Visualization of genomic data

Genome browsers

•UCSC browser

• Ensembl browser• Others ?

Survey

UCSC genome browserBasic functionalities used in exercise

• Finding a gene• by name

• by sequence

• Gene structure

• Orthologues – i.e. functional homolog in other organisms

• SNP’s - Single Nucleotide Polymorphisms

• Several other functionalities

• Gene Sorter - sort according to expression, homology, in situ images of genes in different tissues

• Custom tracks – upload your own data

Visualization of genomic data

Genome browsers

Genome browsersVisualization of a gene

>chr5:123.004.678-125.345.112ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCCTTCCCGCTGCCCGCCGGTAAGAGGCCTCCCGAGGCGCCCGCCGAAGACCGCTCCCTCGGCCGCCGCCGCGCGCCCTTCGCGCTGAGCAGTGACTGTAAGAACCGTTCCCTCCCCGCGGGGGGGCCGCCGGCGGACCCCCTCGCACCCCCACCCGCAGCCAGCCCCGCACGTACCCCAAGCCAGCCTGATGGCTGTGTGGCCTACCGACCCGTGGGCAAGGGGTGCGGGTGCTGAAGCCCCCAGGGGTGCCTGGCTGCCCACTGCTGCCCGCACGCCTGGCCTGAAAGTGACACGCGCTGGTTTGCCCAGCACAGAGGGGATGGAATTTTTATGCTGCTCCTTTAGCATTCTGATGAACAAATATCCTCCCCACCAGCACCACCACCTCAGTAA

Chr5 123.004.678 123.404.678 124.987.012 125.345.112

Open Reading Frame (ORF) – from start to stop codon

Flat files / tab files

Exon

Exon

Intron

Genome browsersWhy graphic Display ?

Why is a graphic display better than Flat files / tab files• A graphic display is compact• Meta data available i.e. Support information about a gene• Experimental evidence like EST• Predicted gene structures• SNP information• Links to many databases

In short much data about a gene is gathered is one placeand can be viewed easily.

Genome browsersVisualization of a gene (Ensembl)

Genome browsersVisualization of a gene (UCSC)

Exon Intron UTR

• UCSC genome browser• http://genome.ucsc.edu/

• Easy to use

• Often updates, but not as often as Ensembl

• upload of personal tracks

• Ensembl browser

• http://www.ensembl.org/index.html

• Less easy to use

• Maintained/updated by several people

• Gbrowser

• http://www.gmod.org/GBrowse

Genome browsers

BLATBlast Like Alignment Tool

• BLAT (2002)• Very fast searches (MySQL database)• Handle introns in RNA/DNA alignments• Data for more that 30 genomes (human, mouse, rat…)

Exon Intron Exon

Splice sites

BLAT genome Browserhttp://genome.ucsc.edu//

BLAT genome Browser

Using a search term or position eg Chr1:10,234-11,567

BLAT genome Browserhttp://genome.ucsc.edu/

BLAT genome Browser

Using a protein or DNA sequence

Blat genome Browser

BLAT genome Browser”Details”

Correct splice site ?

Logo PlotInformation Content

IC = -H(p) + log2(4) = a palog2pa + 2

The Information content is calculated from a multiple sequence alignment.

Result is a graphical visualization of sequence conservation where:• Total height at a position is the Information Content• Height of single letter is proportional to the frequency of that

letter

Mutiple alignment of 3 protein sequences:Seq1: A L R K P Q R TSeq2: A V R H I L L ISeq3: A I K V H N N T

Pos1: I = -[1*log2(1)]+ 4.32 = log2(20) = 4.32Pos2: I = -[1/3*log2(1/3)+ 1/3*log2(1/3)+ 1/3*log2(1/3)] + 4.32 = 2.73Pos3: I = -[2/3*log2(2/3)+ 1/3*log2(1/3) + 4.32 = 3.38

Logo Plot

Exon

BLAT genome Browser”Details”

Correct splice site ?

BLAT genome Browser”Details”

Donor site | Acceptor siteexon... . G | GT ...intron ...AG | exon...

Blat genome Browser

BLAT genome Browser”Browser”

Base,Center &ZoomKnown genes

Predictions

RNA

EST

Conservation

Expression

Genome browsers

Genome browsers

BLAT genome BrowserCenter & zoom

BLAT genome BrowserCenter & zoom

Forward/reverse directionSelected number of tracks

BLAT genome BrowserSequence Orthologs

BLAT genome BrowserSequence Orthologs

“klick”

BLAT genome BrowserSequence Orthologs

BLAT genome BrowserSequence Orthologs

BLAT genome BrowserSequence Orthologs

SNPs

Single Nucleotide PolymorphismSNP

• SNPs can be located anywere in the genome• non synomous (nsSNP) i.e. amino acid is changed (shown below )• Synomous SNP does not affect the the protein

An amino acid is coded by 3 nucleotidesValine (V): GTC

V I T

P

Humans are diploid: cells have 2 homologous copies of each chromosome i.e. 2*23 chromosomes. Haploid cells only 23 chromosomes (sex-cells)

Diploid organism - most mammals

A chromosome from mother

If the red strand is the plus-strand: C;T (or T;C but we write it alphabetical)If the green strand is the minus strand: G;A but we write it as G;A

A chromosome from father

An example of two homologous copies of ex chromosome 9 within a cell

SNPs

SNPs

Exercise

1. Basic understanding of the graphics2. Effect of Single Nucleotide Polymorphisms (SNPs)3. Finding Orthologue genes4. Identify chromosomal locus for a gene