TER withsignificantly faster kinetics than those of the csrA mutant (t1/2

of 7.9 h), and by 9.5 h it had decreased the TER by over 63%(Fig. 2). Interestingly, even after prolonged infection by thecsrA mutant, there was still some residual endpoint resistance(12,000 �) that was reproducibly higher than that observedin cells infected with EPEC (7,000 �) or with the comple-mented strain (5,000 �) (Fig. 2). Taken together, these datasuggest that csrA not only regulates the time of onset but also


on Decem


.org/D

ownloaded from

http://iai.asm.org/

FIG. 1. Inactivation of csrA does not affect EPEC growth but greatly diminishes adherence, pedestal formation, and disruption of TER. (A andB) Bacterial cultures grown overnight were diluted in DMEM (lacking phenol red) to a starting OD600 of 0.01, and the growth of the strains wasmeasured hourly and intermittently at half-hour intervals. Shown are the growth curves of the strains on logarithmic (A) and linear (B) scales.EPEC and its isogenic csrA mutant grow at similar rates. Furthermore, EPEC(pBR322) and EPEC(pCRA16) also grow at the same rate to an ODof 0.25, after which the multicopy csrA expressor grows at a slower rate. (C) The doubling times of EPEC, the csrA mutant, EPEC(pBR322),and EPEC(pCRA16) were determined from at least two independent experiments with each strain assayed in duplicate per experiment. The valuesrepresent the mean � standard deviation from all of the experiments. (a) The doubling time of EPEC(pCRA16) was determined in the early logphase (OD600, �0.25) prior to the first biphasic lag (lower black arrow) displayed by the strain. (D) 3T3 cells were infected for 5 h with equalnumbers of bacteria. Cells were then fixed with formaldehyde and permeabilized with Triton X-100. Pedestal formation was visualized byimmunofluorescence microscopy by using antibodies against Tir and pY. Fluorescein isothiocyanate-phalloidin was used to detect filamentous actinbeneath the adherent bacteria. DAPI was used to detect adherent bacteria and the cellular nucleus. Adherence was diminished in the csrA mutant,as evident from the relatively low number of DAPI-stained mutant bacteria compared to those of the wild-type or the complemented strain(compare column 2, row 3 (csrA mutant), with column 1, row 3 (EPEC), or column 3, row 3 (csrA lacZ csrA�). Yellow arrows represent clusteringof bacteria that was routinely observed in the wild-type and complemented strains but not in the csrA mutant. The ability to form pedestals wasalso reduced in the csrA mutant, as manifested by diminished Tir, pY, and polymerized actin staining. Pedestal assays were performed on threeseparate occasions with independent bacterial cultures, and similar results were obtained in each experiment. Images are representative of one suchexperiment. Scale bars represent 20 �m. (E) The extent of pedestal formation was quantified by counting a total of 100 cells from at least 10different frames, and the percentage of cells with 10 or more pedestals per cell was determined. The values and error bars represent the standarddeviation of the mean from one such experiment. ** denotes a P value of �0.001. FITC, fluorescein isothiocyanate.

3557

on Decem


.org/D

ownloaded from

http://iai.asm.org/

the kinetics and extent of membrane depolarization of mam-malian cells in vitro.

csrA is necessary for synthesis and secretion of transloca-tors but only affects the secretion of the effector Tir. Mutationsin espA, espB, espD, or tir negate the ability of EPEC andCitrobacter rodentium to form pedestals on tissue culture cellsin vitro or to colonize mice, respectively (14, 21, 28, 44–46, 50,55). Disruption of csrA reduced the secreted (Fig. 3A), as wellas the bacterium-associated (Fig. 3B), levels of EspA, EspB,and EspD. Complementation of the csrA mutant with csrAexpressed in a single copy under the control of its putativepromoter(s) restored both the secreted (Fig. 3A) and the bac-terium-associated (Fig. 3B) amounts of EspA, EspB, and EspDto nearly wild-type levels.

Two prominent bands corresponding to Tir were visible inthe secreted fraction of the wild type and the complementedstrain (Fig. 3A, lanes 1 and 3) but absent in the tir mutant (datanot shown). Whereas the slower-migrating band displayed amodest reduction, the faster-migrating band was absent in thecsrA mutant (Fig. 3A, compare lane 1 with lane 2). Our resultsare consistent with previous observations identifying at leasttwo variants of Tir in EPEC, of which one migrates at 80 kDa(upper band) and the other, likely representing a truncatedform, migrates at 70 kDa (lower band) (25, 26). Both bandswere routinely observed in the secreted fraction (Fig. 3A), butonly the 80-kDa band was consistently observed in cell lysates(Fig. 3B). In contrast to the secretion of Tir, the bacterium-associated level of Tir was not substantially affected by thedisruption of csrA (Fig. 3B). Overall, these data suggest thatdisruption of csrA reduces the secretion of Tir without appre-ciably affecting the amount of Tir protein associated with thebacterium or its synthesis (see below).

csrA regulates the transcript levels of the architectural com-ponents of the TTSS. Because the bacterium-associated levels ofEspA, EspB, and EspD were reduced in the csrA mutant, we nextexplored the possibility that reduced levels of protein were due toreduced transcript levels. Real-time qRT-PCR for espA, espD,and espB demonstrated that transcript levels for these genes were

reduced by approximately 16-, 28-, and 14-fold, respectively, inthe csrA mutant (Fig. 4A). Complementation with csrA in a singlecopy restored the transcript levels to those seen in the parentalstrain (Fig. 4A). Thus, reduced steady-state protein levels of thetranslocators in the mutant can be accounted for by reducedtranscript levels. Interestingly, whereas espA and espB showed

FIG. 2. csrA is necessary for disruption of TER across Caco-2BBe cells. Caco-2BBe cells were seeded into ECIS 8W1E electrodes (5 105

cells/400 �l/electrode) and kept at 37°C in a 5% CO2 incubator with 90% humidity. Bacterial cultures grown overnight were used to infect the cellsat a multiplicity of infection of 10. TER was measured continuously postinfection. Disruption of csrA delayed the onset and reduced the rate andextent of membrane depolarization. Each experiment was performed on three separate occasions, with triplicate samples being assayed in everyexperiment. Error bars represent standard deviations of the mean values obtained at the designated time points from one such experiment. Thestart of infection of the cells by the bacterial strains is indicated by the arrow.

FIG. 3. Secretion of EspA, EspB, EspD, and Tir is diminished in thecsrA mutant. (A and B) EPEC, the csrA mutant, and the csrA lacZ csrA�

monocopy complemented strain were grown in DMEM lacking phenolred at 37°C in a 5% CO2 incubator to an OD of 1.0. Western blottingfor secreted (A) and EPEC-associated (B) EspA, EspB, EspD, and Tirwas performed with polyclonal antibodies as described in Materials andMethods. Whereas both the secreted and bacterium-associated levels ofEspA, EspB, and EspD were reduced, only the secretion of Tir wasreduced in the csrA mutant. Western blotting experiments were con-ducted on at least three separate occasions with similar results. The imageshown is a representation of one such experiment.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

similar n-fold reductions in transcript levels, espD exhibited a1.75-fold greater reduction (Fig. 4A).

A �70 promoter for the LEE4 operon is located upstream ofsepL, which is the first gene in the operon (67). In EPEC andEHEC, sepL, espA, espD, and espB are transcribed as a singlepolycistronic transcript (60, 67). In EHEC, this polycistronictranscript is processed at the C terminus of sepL to yield twotranscripts containing sepL and espADB, respectively (60),whereas for EPEC this phenomenon has yet to be demon-strated. SepL facilitates the secretion of translocators (20, 52,72) without affecting their synthesis. Because CsrA binds to the5� leader segment of transcripts and affects gene expression, wescanned the RNA sequence in the leader segment of the sepLtranscript for putative CsrA binding sites. Two such sites wereidentified (Fig. 5A and B), suggesting that CsrA might bind toand affect the sepL espADB transcript levels. Consistent withthis prediction, sepL transcript levels were reduced by 17.2-

fold in the csrA mutant (Fig. 4A). Together, these data suggestthat csrA not only regulates the synthesis of EspA, EspB, andEspD but may directly affect their export by regulating thelevels of SepL. Consistent with data showing similar levels ofbacterium-associated Tir in the wild type and the csrA mutant,no significant differences in the tir transcript levels in thesestrains were observed (Fig. 4B). Thus, reduced secretion of Tirin the mutant is likely due to an effect of csrA on a regulator ora component of the TTSS.

EscF forms the needle complex of the TTSS that connectsthe EscC outer membrane protein of the TTSS to the EspAfilament. Inactivation of escF diminishes the secretion of EspA,EspB, and EspD and pedestal formation by EPEC (100). escFis present on the same polycistronic transcript as sepL espADB(67), suggesting that its transcript levels might also be reducedin the csrA mutant. However, the transcript levels of escF didnot show the same extent of reduction as sepL espADB andwere reduced by only 5.5-fold in the csrA mutant (Fig. 4B). Itis possible that besides being present on the longer transcript,escF is also transcribed from an additional promoter(s) in theintergenic region between espB and escF and this transcript isnot subject to CsrA-mediated regulation.

Besides escF, we also assayed for the transcript levels ofescD. EscD is homologous to the Yersinia YscD protein, bothof which are predicted to be inner membrane proteins andcomponents of the TTSS necessary for the secretion of trans-locators and effectors (73). escD is located between the eaegene of the LEE5 operon and the sepL gene of the LEE4operon (67). escD and LEE4 have overlapping divergent pro-moters, and their transcriptional initiation nucleotides are ad-jacent to one another, albeit on opposite strands (67). Wefound that escD transcript levels were reduced 2.5-fold in thecsrA mutant (Fig. 4B) and restored when the mutant was com-plemented with csrA in single copy. Overall, these data suggestthat reduced synthesis of EscF and EscD in the csrA mutantmay, in part, be responsible for reduced secretion of Tir andthe translocators by affecting assembly of the TTSS. Expressionfrom the LEE1 and LEE2 operons, which encode other com-ponents of the TTSS, was not significantly affected in the csrAmutant (data not shown).

Purified CsrA binds to the leader segment of the sepLespADB, but not the escD, transcript. Two putative CsrA bind-ing sites were identified in the 5� leader segment of sepL (Fig.5A and B), suggesting that CsrA might regulate sepL espADBmRNA levels by directly binding to the transcript. Binding ofCsrA to the leader segment of the sepL transcript was detect-able at a protein concentration of 10 nM (Fig. 5C), with anapparent equilibrium binding constant of 23 � 1.7 nM (Fig.5E). No unbound transcript was evident at a CsrA concentra-tion of 80 nM (Fig. 5C), and multiple shifted ribonucleoproteincomplexes were evident at concentrations of �160 nM (Fig.5C). The binding of CsrA to the sepL transcript was specific, asshown by competition assays with unlabeled sepL and the non-specific phoB RNA, to which CsrA does not bind (Fig. 5D).The binding data and real-time qRT-PCR results suggest thatincreased steady-state levels of sepL, espA, espD, espB, andescF in the wild-type strain are the result of direct interactionbetween CsrA and the polycistronic transcript. CsrA failed tobind to the escD transcript (data not shown), suggesting that

FIG. 4. sepL, espA, espD, espB, escD, and escF, but not tir, transcriptlevels are reduced in the csrA mutant. (A and B) RNA was isolatedfrom bacterial cultures grown to an OD of 1.0, and real-time qRT-PCR was performed as described in Materials and Methods. Shownare the relative transcript levels of sepL, espA, espD, espB (A), tir, escD,and escF (B) in csrA mutant and csrA lacZ csrA� strains normalized tothose of wild-type EPEC. Results are means � standard deviationsfrom triplicate experiments, with each sample being assayed in dupli-cate per experiment. The unpaired Student t test was used to assay forthe statistical significance of differences between the csrA mutant andEPEC or the csrA lacZ csrA� strain. A P value of �0.01 was consideredstatistically significant. ** denotes a P value of �0.001, whereas *denotes a P value of �0.005.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

FIG. 5. CsrA binds to the leader segment of the LEE4 operon. (A) Cartoon depicting the location of putative CsrA binding sites in the leadersegment of the LEE4 transcript. The thick black arrows depict the genetic organization of sepL, espA, espD, espB, cesD2, and escF. Two putativeCsrA binding sites identified upstream of sepL are depicted by white rectangles. The vertical line with an arrow at the apex indicates thetranscription start site of the LEE4 operon in EPEC. (B) The primary sequence in the leader segment of the sepL transcript of EPEC, EHEC,and C. rodentium was scanned to determine the presence of putative CsrA binding sites by comparing the sequence to the SELEX (selectedevolution of ligands by exponential enrichment)-determined CsrA consensus sequence (A/GUACAA/GGGAUGU) (23). The �70 transcriptionalstart site for sepL is highlighted in gray. The predicted Shine-Dalgarno sequence for the transcript is in bold and italicized. The predicted CsrAbinding sites are in boldface. Note that each predicted CsrA binding site contains the highly conserved ANGGA motif (boldface and underlined)present in known CsrA-regulated transcripts (4, 62). The highlighted AUG codon represents the translation initiation codon. References for thetranscriptional start site and/or the predicted Shine-Dalgarno sequence are shown on the right. (C) RNA EMSA was performed with purifiedHis-tagged CsrA and 32P-labeled sepL leader RNA as described in Materials and Methods. CsrA bound to the leader segment of sepL at aconcentration of 10 nM (S1). Higher-molecular-weight ribonucleoprotein complexes were observed with increasing CsrA concentrations of �80nM (S2). U1 and U2 represent the unbound transcript, whereas S1 and S2 represent shifted ribonucleoprotein complexes. (D) Binding to the sepLtranscript was specific because unlabeled sepL but not the noncompetitor RNA, phoB, successfully competed with the labeled transcript. CsrA andsepL or phoB RNA concentrations are indicated at the bottom of each lane. (E) The calculated apparent equilibrium binding constant of CsrAfor sepL RNA was 23 � 1.7 nM. Error bars represent standard errors of the means determined from two independent experiments. (F and G) Thesteady-state protein levels of Ler in EPEC, the csrA mutant, and the csrA lacZ csrA� strain (F) or chromosomally 3XFLAG-tagged GrlA in EPECgrlA 3XFLAG, csrA mutant grlA 3XFLAG, and csrA lacZ csrA� grlA 3XFLAG (G) were determined by Western blotting. Ler and 3XFLAG-taggedGrlA protein levels were unaffected in the csrA disruptant.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

csrA-mediated activation of escD occurred through an inter-mediate regulator.

The transcription factor GrlA activates the transcription ofler (7, 21, 38), which in turn upregulates the steady-state tran-script levels of escD (21, 26, 67). To determine whether theeffect of csrA on escD and LEE4 may also be occurring throughgrlA and ler, we assayed for the expression of these genes. Proteinlevels of Ler and FLAG-tagged GrlA were unchanged in the csrAmutant (Fig. 5F and G), suggesting that the effects of csrA on escDand LEE4 occurred independently of Ler and GrlA.

Overexpression of csrA globally represses expression fromthe LEE. Previous studies with csrA suggest that fine tuning ofthe activity of CsrA is critical for the virulence of S. entericaserovar Typhimurium (2). This observation prompted us toassess the effect of increasing the activity of CsrA in EPEC.The noncoding small RNAs CsrB and CsrC bind to and se-quester CsrA, thereby inhibiting its activity. These RNAs arestrongly regulated in vivo, and deletion of both csrB and csrCincreases CsrA activity in the cell, a condition that would bemore relevant for in vivo interpretation (92, 99). Because CsrBand CsrC exhibit compensatory regulation, loss of either RNAleads to an increase in the remaining RNA (99). Thus, singledeletions have weak or negligible effects on CsrA-regulatedgenes and processes. In this regard, isogenic csrB or csrC singlemutants show no difference in the expression of Tir (data notshown), and we were unable to construct a csrB csrC doublemutant of EPEC, for unknown reasons. Thus, high activity ofCsrA was achieved by increasing the levels of CsrA via expres-sion of csrA from a plasmid. Multicopy expression of csrAresulted in a modest 1.5-fold � 0.1-fold increase in CsrAprotein levels above that of the empty-vector-containing strain(Fig. 6A). Overexpression of CsrA reduced the transcript lev-els of escJ, tir, and espA in the LEE2, LEE5, and LEE4 operonsand the monocistronic gene escD by 76-, 43-, 13-, and 45-fold,respectively (Fig. 6B). Consistent with the observed reductionin transcript levels of tir and espA, the overall steady-stateprotein levels were also reduced (data not shown). Reduced tirtranscript levels in the overexpressor, but not the csrA mutant(compare Fig. 6B with 4B), suggest that at some level of reg-ulation, disruption and overexpression of csrA affect Tir levelsvia distinct pathways.

In EPEC, grlR and grlA are on the same bicistronic transcriptbecause a PCR product was generated in a real-time qRT-PCRwith a primer specific for grlR and another specific for grlA(data not shown). The grlRA operon encodes a repressor,GrlR, and an activator, GrlA (21). GrlA activates the expres-sion from the LEE by upregulating the transcription of ler (7,21), whereas binding of GrlR to GrlA has been proposed toprevent such activation (15, 38, 41). Ler, in turn, upregulatesthe transcription from LEE2, LEE3, LEE5, LEE4, and escD(26, 67). Because we observed reduced transcript levels ofgenes under the control of the ler regulon, we assessed theexpression of ler, grlR, and grlA in the csrA-overexpressingstrain. The transcript levels of the three genes were reduced by7-, 14-, and 29-fold, respectively, in the overexpressor, as de-termined by real-time qRT-PCR (Fig. 6C). The correspondingprotein levels of Ler and 3XFLAG-tagged GrlA were alsosubstantially reduced (Fig. 6D), suggesting that overexpressionof csrA globally shuts off the transcription from the LEE byrepressing the expression of grlA. We were unable to assay for

GrlR because no antibody was available, and we were unableto epitope tag grlR on the chromosome. Notably, no Ler pro-tein was detectable in the csrA overexpressor, even when lerwas expressed from a multicopy plasmid, despite the fact thatcomplementation of EPEC �ler with the same plasmid re-sulted in Ler protein levels that were 17-fold higher thanthose of EPEC containing a single chromosomal copy of ler(data not shown).

We could not attribute the observed differences in geneexpression from the LEE simply to the subtle alteration ingrowth exhibited by the csrA-overexpressing strain. Whilebarely observable on a logarithmic scale (Fig. 1A), in alinear plot of growth, the csrA-overexpressing strain exhib-ited biphasic growth (black arrows in Fig. 1B), which re-sulted in a mild but detectable growth defect (Fig. 1B). Thisgrowth defect was evident only after the strain had grownpast the early log phase beyond an OD600 of 0.25 as bothstrains grew at similar rates in the early log phase, withdoubling times of 51.61 � 8.3 and 54.70 � 6.4 min forEPEC(pBR322) and EPEC(pCRA16), respectively (Fig.1C). Steady-state levels of Ler protein were reduced in thecsrA overexpressor (Fig. 6E), even when both strains weregrowing at the same rate (OD600, 0.2).

CsrA binds to the 5� leader segment of the grlRA transcript.Three predicted CsrA binding sites were identified in theleader segment of the grlRA transcript (Fig. 7A and B). Tran-scripts that are repressed by CsrA often have binding sites thatoverlap the Shine-Dalgarno sequence or are located nearby (5,97). One of the predicted CsrA binding sites in grlRA is locatedone codon downstream of the translation initiation codon inEPEC (Fig. 7B). Bioinformatic analysis, together with the ob-servation that grlR and grlA transcript levels were reduced inthe csrA-overexpressing strain (Fig. 6C and D), suggested thatCsrA, when present at high levels, might repress these genes bybinding to the leader segment of the grlRA transcript. Bindingof CsrA to the grlRA leader segment was evident at a CsrAconcentration of 2.5 nM; at 80 nM, all of the transcript waspresent in the bound form (Fig. 7C). Multiple shifted ribonu-cleoprotein species were evident at CsrA concentrations as lowas 20 nM (Fig. 7C, S1 and S2). On further increasing the CsrAconcentration (�320 nM), the transcript was evident in super-shifted CsrA-RNA complexes S3 and S4 (Fig. 7C). Binding tothe grlRA leader was specific because unlabeled grlRA, but notphoB, RNA competed with the labeled transcript (Fig. 7D).The apparent equilibrium binding constant of CsrA for grlRAwas 6 � 0.8 nM (Fig. 7E). Taken together, these data suggestthat overexpression of CsrA globally represses transcriptionfrom the LEE in part by binding to the grlRA transcript andrepressing the expression of GrlA.

csrA regulates motility and glycogen biosynthesis in EPEC.In nonpathogenic E. coli K-12, CsrA activates flagellar biogen-esis by directly binding to the untranslated leader segment ofthe flhDC transcript and increasing its half-life (98). Similarly,inactivation of csrA rendered EPEC nonmotile, whereas comple-mentation of the mutant with csrA restored motility (Fig. 8A).High levels of CsrA appeared to have a dose-dependent effect onmotility, as the overexpressor was hypermotile compared to theempty-vector-containing strain (Fig. 8A). Consistent with the ob-served reduction in motility, flhD transcript levels exhibited anapproximately sixfold reduction in the csrA mutant and the


on Decem


.org/D

ownloaded from

http://iai.asm.org/

transcript levels were restored in the complemented strain(Fig. 8B). Besides motility, csrA also regulated glycogen bio-synthesis in EPEC, with a csrA mutation resulting in elevatedglycogen levels (Fig. 8C). Glycogen biosynthesis was repressedin a dose-dependent manner as multicopy presence of csrA inEPEC [EPEC(pCRA16)] did not elicit any color change onexposure to iodine in comparison to EPEC containing theempty vector [EPEC(pBR322)] (Fig. 8C).

DISCUSSION

We have shown that csrA regulates gene expression from theLEE pathogenicity island of EPEC and is necessary for pedestalformation and disruption of TER, two in vitro correlates ofpathogenesis. Whereas disruption and multicopy expression ofcsrA lead to a reduction in the levels of the LEE4-encoded tran-scripts, the mechanistic basis differs. The two predicted CsrA

FIG. 6. Expression of csrA from a multicopy plasmid globally represses expression from the LEE via GrlA. (A) Cultures of EPEC(pBR322)and EPEC(pCRA16) grown overnight were diluted in DMEM and allowed to grow to an OD of 1.0. CsrA protein levels were elevated by1.5 � 0.1 in the overexpressor [EPEC(pCRA16)] compared to those in the empty-vector-containing strain [EPEC(pBR322)]. (B and C) RNA wasisolated from EPEC(pBR322) and EPEC(pCRA16) grown to an OD of 1.0, and real-time qRT-PCRs for escJ (LEE2), tir (LEE5), espA (LEE4), andescD (B) and ler (LEE1), grlR, and grlA (C) transcripts were performed as described above. Multicopy expression of csrA repressed the transcript levelsfrom all of the LEE operons tested. Error bars represent the standard deviation of the mean from two separate experiments, with triplicate samplesassayed every experiment. The unpaired Student t test was used to assay for the statistical significance of differences between EPEC(pBR322) andEPEC(pCRA16). A P value of �0.01 was considered statistically significant. ** denotes a P value of �0.001. (D) Western blotting for the steady-stateprotein levels of Ler and 3XFLAG-tagged GrlA was performed with cell lysates of EPEC(pBR322) and EPEC(pCRA16) grown to an OD of 0.5.Multicopy expression of csrA repressed the steady-state protein levels of Ler and GrlA-3XFLAG. NS refers to a cross-reacting nonspecific band. (E) Thesteady-state Ler levels were reduced in the overexpressor, even when both strains were growing at the same rate (OD600 of 0.2). NS refers to across-reacting nonspecific band. EPEC(pBR322) and EPEC(pCRA16) grew at comparable rates to an OD600 of 0.25, after which the overexpressorgrew at a slightly slower rate (Fig. 1A, B, and C).


on Decem


.org/D

ownloaded from

http://iai.asm.org/

binding sites observed in the leader segment of the sepL transcriptdo not overlap the predicted Shine-Dalgarno sequence of sepLand are located 17 and 45 nucleotides upstream. Our resultssuggest that binding of CsrA to the leader segment of the sepL

espADB transcript results in increased steady-state transcript lev-els in EPEC. In contrast, multicopy expression of csrA decreasestranscription from the LEE operons, including LEE4, by repress-ing the expression of the transcriptional activator GrlA (Fig. 9).

FIG. 7. Purified CsrA binds to the leader segment of the grlRA transcript. (A) Cartoon depicting the locations of putative CsrA binding sitesin the leader segment of the grlRA transcript. The thick black arrows depict the genetic organization of grlR and grlA, respectively, in the grlRAoperon. The three white rectangles in the leader segment and the 5� region of the grlR ORF represent the predicted sites to which CsrA dimers(bound black balls) might bind. The vertical line with an arrow at the apex indicates the transcription start site. (B) The primary sequence of theleader segment of the grlRA transcript of EPEC, EHEC, and C. rodentium was scanned to determine the presence of putative CsrA binding sites.The �70 transcriptional start site of the grlRA operon is highlighted in gray. The predicted Shine-Dalgarno sequence of the transcript is in bold anditalicized. The predicted CsrA binding sites are in boldface. Note that each predicted CsrA binding site contains the highly conserved ANGGA motif(boldface and underlined) (4, 62). The highlighted trinucleotide AUG represents the translation initiation codon. References for the transcriptional startsites are shown on the right. (C) RNA EMSA with purified His-tagged CsrA and 32P-labeled grlRA leader RNA was performed as described above. Thebinding of CsrA to the leader segment of the grlRA transcript began to occur at a concentration of 2.5 nM. Higher-molecular-weight ribonucleoproteincomplexes were observed beginning at a concentrations of 20 nM (S2, S3, and S4). CsrA and grlRA RNA concentrations are indicated at the bottom ofeach lane. U1 represents the unbound transcript, whereas S1, S2, S3, and S4 represent shifted ribonucleoprotein complexes. (D) Binding to grlRA wasspecific because high concentrations of unlabeled grlRA RNA, but not of the noncompetitor phoB RNA, successfully competed with the labeledtranscripts. (E) The apparent equilibrium binding constant of CsrA for the grlRA transcript was 6 nM. The error bars represent the standard errors ofthe means determined from two independent experiments.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

csrA disruption and overexpression also differentially regu-late the expression of Tir. Whereas tir transcript and bacteri-um-associated Tir protein levels are unaffected in the csrAmutant, reduced secretion of Tir in the csrA mutant is partlydue to reduced synthesis of EscD and EscF. In the multicopyexpressor, by contrast, tir transcript levels are greatly dimin-ished, resulting in reduced Tir synthesis.

It is noteworthy that csrA, when expressed in a single copy,upregulates the expression of genes that form the architecturalcomponents of the TTSS (e.g., escD and escF), translocatorsthat form a filamentous conduit between the EscF needle ofthe TTSS and the host cytosol (e.g., espA, espB, and espD) andthe “gatekeeper switch” sepL. SepL and SepD interact (20, 72)to facilitate the hierarchical secretion of translocators over the

effectors in response to changes in calcium and possibly otherenvironmental signals (20), perhaps as a means of ensuring theformation of a functional secretion apparatus and subsequentdelivery of effectors directly into the host cytosol rather thanthe medium. EPEC with a mutation in sepL is insensitive to thepresence or absence of calcium and displays dysregulated se-cretion of effectors and translocators (20). Thus, SepL may bea component of a sensor apparatus that detects a reducedintracellular calcium concentration in the host cell and thenpromotes the release of effectors. Our results suggest that csrAis immediately proximal to sepL in a regulatory cascade, andthus it might play a role in coordinating this hierarchical se-cretion of translocators over effectors by posttranscriptionallyregulating the expression of sepL in response to different en-

FIG. 8. csrA activates motility and represses glycogen biosynthesis in EPEC. (A) For motility assays, cultures grown overnight were diluted inLB broth or in LB broth supplemented with the appropriate antibiotic and allowed to grow to an OD of 1.0. One microliter of the culture wasstabbed onto 0.3% 0.5 DMEM agar plates and incubated for 30 h at 37°C. Motility assays were performed in triplicate, and the diameter of thebacterial halo was measured as an indicator of bacterial motility. The unpaired Student t test was used to assay for the statistical significance ofdifferences between the csrA mutant and EPEC or the csrA lacZ csrA� strain or between EPEC(pBR322) and EPEC(pCRA16). A P value of �0.01was considered statistically significant. ** denotes a P value of �0.001, and * denotes a P value of �0.01. (B) Real-time qRT-PCR for flhD (masterregulator of flagella) was performed as described above. flhD transcript levels were substantially reduced in the csrA mutant and restored whenthe mutant was complemented with csrA in monocopy. ** denotes a P value of �0.001, whereas * denotes a P value of �0.005. (C) To measureglycogen biosynthesis, bacterial cultures were grown to an OD600 of 1.0, streaked onto Kornberg plates, and incubated at 37°C overnight, afterwhich the plates were exposed to iodine vapor. Glycogen levels were elevated in the csrA mutant compared to those in the wild type (EPEC) orthe complemented strain (csrA lacZ csrA�), as evident from increased black-brown color formation in the mutant. csrA repressed glycogen biosynthesisin a dose-dependent manner because multicopy expression of csrA in the wild-type background [EPEC(pCRA16)] did not lead to a color change, incontrast to the brown color observed for the empty-vector-containing strain [EPEC(pBR322)], which contains a single copy of csrA.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

vironmental stimuli. Future experiments aimed at addressingwhether csrA transcript or CsrA protein levels are affected byenvironmental factors known to regulate the expression and/orsecretion of the proteins encoded by LEE4 genes will shedlight on the possible involvement of CsrA in such a hierarchicalsecretion mechanism.

We have demonstrated that multicopy expression of csrAglobally represses expression from the LEE locus, likely viaGrlA. A grlA mutation might be expected to act epistaticallywith respect to a grlR mutation, because GrlR affects expres-sion from the LEE locus by binding to and inhibiting GrlAactivity (15, 38). Hence, a reduction in GrlR and GrlA shouldlead to overall transcriptional repression from lee1, resulting inreduced levels of the master regulator Ler. Consistent with thisidea, ler transcript and Ler protein levels, as well as transcrip-tion from all of the LEE operons tested, were reduced in theCsrA overexpressor.

It is intriguing that the affinity of CsrA for the grlRA tran-script is higher than that for the sepL transcript, especially asthe repression of grlRA by CsrA appears to occur only at highCsrA concentrations. A likely explanation is that althoughCsrA initially binds to the grlRA transcript at low concentra-tions (KD, 6 nM), it does not produce physiologically relevantchanges in gene expression, as evidenced by unchanged GrlAand Ler protein levels in the csrA mutant and the wild-typestrain. However, at higher CsrA concentrations, higher-ordercomplexes that affect gene expression may form. Consistentwith this idea, multiple CsrA-grlRA ribonucleoprotein species

are observed in gel shifts at higher CsrA concentrations (40nM) (Fig. 7C, band S2). It is unlikely that S2 represents anartifact resulting from nonspecific aggregates of CsrA becausewhereas almost all of the grlRA leader transcript is evident inthe supershifted species S2 at 80 nM, the sepL transcript re-mained in the S1 form. Notably, a concentration of 40 nM iswithin the range in which CsrA binds to other E. coli mRNAs(5). Our data also raise the possibility of at least one additionalCsrA-regulated factor that affects gene expression from theLEE in lieu of the fact that escD transcript levels are reducedin the csrA mutant but purified CsrA does not bind to its leadersegment.

CsrA is a pleiotropic regulator in EPEC as it also regulatesmotility and glycogen metabolism. The flhDC mRNA leadersegment contains binding sites for CsrA that mediate its effectson motility in E. coli K-12 (98). These binding sites are con-served in EPEC. Thus, it is likely that in EPEC, as in K-12,flagellar biogenesis and consequent motility are mediated bythe direct binding of CsrA to the flhDC leader transcript.However, there may also be differences in the CsrA-mediatedregulation of motility between EPEC and K-12. E. coli K-12 ismotile under diverse environmental conditions, including LBand LB supplemented with exogenous carbon sources such asacetate and succinate, whereas a glucose concentration of 10mM represses motility (98). By contrast, EPEC remains motileon 0.5 DMEM, which contains 12.5 mM glucose, whereas anisogenic csrA mutant is nonmotile.

Thus, CsrA represents a novel posttranscriptional regulatory

FIG. 9. Model of LEE regulation by csrA. When expressed in monocopy, binding of CsrA to the LEE4 operon encoding sepL espADB and escFtranscript results in their increased steady-state transcript levels. However, activation of escD occurs indirectly via an intermediate regulator(s). Forsimplicity, the effect is shown to occur via an activator (X). In contrast to the csrA mutant, overexpression of csrA globally represses thetranscription from the LEE. This is achieved in part by CsrA binding to the leader segment and resulting in reduced grlRA transcript andconsequent GrlA protein levels. Reduced GrlA protein levels lead to reduced Ler protein levels, which in turn result in reduced transcription fromthe other LEE-encoded operons. csrA also promotes motility by upregulating the flhDC transcript levels in EPEC and represses glycogenbiosynthesis. Dotted arrows represent positive genetic circuits that have been demonstrated previously, thick transparent arrows represent thetranscription-activating gene product encoded in the LEE1 and grlRA operons, whereas thick filled arrows with shard ends (activated circuits) andthick filled arrows with blunted ends (repressed circuits) represent novel genetic circuits and/or phenotypes of EPEC identified in this paper.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

molecule in A/E pathogens that activates and represses theexpression of the LEE-encoded genes in a concentration-de-pendent manner. Based on putatively identified CsrA bindingsites in the leader segment of sepL and grlRA of EHEC and C.rodentium (Fig. 5B and 7B), and the conserved mode of reg-ulation of ler by GrlR and GrlA (7, 21), we predict that CsrAfunctions similarly in these A/E pathogens.

An outstanding question is how EPEC and other A/E patho-gens integrate transcriptional and posttranscriptional controlof the LEE with motility and metabolism as they transitthrough the digestive tract. Our results raise the possibility thatan important component of this coordinated regulatory systemmay be CsrA. Thus, regulation of the concentration or activityof CsrA, through transcriptional control or via its binding part-ners CsrB/C, in response to extracellular signals from otherbacteria, or even signals from the host, may have pronouncedeffects on pathogenesis in vivo. We speculate that it would beadvantageous for EPEC to mimic commensal strains, perhapsin a manner akin to the csrA overexpressor, during passagethrough the upper gastrointestinal tract. Thus, increased ex-pression or activity of CsrA would be expected to repress theexpression of virulence factors encoded on the LEE (Fig. 9),thereby minimizing energy expenditures on unneeded tran-scripts and reducing the possibility of detection of pathogen-specific antigens by the innate immune system. Moreover, in-creased flagellar motility might facilitate transit to the sites ofcolonization. As EPEC approaches the small intestine, de-creasing CsrA protein levels or activity may prove advanta-geous. Thus, reducing flagellar motility in coordination withincreased transcription and translation of translocators, fol-lowed by effectors, would permit the bacteria to efficientlyattach and colonize. Using the mutants we have developed, weare currently testing how coordinated regulation of flagellarmotility, metabolism, and LEE expression by CsrA contributesto pathogenesis and immune evasion in vivo.

ACKNOWLEDGMENTS

We thank Bernie Weiss and Phil Rather for critical evaluation ofthe manuscript and Guy Benian, Charlie Moran, and the membersof the Kalman, Romeo, and Weiss labs for helpful discussions andsuggestions. We are grateful to June Scott (Emory University) forproviding the wild-type strain EPEC 2348/69, Jim Kaper and Mi-chael Donnenberg (University of Maryland) for strains (EPEC�espA, EPEC �espB, and EPEC �espD), and antibodies (anti-Tir,anti-EspA, and anti-EspB), B. Brett Finlay (University of British Co-lumbia) for EPEC �tir, Jay Mellies (Reed College) for EPEC �ler,Vanessa Sperandio (UT-Southwestern, Dallas) for pJRLacZIns,Rebekah DeVinney (University of Calgary) for the anti-EspD anti-body, Phil Rather (Emory University) for S17-1�pir, Bettina Bom-marius (Emory University) for DH5 , and Ilan Rosenshine (The He-brew University, Jerusalem) for anti-Ler.

This work was supported by NIH grants R01DK074731-01 and R01-A1056067-01 to D.K. and R01-GM059969 to T.R. S.B. is the recipientof National Science Foundation award 0450303 and subaward I-66-606-63 to Emory University.

REFERENCES

1. Abe, H., I. Tatsuno, T. Tobe, A. Okutani, and C. Sasakawa. 2002. Bicar-bonate ion stimulates the expression of locus of enterocyte effacement-encoded genes in enterohemorrhagic Escherichia coli O157:H7. Infect. Im-mun. 70:3500–3509.

2. Altier, C., M. Suyemoto, and S. D. Lawhon. 2000. Regulation of Salmonellaenterica serovar Typhimurium invasion genes by csrA. Infect. Immun. 68:6790–6797.

3. Anyanful, A., J. Dolan-Livengood, T. Lewis, S. Sheth, M. N. DeZalia, M.

Sherman, L. V. Kalman, G. M. Benian, and D. Kalman. 2005. Paralysis andkilling of Caenorhabditis elegans by enteropathogenic Escherichia coli re-quires the bacterial tryptophanase gene. Mol. Microbiol. 57:988–1007.

4. Babitzke, P., and T. Romeo. 2007. CsrB sRNA family: sequestration ofRNA-binding regulatory proteins. Curr. Opin. Microbiol. 10:156–163.

5. Baker, C. S., L. A. Eory, H. Yakhnin, J. Mercante, T. Romeo, and P.Babitzke. 2007. CsrA inhibits translation initiation of Escherichia coli hfq bybinding to a single site overlapping the Shine-Dalgarno sequence. J. Bac-teriol. 189:5472–5481.

6. Baker, C. S., I. Morozov, K. Suzuki, T. Romeo, and P. Babitzke. 2002. CsrAregulates glycogen biosynthesis by preventing translation of glgC in Esch-erichia coli. Mol. Microbiol. 44:1599–1610.

7. Barba, J., V. H. Bustamante, M. A. Flores-Valdez, W. Deng, B. B. Finlay,and J. L. Puente. 2005. A positive regulatory loop controls expression of thelocus of enterocyte effacement-encoded regulators Ler and GrlA. J. Bac-teriol. 187:7918–7930.

8. Barnard, F. M., M. F. Loughlin, H. P. Fainberg, M. P. Messenger, D. W.Ussery, P. Williams, and P. J. Jenks. 2004. Global regulation of virulenceand the stress response by CsrA in the highly adapted human gastricpathogen Helicobacter pylori. Mol. Microbiol. 51:15–32.

9. Bommarius, B., D. Maxwell, A. Swimm, S. Leung, A. Corbett, W. Born-mann, and D. Kalman. 2007. Enteropathogenic Escherichia coli Tir is anSH2/3 ligand that recruits and activates tyrosine kinases required for ped-estal formation. Mol. Microbiol. 63:1748–1768.

10. Burrowes, E., C. Baysse, C. Adams, and F. O’Gara. 2006. Influence of theregulatory protein RsmA on cellular functions in Pseudomonas aeruginosaPAO1, as revealed by transcriptome analysis. Microbiology 152:405–418.

11. Bustamante, V. H., F. J. Santana, E. Calva, and J. L. Puente. 2001. Tran-scriptional regulation of type III secretion genes in enteropathogenic Esch-erichia coli: Ler antagonizes H-NS-dependent repression. Mol. Microbiol.39:664–678.

12. Canil, C., I. Rosenshine, S. Ruschkowski, M. S. Donnenberg, J. B. Kaper,and B. B. Finlay. 1993. Enteropathogenic Escherichia coli decreases thetransepithelial electrical resistance of polarized epithelial monolayers. In-fect. Immun. 61:2755–2762.

13. Chen, H. D., and G. Frankel. 2005. Enteropathogenic Escherichia coli:unravelling pathogenesis. FEMS Microbiol. Rev. 29:83–98.

14. Cleary, J., L. C. Lai, R. K. Shaw, A. Straatman-Iwanowska, M. S. Donnen-berg, G. Frankel, and S. Knutton. 2004. Enteropathogenic Escherichia coli(EPEC) adhesion to intestinal epithelial cells: role of bundle-forming pili(BFP), EspA filaments and intimin. Microbiology 150:527–538.

15. Creasey, E. A., R. M. Delahay, S. J. Daniell, and G. Frankel. 2003. Yeasttwo-hybrid system survey of interactions between LEE-encoded proteins ofenteropathogenic Escherichia coli. Microbiology 149:2093–2106.

16. Cui, Y., A. Chatterjee, Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1995.Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp.carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-L-homo-serine lactone, and pathogenicity in soft-rotting Erwinia spp. J. Bacteriol.177:5108–5115.

17. Daniell, S. J., N. Takahashi, R. Wilson, D. Friedberg, I. Rosenshine, F. P.Booy, R. K. Shaw, S. Knutton, G. Frankel, and S. Aizawa. 2001. Thefilamentous type III secretion translocon of enteropathogenic Escherichiacoli. Cell. Microbiol. 3:865–871.

18. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chro-mosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl.Acad. Sci. USA 97:6640–6645.

19. Dean, P., and B. Kenny. 2004. Intestinal barrier dysfunction by entero-pathogenic Escherichia coli is mediated by two effector molecules and abacterial surface protein. Mol. Microbiol. 54:665–675.

20. Deng, W., Y. Li, P. R. Hardwidge, E. A. Frey, R. A. Pfuetzner, S. Lee, S.Gruenheid, N. C. Strynakda, J. L. Puente, and B. B. Finlay. 2005. Regu-lation of type III secretion hierarchy of translocators and effectors in at-taching and effacing bacterial pathogens. Infect. Immun. 73:2135–2146.

21. Deng, W., J. L. Puente, S. Gruenheid, Y. Li, B. A. Vallance, A. Vazquez, J.Barba, J. A. Ibarra, P. O’Donnell, P. Metalnikov, K. Ashman, S. Lee, D.Goode, T. Pawson, and B. B. Finlay. 2004. Dissecting virulence: systematicand functional analyses of a pathogenicity island. Proc. Natl. Acad. Sci.USA 101:3597–3602.

22. Donnenberg, M. S., J. Yu, and J. B. Kaper. 1993. A second chromosomalgene necessary for intimate attachment of enteropathogenic Escherichiacoli to epithelial cells. J. Bacteriol. 175:4670–4680.

23. Dubey, A. K., C. S. Baker, T. Romeo, and P. Babitzke. 2005. RNA sequenceand secondary structure participate in high-affinity CsrA-RNA interaction.RNA 11:1579–1587.

24. Dubey, A. K., C. S. Baker, K. Suzuki, A. D. Jones, P. Pandit, T. Romeo, andP. Babitzke. 2003. CsrA regulates translation of the Escherichia coli carbonstarvation gene, cstA, by blocking ribosome access to the cstA transcript. J.Bacteriol. 185:4450–4460.

25. Elliott, S. J., S. W. Hutcheson, M. S. Dubois, J. L. Mellies, L. A. Wain-wright, M. Batchelor, G. Frankel, S. Knutton, and J. B. Kaper. 1999.Identification of CesT, a chaperone for the type III secretion of Tir inenteropathogenic Escherichia coli. Mol. Microbiol. 33:1176–1189.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

26. Elliott, S. J., V. Sperandio, J. A. Giron, S. Shin, J. L. Mellies, L. Wain-wright, S. W. Hutcheson, T. K. McDaniel, and J. B. Kaper. 2000. The locusof enterocyte effacement (LEE)-encoded regulator controls expression ofboth LEE- and non-LEE-encoded virulence factors in enteropathogenicand enterohemorrhagic Escherichia coli. Infect. Immun. 68:6115–6126.

27. Forsbach-Birk, V., T. McNealy, S. Chunwei, D. Lynch, and R. Marre. 2004.Reduced expression of the global regulator protein CsrA in Legionellapneumophila affects virulence-associated regulators and growth in Acan-thamoeba castellanii. Int. J. Med. Microbiol. 294:15–25.

28. Foubister, V., I. Rosenshine, M. S. Donnenberg, and B. B. Finlay. 1994. TheeaeB gene of enteropathogenic Escherichia coli is necessary for signal trans-duction in epithelial cells. Infect. Immun. 62:3038–3040.

29. Friedberg, D., T. Umanski, Y. Fang, and I. Rosenshine. 1999. Hierarchy inthe expression of the locus of enterocyte effacement genes of enteropatho-genic Escherichia coli. Mol. Microbiol. 34:941–952.

30. Goldberg, M. D., M. Johnson, J. C. Hinton, and P. H. Williams. 2001. Roleof the nucleoid-associated protein Fis in the regulation of virulence prop-erties of enteropathogenic Escherichia coli. Mol. Microbiol. 41:549–559.

31. Grant, A. J., M. Farris, P. Alefounder, P. H. Williams, M. J. Woodward,and C. D. O’Connor. 2003. Co-ordination of pathogenicity island expressionby the BipA GTPase in enteropathogenic Escherichia coli (EPEC). Mol.Microbiol. 48:507–521.

32. Gruenheid, S., R. DeVinney, F. Bladt, D. Goosney, S. Gelkop, G. D. Gish,T. Pawson, and B. B. Finlay. 2001. Enteropathogenic E. coli Tir binds Nckto initiate actin pedestal formation in host cells. Nat. Cell Biol. 3:856–859.

33. Gutierrez, P., Y. Li, M. J. Osborne, E. Pomerantseva, Q. Liu, and K.Gehring. 2005. Solution structure of the carbon storage regulator proteinCsrA from Escherichia coli. J. Bacteriol. 187:3496–3501.

34. Guttman, J. A., Y. Li, M. E. Wickham, W. Deng, A. W. Vogl, and B. B.Finlay. 2006. Attaching and effacing pathogen-induced tight junction dis-ruption in vivo. Cell. Microbiol. 8:634–645.

35. Haack, K. R., C. L. Robinson, K. J. Miller, J. W. Fowlkes, and J. L. Mellies.2003. Interaction of Ler at the LEE5 (tir) operon of enteropathogenicEscherichia coli. Infect. Immun. 71:384–392.

36. Heeb, S., S. A. Kuehne, M. Bycroft, S. Crivii, M. D. Allen, D. Haas, M.Camara, and P. Williams. 2006. Functional analysis of the post-transcrip-tional regulator RsmA reveals a novel RNA-binding site. J. Mol. Biol.355:1026–1036.

37. Heroven, A. K., K. Bohme, M. Rohde, and P. Dersch. 2008. A Csr-typeregulatory system, including small non-coding RNAs, regulates the globalvirulence regulator RovA of Yersinia pseudotuberculosis through RovM.Mol. Microbiol. 68:1179–1195.

38. Huang, L. H., and W. J. Syu. 2008. GrlA of enterohemorrhagic Escherichiacoli O157:H7 activates LEE1 by binding to the promoter region. J. Micro-biol. Immunol. Infect. 41:9–16.

39. Ide, T., S. Laarmann, L. Greune, H. Schillers, H. Oberleithner, and M. A.Schmidt. 2001. Characterization of translocation pores inserted into plasmamembranes by type III-secreted Esp proteins of enteropathogenic Esche-richia coli. Cell. Microbiol. 3:669–679.

40. Iyoda, S., and H. Watanabe. 2005. ClpXP protease controls expression ofthe type III protein secretion system through regulation of RpoS and GrlRlevels in enterohemorrhagic Escherichia coli. J. Bacteriol. 187:4086–4094.

41. Jobichen, C., M. Li, G. Yerushalmi, Y. W. Tan, Y. K. Mok, I. Rosenshine,K. Y. Leung, and J. Sivaraman. 2007. Structure of GrlR and the implicationof its EDED motif in mediating the regulation of type III secretion systemin EHEC. PLoS Pathog. 3:e69.

42. Kalman, D., O. D. Weiner, D. L. Goosney, J. W. Sedat, B. B. Finlay, A. Abo,and J. M. Bishop. 1999. Enteropathogenic E. coli acts through WASP andArp2/3 complex to form actin pedestals. Nat. Cell Biol. 1:389–391.

43. Kenny, B., A. Abe, M. Stein, and B. B. Finlay. 1997. EnteropathogenicEscherichia coli protein secretion is induced in response to conditions sim-ilar to those in the gastrointestinal tract. Infect. Immun. 65:2606–2612.

44. Kenny, B., R. Devinney, M. Stein, D. J. Reinscheid, E. A. Frey, and B. B.Finlay. 1997. Enteropathogenic E. coli (EPEC) transfers its receptor forintimate adherence into mammalian cells. Cell 91:511–520.

45. Kenny, B., and B. B. Finlay. 1995. Protein secretion by enteropathogenicEscherichia coli is essential for transducing signals to epithelial cells. Proc.Natl. Acad. Sci. USA 92:7991–7995.

46. Kenny, B., L. C. Lai, B. B. Finlay, and M. S. Donnenberg. 1996. EspA, aprotein secreted by enteropathogenic Escherichia coli, is required to inducesignals in epithelial cells. Mol. Microbiol. 20:313–323.

47. Kerrinnes, T., Z. B. Zelas, W. Streckel, F. Faber, E. Tietze, H. Tschape, andS. Yaron. 2009. CsrA and CsrB are required for the post-transcriptionalcontrol of the virulence-associated effector protein AvrA of Salmonellaenterica. Int. J. Med. Microbiol. 299:333–341.

48. Knutton, S., M. M. Baldini, J. B. Kaper, and A. S. McNeish. 1987. Role ofplasmid-encoded adherence factors in adhesion of enteropathogenic Esch-erichia coli to HEp-2 cells. Infect. Immun. 55:78–85.

49. Knutton, S., T. Baldwin, P. H. Williams, and A. S. McNeish. 1989. Actinaccumulation at sites of bacterial adhesion to tissue culture cells: basis of anew diagnostic test for enteropathogenic and enterohemorrhagic Esche-richia coli. Infect. Immun. 57:1290–1298.

50. Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C.Wolff, G. Dougan, and G. Frankel. 1998. A novel EspA-associated surfaceorganelle of enteropathogenic Escherichia coli involved in protein translo-cation into epithelial cells. EMBO J. 17:2166–2176.

51. Kraiss, A., J. Blass, and J. Reidl. 1998. A suicide plasmid (pJR lacZins) fortargeted integration for non-native genes into the chromosome of Esche-richia coli. Tech. Tips Online 1:TO1249.

52. Kresse, A. U., F. Beltrametti, A. Muller, F. Ebel, and C. A. Guzman. 2000.Characterization of SepL of enterohemorrhagic Escherichia coli. J. Bacte-riol. 182:6490–6498.

53. Laaberki, M., N. Janabi, E. Oswald, and F. Repoila. 2006. Concert ofregulators to switch on LEE expression in enterohemorrhagic Escherichiacoli O157:H7: interplay between Ler, GrlA, HNS and RpoS. Int. J. Med.Microbiol. 296:197–210.

54. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

55. Lai, L. C., L. A. Wainwright, K. D. Stone, and M. S. Donnenberg. 1997. Athird secreted protein that is encoded by the enteropathogenic Escherichiacoli pathogenicity island is required for transduction of signals and forattaching and effacing activities in host cells. Infect. Immun. 65:2211–2217.

56. Lawhon, S. D., J. G. Frye, M. Suyemoto, S. Porwollik, M. McClelland, andC. Altier. 2003. Global regulation by CsrA in Salmonella typhimurium. Mol.Microbiol. 48:1633–1645.

57. Leverton, L. Q., and J. B. Kaper. 2005. Temporal expression of entero-pathogenic Escherichia coli virulence genes in an in vitro model of infection.Infect. Immun. 73:1034–1043.

58. Liu, M. Y., G. Gui, B. Wei, J. F. Preston, 3rd, L. Oakford, U. Yuksel, D. P.Giedroc, and T. Romeo. 1997. The RNA molecule CsrB binds to the globalregulatory protein CsrA and antagonizes its activity in Escherichia coli.J. Biol. Chem. 272:17502–17510.

59. Liu, M. Y., and T. Romeo. 1997. The global regulator CsrA of Escherichiacoli is a specific mRNA-binding protein. J. Bacteriol. 179:4639–4642.

60. Lodato, P. B., and J. B. Kaper. 2009. Post-transcriptional processing of theLEE4 operon in enterohaemorrhagic Escherichia coli. Mol. Microbiol.71:273–290.

61. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Proteinmeasurement with the Folin phenol reagent. J. Biol. Chem. 193:265–275.

62. Lucchetti-Miganeh, C., E. Burrowes, C. Baysse, and G. Ermel. 2008. Thepost-transcriptional regulator CsrA plays a central role in the adaptation ofbacterial pathogens to different stages of infection in animal hosts. Micro-biology 154:16–29.

63. McDaniel, T. K., and J. B. Kaper. 1997. A cloned pathogenicity island fromenteropathogenic Escherichia coli confers the attaching and effacing phe-notype on E. coli K-12. Mol. Microbiol. 23:399–407.

64. McNamara, B. P., A. Koutsouris, C. B. O’Connell, J. P. Nougayrede, M. S.Donnenberg, and G. Hecht. 2001. Translocated EspF protein from en-teropathogenic Escherichia coli disrupts host intestinal barrier function.J. Clin. Investig. 107:621–629.

65. Mellies, J. L., A. M. Barron, and A. M. Carmona. 2007. Enteropathogenicand enterohemorrhagic Escherichia coli virulence gene regulation. Infect.Immun. 75:4199–4210.

66. Mellies, J. L., A. M. Barron, K. R. Haack, A. S. Korson, and D. A. Oldridge.2006. The global regulator Ler is necessary for enteropathogenic Esche-richia coli colonization of Caenorhabditis elegans. Infect. Immun. 74:64–72.

67. Mellies, J. L., S. J. Elliott, V. Sperandio, M. S. Donnenberg, and J. B.Kaper. 1999. The Per regulon of enteropathogenic Escherichia coli: iden-tification of a regulatory cascade and a novel transcriptional activator, thelocus of enterocyte effacement (LEE)-encoded regulator (Ler). Mol. Mi-crobiol. 33:296–306.

68. Mercante, J., K. Suzuki, X. Cheng, P. Babitzke, and T. Romeo. 2006.Comprehensive alanine-scanning mutagenesis of Escherichia coli CsrA de-fines two subdomains of critical functional importance. J. Biol. Chem.281:31832–31842.

69. Moon, H. W., S. C. Whipp, R. A. Argenzio, M. M. Levine, and R. A.Giannella. 1983. Attaching and effacing activities of rabbit and humanenteropathogenic Escherichia coli in pig and rabbit intestines. Infect. Im-mun. 41:1340–1351.

70. Murphy, K. C., and K. G. Campellone. 2003. Lambda Red-mediated re-combinogenic engineering of enterohemorrhagic and enteropathogenic E.coli. BMC Mol. Biol. 4:11.

71. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin.Microbiol. Rev. 11:142–201.

72. O’Connell, C. B., E. A. Creasey, S. Knutton, S. Elliott, L. J. Crowther, W.Luo, M. J. Albert, J. B. Kaper, G. Frankel, and M. S. Donnenberg. 2004.SepL, a protein required for enteropathogenic Escherichia coli type IIItranslocation, interacts with secretion component SepD. Mol. Microbiol.52:1613–1625.

73. Ogino, T., R. Ohno, K. Sekiya, A. Kuwae, T. Matsuzawa, T. Nonaka, H.Fukuda, S. Imajoh-Ohmi, and A. Abe. 2006. Assembly of the type IIIsecretion apparatus of enteropathogenic Escherichia coli. J. Bacteriol. 188:2801–2811.

74. Pernestig, A. K., D. Georgellis, T. Romeo, K. Suzuki, H. Tomenius, S.


on Decem


.org/D

ownloaded from

http://iai.asm.org/

Normark, and O. Melefors. 2003. The Escherichia coli BarA-UvrY two-component system is needed for efficient switching between glycolytic andgluconeogenic carbon sources. J. Bacteriol. 185:843–853.

75. Pessi, G., F. Williams, Z. Hindle, K. Heurlier, M. T. Holden, M. Camara,D. Haas, and P. Williams. 2001. The global posttranscriptional regulatorRsmA modulates production of virulence determinants and N-acylhomo-serine lactones in Pseudomonas aeruginosa. J. Bacteriol. 183:6676–6683.

76. Poteete, A. R., and A. C. Fenton. 1984. Lambda red-dependent growth andrecombination of phage P22. Virology 134:161–167.

77. Rife, C., R. Schwarzenbacher, D. McMullan, P. Abdubek, E. Ambing, H.Axelrod, T. Biorac, J. M. Canaves, H. J. Chiu, A. M. Deacon, M. DiDonato,M. A. Elsliger, A. Godzik, C. Grittini, S. K. Grzechnik, J. Hale, E. Hamp-ton, G. W. Han, J. Haugen, M. Hornsby, L. Jaroszewski, H. E. Klock, E.Koesema, A. Kreusch, P. Kuhn, S. A. Lesley, M. D. Miller, K. Moy, E.Nigoghossian, J. Paulsen, K. Quijano, R. Reyes, E. Sims, G. Spraggon,R. C. Stevens, H. van den Bedem, J. Velasquez, J. Vincent, A. White, G.Wolf, Q. Xu, K. O. Hodgson, J. Wooley, and I. A. Wilson. 2005. Crystalstructure of the global regulatory protein CsrA from Pseudomonas putidaat 2.05 Å resolution reveals a new fold. Proteins 61:449–453.

78. Roe, A. J., H. Yull, S. W. Naylor, M. J. Woodward, D. G. Smith, and D. L.Gally. 2003. Heterogeneous surface expression of EspA translocon fila-ments by Escherichia coli O157:H7 is controlled at the posttranscriptionallevel. Infect. Immun. 71:5900–5909.

79. Romeo, T. 1998. Global regulation by the small RNA-binding protein CsrAand the non-coding RNA molecule CsrB. Mol. Microbiol. 29:1321–1330.

80. Romeo, T., M. Gong, M. Y. Liu, and A. M. Brun-Zinkernagel. 1993. Iden-tification and molecular characterization of csrA, a pleiotropic gene fromEscherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size,and surface properties. J. Bacteriol. 175:4744–4755.

81. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

82. Sekiya, K., M. Ohishi, T. Ogino, K. Tamano, C. Sasakawa, and A. Abe.2001. Supermolecular structure of the enteropathogenic Escherichia colitype III secretion system and its direct interaction with the EspA-sheath-like structure. Proc. Natl. Acad. Sci. USA 98:11638–11643.

83. Sharp, F. C., and V. Sperandio. 2007. QseA directly activates transcriptionof LEE1 in enterohemorrhagic Escherichia coli. Infect. Immun. 75:2432–2440.

84. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilisationsystem for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio/Technology 1:784–791.

85. Sircili, M. P., M. Walters, L. R. Trabulsi, and V. Sperandio. 2004. Modu-lation of enteropathogenic Escherichia coli virulence by quorum sensing.Infect. Immun. 72:2329–2337.

86. Sperandio, V., C. C. Li, and J. B. Kaper. 2002. Quorum-sensing Escherichiacoli regulator A: a regulator of the LysR family involved in the regulationof the locus of enterocyte effacement pathogenicity island in enterohemor-rhagic E. coli. Infect. Immun. 70:3085–3093.

87. Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999.

Quorum sensing controls expressionof the type III secretion gene transcrip-tion and protein secretion in enterohemorrhagic and enteropathogenicEscherichia coli. Proc. Natl. Acad. Sci. USA 96:15196–15201.

88. Sperandio, V., A. G. Torres, J. A. Giron, and J. B. Kaper. 2001. Quorumsensing is a global regulatory mechanism in enterohemorrhagic Escherichiacoli O157:H7. J. Bacteriol. 183:5187–5197.

89. Sperandio, V., A. G. Torres, B. Jarvis, J. P. Nataro, and J. B. Kaper. 2003.Bacteria-host communication: the language of hormones. Proc. Natl. Acad.Sci. USA 100:8951–8956.

90. Sperandio, V., A. G. Torres, and J. B. Kaper. 2002. Quorum sensing Esch-erichia coli regulators B and C (QseBC): a novel two-component regulatorysystem involved in the regulation of flagella and motility by quorum sensingin E. coli. Mol. Microbiol. 43:809–821.

91. Suzuki, K., P. Babitzke, S. R. Kushner, and T. Romeo. 2006. Identificationof a novel regulatory protein (CsrD) that targets the global regulatoryRNAs CsrB and CsrC for degradation by RNase E. Genes Dev. 20:2605–2617.

92. Suzuki, K., X. Wang, T. Weilbacher, A. K. Pernestig, O. Melefors, D.Georgellis, P. Babitzke, and T. Romeo. 2002. Regulatory circuitry of theCsrA/CsrB and BarA/UvrY systems of Escherichia coli. J. Bacteriol. 184:5130–5140.

93. Swimm, A., B. Bommarius, Y. Li, D. Cheng, P. Reeves, M. Sherman, D.Veach, W. Bornmann, and D. Kalman. 2004. Enteropathogenic Escherichiacoli use redundant tyrosine kinases to form actin pedestals. Mol. Biol. Cell15:3520–3529.

94. Umanski, T., I. Rosenshine, and D. Friedberg. 2002. Thermoregulatedexpression of virulence genes in enteropathogenic Escherichia coli. Micro-biology 148:2735–2744.

95. Uzzau, S., N. Figueroa-Bossi, S. Rubino, and L. Bossi. 2001. Epitope tag-ging of chromosomal genes in Salmonella. Proc. Natl. Acad. Sci. USA98:15264–15269.

96. Wachter, C., C. Beinke, M. Mattes, and M. A. Schmidt. 1999. Insertion ofEspD into epithelial target cell membranes by infecting enteropathogenicEscherichia coli. Mol. Microbiol. 31:1695–1707.

97. Wang, X., A. K. Dubey, K. Suzuki, C. S. Baker, P. Babitzke, and T. Romeo.2005. CsrA post-transcriptionally represses pgaABCD, responsible for syn-thesis of a biofilm polysaccharide adhesin of Escherichia coli. Mol. Micro-biol. 56:1648–1663.

98. Wei, B. L., A. M. Brun-Zinkernagel, J. W. Simecka, B. M. Pruss, P.Babitzke, and T. Romeo. 2001. Positive regulation of motility and flhDCexpression by the RNA-binding protein CsrA of Escherichia coli. Mol.Microbiol. 40:245–256.

99. Weilbacher, T., K. Suzuki, A. K. Dubey, X. Wang, S. Gudapaty, I. Morozov,C. S. Baker, D. Georgellis, P. Babitzke, and T. Romeo. 2003. A novel sRNAcomponent of the carbon storage regulatory system of Escherichia coli.Mol. Microbiol. 48:657–670.

100. Wilson, R. K., R. K. Shaw, S. Daniell, S. Knutton, and G. Frankel. 2001.Role of EscF, a putative needle complex protein, in the type III proteintranslocation system of enteropathogenic Escherichia coli. Cell. Microbiol.3:753–762.

Editor: A. J. Baumler


on Decem


.org/D

ownloaded from

http://iai.asm.org/

the rna binding protein csra is a pleiotropic regulator of ... · csra, have a putative csra...

Documents