8.pdf

International Journal of Microbiological Research 5 (3): 190-197, 2014ISSN 2079-2093© IDOSI Publications, 2014DOI: 10.5829/idosi.ijmr.2014.5.3.8677

Corresponding Author: Dr. Rafiq Lone, School of Studies in Botany, Jiwaji University Gwalior (M.P) - 474011, India.

189

Taxonomic Characteristic of Arbuscular Mycorrhizal Fungi-A Review

Rafiq Lone, Shuchi Agarwal and K.K. Koul

School of Studies in Botany, Jiwaji University Gwalior (M.P)-474011, India

Abstract: Arbuscular mycorrhizal fungi (AMF) have mutualistic relationships with more than 80% of terrestrialplant species. Despite their abundance and wide range of relationship with plant species, AMF have shownlow species diversity. AMF have high functional diversity because different combinations of host plants andAMF have different effects on the various aspects of symbiosis. Because of wide range of relationships withhost plants it becomes difficult to identify the species on the morphological bases as the spores are to beextracted from the soil. This review provides a summary of morphological and molecular characteristics on thebasis of which different species are identified.

Key words: AMF Taxonomic Characteristics

INTRODUCTION structure and the manner of colonization of roots have

The fungi forming arbuscules in roots of terrestrial found that some taxa are both arbuscular mycorrhizal,plants always created great taxonomic problems, in the host roots, whereas other species of mycorrhizaemainly because of difficulties to extract their spores from lacked vesicles. The first taxonomic key for thethe soil and to maintain the fungi in living cultures. recognition of the types of the endogonaceous sporesPeyronel [1] was first to discover the regular occurrence has been prepared by Mosse and Bowen [6].of both associations that of the spores and The Endogonaceae was revised by Gerdemann andsporocarps of the first described family Trappe in [7]. He maintained the family in the orderEndogonaceae from vesicular-arbuscular mycorrhizae Mucorales comprising, 44 species in seven genera.of plants. He suggested that the fungi can be Amongest these, many a taxa were redefined. Two generaconsidered as the proginators of the mycorrhizae.The Acaulospora and Gigaspora and 12 species werefirst monograph of the family Endogonaceae Paol. placed described novo. The genus Endogone containedin the order Mucorales (Zygomycetes) was prepared by 11 species with zygospores arranged in sporocarps.Thaxter [2]. Fungi of this family were described in four Two of these, E. lactiflua Berk. and Broom andgenera which produced spores in the sporocarps. The E. flammicorona Trappe and Gerd., are ectomycorrhizaefour genera being those of Endogone Link: Fries; Glaziella [7-9]. Therefore, according to Gerdemann and Trappe [7],Berk.; Sclerocystis Berk. and Br.; and Sphaerocreas Sacc. the other Endogone species were ectomycorrhizal orand Ellis. The existing genera included both saprotrophic fungi.chlamydosporic and zygosporic species of fungi. Thaxter The genus Glomus with 19 species, then with two[2] and Godfrey [3], however, considered chlamydosporic varieties of G. macrocarpus, i.e., G. macrocarpus var.species to be anamorphs of those producing zygospores, macrocarpus and G. macrocarpus var. geosporus,following the finding of both types of spores in originally erected by Tulasne and Tulasne [10] and thesporocarps of the present day Glomus fasciculatum earlier genus Sclerocystis with four taxa contained speciesnomenclated as Endogone fasciculata and E. microcarpa. forming chlamydospores blastically at hyphal tips.

Sizable data of the biology of fungi belonging to In contrast to sporocarpic Sclerocystis spp.,family Endogonaceae has been generated from their the chlamydospores of the members of genus Glomusstudies in pot cultures. The mode of germination of have been considered to occur mainly in loosespores of these fungi, their life cycles, subcellular spore aggregates or singly in the soil, although the genus also

been recognized as the main characters [4, 5]. It has been

Intl. J. Microbiol. Res., 5 (3): 190-197, 2014

190

included species forming compact sporocarps with or Since 1984, the genera Glaziella and Modicellawithout a peridium. Species of the genus Glomus were not considered to be members of the familyhave been found to form vesicular-arbuscular or only Endogonaceae. The presence of septa in fragments ofarbuscular mycorrhizae. The distinctive property of sporocarps of Glaziella aurantiaca (Berk. and Curtis),members of the genus Sclerocystis was the production Cooke has decided that the fungus has first beenof chlamydospores arranged in a single layer around a transferred to Deuteromycotina [21] and then to a newcentral, spore-free plexus. The newly erected genera order, Glaziellales with one family, Glaziellaceae [22].Acaulospora and Gigaspora have been defined by The genus Modicella has been transferred to theGerdemann and Trappe [7] as forming azygospores singly Mortierellaceae [23].in the soil, although no parthenogenetical process of Walker and Sanders [24] separated the genusspore development was observed. Acaulospora spp. Scutellospora from the genus Gigaspora, with fungiproduced spores laterally on the neck of a sporiferous forming spores having at least one inner germination wallsaccule and species of the genus Gigaspora formed and later containing species with spores lacking an innerspores terminally at the tip of an inflated, germination wall having no physical contact with theirbulbous sporogenous hypha. The genera Glaziella and main, structural wall. Modicella Kanouse were represented by chlamydosporic Morton and Benny [25] transferred soil-borne fungi,and sporangial species, respectively. forming arbuscules in roots of terrestrial plants, to a new

Ames and Schneider [11] erected a new genus in order-Glomales (orthographically corrected to Glomeralesthe Endogonaceae, Entrophospora with a species E. by Schubler et al. [26], consisting of two suborders,infrequens which earlier existed in the genus Glomus, Glomineae J.B. Morton and Benny and Gigasporineaeas G. infrequens [12]. Spores of E. infrequens were J.B. Morton and Benny. The Glomineae suborderformed inside the neck of a sporiferous saccule. In the consisted of the type family Glomaceae, with the generasame year, Benjamin [13] redefined the order Mucorales, Glomus and Sclerocystis and the Acaulosporaceae fam.by retaining in it mainly the saprotrophs or nonhaustorial nov., containing the genera Acaulospora andparasites that reproduce asexually by sporangia, Entrophospora. The suborder Gigasporineae wassporangiola, merosporangia and sometimes by proposed to include the Gigasporaceae fam. nov. withchlamydospores, arthrospores and yeast-like cells. the genera Gigaspora and Scutellospora. Apart fromConsequently, he transferred the family Endogonaceae to differences in the mode of formation of spores and theirthe order Endogonales established by Moreau [14]. subcellular structure, the taxa of the suborder GlomineaeWalker [15] proposed to establish a monotypic genus in distinguished the ability to form vesicles that did notthe Endogonaceae, Complexipes with single species, occur in mycorrhizae of members of the suborderC. moniliformis C. Walker. The ornamented Glomus-like Gigasporineae. Fungi of the genus Endogone remained inspores of C. moniliformis were isolated from the root zone the family Endogonaceae of the order Endogonalesof Parthenocisus quinquefolia (L.) Planch. growing in a containing such forms which produced only zygosporespine plantation. No properties of mycorrhizae of this in compact sporocarps. Almeida and Schenck [27],fungus were recognized. The spores morphologically concluded that, except for Sclerocystis coremioides,resembled “crenulate spores” found by Mosse and a continuum of morphological properties exists betweenBowen [6] in New Zealand and Australia and those of sporocarpic Glomus species and the other members of thethe E-strain fungi associated with ectomycorrhizae of genus Sclerocystis. As a result, the five-species genustrees of the genus Pinus [16, 17]. However, Sclerocystis was reduced to a one having a single-speciesDanielson [18] suggested C. moniliformis to belong to by them.the Ascomycota. Young and Wilcox [19] classified the Redecker et al. [28] utilizing both morphological andE-strain fungi and C. moniliformis to a new species of the molecular data, transferred Sclerocystis coremioides to thegenus Tricharina Eckblad, T. mikolae Chin S. Yang and genus Glomus and, thereby, eliminated the genusH.E. Wilcox (Discomycetes, Ascomycota). Subsequently, Sclerocystis from the Kingdom Fungi.Yang and Korf [20] segregated from the genus Tricharina Two new families of Archaeosporaceae and witha new taxon, Wilcoxina Chin S. Yang and Korf gen. nov. order Glomales (now Glomerales) Paraglomaceae (now(Pezizales) with anamorphic chlamydospores of the Paraglomerae) were eraeted by Morton and RedeckerE-strain fungi and C. moniliformis. [29] on the basis of the molecular, morphological


191

and biochemical investigation. Despite similarities in Entrophospora R.N. Ames and R.W. Schneid. emend.mycorrhizal morphology each of these families was Oehl and Sieverd.phylogenetically distant from each other and from Gigasporaceae J.B. Morton and Bennyother glomalean families. The family Archaeosporaceae Gigaspora Gerd. and Trappe emend. C. Walker and F.E.contained one genus, Archaeospora, with three species Sandersforming a typical Acaulospora-like spores from the neck Scutellospora C. Walker and F.E. Sandersof a sporiferous saccule. Two of these species, Pacisporaceae C. Walker, Blaszk., Schuessler andA. gerdemannii and A. leptoticha, were considered to be Schwarzottdimorphic, since there formed Glomus-like spores as well. Pacispora Oehl and Sieverd.The genus Paraglomus in the family Paraglomaceae (now Glomerales J.B. Morton and BennyParaglomeraceae) consisted of two species producing Glomeraceae Piroz. and Dalpespores indistinguishable from those of the species of Glomus Tul. and C. Tul.Glomus. Paraglomerales C. Walker and Schuessler

The classification of arbuscular fungi presented here Paraglomaceae J.B. Morton and D. Redeckeris basically that of Schubler et al. [26] with later amended Paraglomus J.B. Morton and D. Redeckerby Oehl and Sieverding [30], Walker and Schubler[31], Sieverding and Oehl [32], Spain et al. [33], Walker et The fungi of the order Archaeosporales either formal. [34] and Palenzuela et al.[ 35]. In this system of endocytosymbioses with photoautotrophic prokaryotesclassification, fungi producing or considered to (Geosiphon pyriformis) or produce mycorrhizae withproduce arbuscular mycorrhizae are placed in the arbuscules, both with or without vesicles. Their sporesPhylum Glomeromycota having Glomeromycetes as class. are colourless and do not react with Melzer’s reagent.This class comprises four orders Archaeosporales, Glomoid sporeswhich are identical to those of AMFDiversisporales, Glomerales, Paraglomerales with a total genus Glomus are formed singly or in clusters both on ordistribution of ten families. These families include thirteen under the soil surface. Acaulosporioid spores, similar togenera [26, 30-35]. The earlier relationships of the fungi those of the members of the genus Acaulospora, developwith Zygomycota, as described in the preceding pages, singly but in the soil. This group of AMF differ from otherstands revised presently, since molecular investigations arbuscular fungi by the possession of the rRNArelate these more closely with the members of the Phyla SSU gene signature YCTATCYKYCTGGTGAKRCG,Ascomycota and Basidiomycota. showing homology to the position 691 of the

Glomeromycota C. Walker and Schuessler J01353, with the coloured nucleotides being specific forGlomeromycetes Cavalier-Smith the AMF taxon. The order Archaeosporales containsArchaeosporales C. Walker and Schuessler three families, Archaeosporaceae with the generaAmbisporaceae C. Walker, Vestberg and Schuessler Archaeospora and Intraspora, Ambisporaceae with theAmbispora Spain, Oehl and Sieverd genus Ambispora and Geosiphonaceae with the genusArchaeosporaceae J.B. Morton and D. Redecker emend. Geosiphon.Oehl and Sieverd. Archaeospora J.B. Morton and D. Members of the order Diversisporales formRedecker Intraspora Oehl and Sieverd. mycorrhizae with arbuscules, frequently lacking vesicles,Geosiphonaceae Engler. and E. Gilg emend. Schuessler with or without auxilliary cells. Spores develop eitherGeosiphon (Kütz.) F. Wettst. inside as entrophosporioid spores of the generaDiversisporales C. Walker and Schuessler Entrophospora and Kuklospora or laterally on the neck ofAcaulosporaceae J.B. Morton and Benny a sporiferous saccule such as acaulosporioid spores ofAcaulospora Gerd. and Trappe emend. S.M. Berch the genus Acaulospora and Otospora, also either fromKuklospora Oehl and Sieverd. a bulbous base on the sporogenous hypha likeAcaulospora Gerd. and Trappe emend. S.M. Berch gigasporioid spores of the genera Gigaspora andDiversisporaceae C. Walker and Schuessler Scutellospora, or blastically at the tip of a sporogenousDiversispora C. Walker and Schuessler hypha such as the glomoid spores of the generaOtospora Oehl, J. Palenzuela and N. Ferrol Diversispora and Pacispora. They differ from otherEntrophosporaceae Oehl and Sieverd. arbuscular fungi by the possession of the rRNA

Saccharomyces cerevisiae SSU r RNA sequence


192

SSU gene sequence signature YVRRYW/1-5/NGYYYGB, Moprhological Characters of AMF Fungal Spores:corresponding to homologous position 658 of the The AMf spores were described and characterized on theS. cerevisiae SSU rRNA sequence J01353 SSU rRNA, basis of their morphological and biochemical charactersGTYARDYHMHYY/2-4/GRADRKKYGWCRAC, by Spain et al. [33]; Morton [37] and Walker and Sanderscorresponding to homologous position of the [24].S. cerevisiae SSU rRNA sequence position 1346 of Spores of arbuscular fungi contain structures eachthe S. cerevisiae SSU rRNA sequence J01353, having a unique phenotypic property. According toTTATCGGTTRAATC, corresponding to homologous Morton [37], each spore, regardless of species, forms oneposition 650 of the S. cerevisiae rRNA SSU sequence spore wall. Additionally, all species of the generaJ01353 and ACTGAGTTMATYT, corresponding to Acaulospora, Ambispora, Archaeospora, Entrophospora,homologous position 1481 of the S. cerevisiae Gigaspora, Intraspora, Kuklospora, Pacispora andrRNA SSU sequence J01353 with the coloured Scutellospora produce spores with 1-3 inner wallsnucleotides being specific for the taxon. The order called “germinal walls”. Expect for Gigaspora spp.,Diversisporales is represented by five families, where germinal wall is physically merged with the sporeDiversisporaceae with the genera Diversispora and wall, the spores of other genera have germinal wallsOtospora, Acaulosporaceae with the genera Acaulospora arising and then functioning independently of their sporeand Kuklospora, Entrophosporaceae with the genus wall.Entrophospora, Gigasporaceae with the genera Gigasporaand Scutellospora and Pacisporaceae with the genus Spore Wall: The spore wall in originates from the tip ofPacispora. sporogenous hypha whereas Diversispora, Glomus,

Fungi of the order Glomerales are usually hypogeous Gigaspora, Pacispora, Paraglomus and Scutellospora spp.,and rarely epigeous. They produce mycorrhizae with in Entrophospora, Intraspora, Kuklospora and somearbuscules, vesicles and spores. Spores are formed either Glomus spp. produce spores intercalary. It arises from theblastically at the tip of a sporogenous hypha or side of the hyphae in Acaulospora, Ambispora,intercalary within the hyphae. Spores occur singly Archaeospora and Otospora spp. With the increasingor in clusters or sporocarps having a peridium. diameter of the spore the spore wall grows, thickens andThey differ arbuscular fungi by the possession of the differentiates into its structures and ceases as the sporerRNA SSU gene sequence signature YTRRY/2- growth maximizes. Post maturity changes observed are5/RYYARGTYGNCARCTTCTTAGAGGGACTATCGGT minor viz. changes in the colour, thickness and rigidity.GTYTAACCGRTGG, corresponding to homologous The spore wall of the species of arbuscular fungiposition 1353 of the S. cerevisiae SSU rRNA sequence recognized consists of at least two layers while althoughJ J01353, with the coloured nucleotides being specific for some species many differentiate in a 4-layered spore wall.the taxon. The order Glomerales includes one genus, The wall of the most juvenile spores may be 1-orGlomus. 2-layered, however, in Acaulospora. gerdemannii,

Species of the order Paraglomerales form arbuscular spore wall layer 2 forms first and then an outer layermycorrhizae, rarely with vesicles. Spores are glomoid and originates de novo [29]. The spore wall layers andcolourless. The fungi differ from other arbuscular fungi by germinal walls may differ both in phenotypic andthe possession of the rRNA SSU gene sequence biochemical properties. signature GCGAAGCGTCATGGCCTTAACCGGCCGT, Eight phenotypes of spore wall layers are recognized.corresponding to homologous position 703 of the S.cerevisiae SSU rRNA sequence J01353, with the coloured Mucilagenous layer: This layer forms the sporenucleotides being specific for the taxon. The order surface of e. g. Glomus claroideum, Gl. mosseae andParaglomerales is represented by a monotypic family, Gl. multiforum. In juvenile spores, this layer isParaglomeraceae, containing single genus, Paraglomus. smooth or slightly roughened.

At present, the number of described species ofarbuscular fungi is about 200. According to Morton et al. Semiflexible layer: A semiflexible layer usually is[36], the number of species of this group of fungi may thin, somewhat less flexible than thin, flexible layerscome up to 2700. present in inner germinal walls of species of the


193

genera, Acaulospora and Scutellospora. In crushed Laminate layer: A laminate layer is a consination ofspecimens, the semiflexible layer frequently detaches usually very thin, <0.5 µm, tightly adherentfrom a layer adherent to its lower surface and does sublayers. It may be colourless through the entire lifenot wrinkle as a flexible layer (see, e. g., G. arenarium). of a fungus, as, in Paraglomus laccatum and GlomusWhen the semiflexible layer covers a laminate spore diaphanum, or may gradually darken because of thewall layer, its longevity is higher than that of a addition of next, coloured sublayers. Both the uppermucilaginous layer, although this layer rarely is and the lower surface of the laminate layer may bepresent intact or at all in mature spores. Generally, in smooth or ornamented with processes as seen inspecies having a semiflexible layer, it is smooth when Entrophospora infrequens and G. pansihalos or asnot deteriorated. In Gl. multiforum, the lower surface pits in Acaulospora cavernata, A. lacunosa,of the semiflexible layer is ornamented producing G. insculptum and G. multiforum. In species of theingrowths from the base to form pits in the upper genera Diversispora, Gigaspora, Glomus, Pacispora,surface of the next laminate layer. Paraglomus and Scutellospora, the laminate layer is

Other deteriorating and sloughing layers: hypha or the sporogenous cell. Except for membersThese layers form a spore surface and are more or of the genera Acaulospora and Entrophospora,less persistent. In young and sometimes in mature the spore wall of species of the other genera of thespores, these layers resemble a unit layer. However, Glomeromycota contain only one laminate layer.with time, these layers always deteriorate and In most of the Acaulospora spp., their 3-layeredfrequently are absent in older spores. In some spore wall contains two inner laminate layers. In thespecies sloughing layer is ornamented with spore wall of E. infrequens, second layer too is finelyblister-like processes that deteriorate and disappear laminate. The permanent laminate layer generally iswith time for example in the species of Acaulospora, the main structure protecting the spore inside fromAppendicispora, Archaeospora, Entrophospora, the influence of different abio-and biotic stresses.Intraspora, Kuklospora and Otospora the sloughing In E. infrequens, the second laminate spore wall layerlayer is continuous with the wall of the neck of a deteriorates with age and is frequently completelysporiferous saccule. sloughed in mature spores.

Another type of age related deteriorating and Layer: This phenotype is a thin, ca. 0.5 µm thick andsloughing layer is one which expands in the lactic flexible structure, usually wrinkling in spores crushedacid-based mountants. It was originally found in the wall in PVLG. The layer resembles flexible layers ofstructure of spores of G. pansihalos [38]. This layer also germinal walls of spores of fungi of the generaoccurs in spores of A. morrowiae and G. arenarium Acaulospora, Ambispora, Archaeospora,[37, 39]. Entrophospora, Intraspora, Kuklospora, Otospora,

Unit layer: This layer is a uniform and a persistent from the inner surface of the subtending hyphalstructure. It may be colourless, as, e. g., in wall continuous with the spore wall and notAcaulospora thomii, or coloured, as, e. g., in independently on the spore wall, as in in spores ofGigaspora gigantea. In some species, this layer is the genera listed above. The flexible layer occurs inornamented as like warts in Scutellospora persica. the wall structure of spores of, G. claroideum andSometimes, the unit layer is very thin and shows G. lamellosum.similar colour as its penultimate layer in S. pellucida.This can mislead in the omission of the layer, Germinal Wall: Germinal walls produced by the AMF ofsimilarly coloured as its penultimate layer, as, e. g., in. the genera Acaulospora, Ambispora, Archaeospora,Hence, this layer may be easily omitted. Entrophospora, Gigaspora, Intraspora, Kuklospora,

Granular layer: This structure is reported uniquely germinal walls in the species described ranges from 1 toin G. caledonium was revealed only in the wall 3. Each wall consists of 1-3 layers. The first germinal wallstructure of spores of as third layer in a four layered forms after the synthesis of the spore wall is completedsporewall. It is seen as a thide, but like unit layer in and has no physical connection with the spore. The nextmildly crushed spores. wall too originates similarly, but only after the first one is

continuous with the laminate layer of the subtending

Pacispora and Scutellospora. However, it originates

Otospora, Pacispora and Scutellospora. The number of


194

fully differentiated. The germinal layers of all species are Thick, Flexible Layer: Walker and Sanders [24] called itcolourless. In most of the taxa the components of the “coriaceous wall”. It was described as having a leather-germinal walls, whenever formed, are more or less flexible. like appearance in hypertonic solutions. While the outerWith the increasing ability of spores to germinate, and inner surfaces of the innermost germinal wall of the 3the germinal wall/s also condition themselves to layered spore constitute the knobby and breeded layerscomplete differentiation. In members of the genus respectively. This part is the middle of the same layerGigaspora, a germ tube directly originates from the such as in the spores of Acaulospora cavernata andgerminal wall which is tightly adhered to the spore wall. Paraglomus scintillans.In comparision the of other genera, forming at least onegerminal wall, germ tubes grow from earlier produced Plastic Layer: The plastic layer was described as “anpre-germination structures. Variously called "germination amorphous wall” by Morton [40]. This layer is highlyorb" in Acaulospora and Kuklospora spp., germination plasticand is not disturbed by applied pressure to sporesshield in Pacispora and Scutellospora spp., or germination while being crushed in lactic acid-based mountants. It isstructure in A. appendicula. These pre-germination always the innermost layer in the subcellular structure ofstructures are placed on the upper surface of the spores of the genera Acaulospora, Kuklospora andinnermost germinal wall where more than such wall is Scutellospora.present. However, no pre-germination structures havebeen reported in the spores of Entrophospora, Thin, Rigid Layer: In 1-layered germinal wall spores, forIntraspora and Otospora spp. till date. example in Acaulospora gedanensis a thin, rigid layer

Six phenotypes of layers are revealed in the germinal forms the first. Such layers also occur in the middle of thewalls of the species of arbuscular fungi. 2-layered germinal walls of the spores of example A.

Smooth, Thin, Flexible Layer: Although this germinal gedanensis, Ap. fennica and A. Gerdemannii. This layerslayer is smooth, thin, ca. 0.5 µm thick, it looks wrinkled is smooth and in A. appendicula they are ornamented withonce the spores are crushed in PVLG. In most arbuscular a convex, alveolate reticulum, unlike all the other speciesfungi, this layer seems to be a tightly adhered second of AMF, producing spores with flexible or semiflexiblelayer of almost similar properties, therefore, may be germinal walls, this type of layeris highly fragile than theerroneously interpreted as a single layer, instead of being other ones described above. be layered.

Ornamented, Thin, Flexible Layers: Two phenotypes of types of pre-germination structures, from which germornamented, thin, flexible, layers have so far been tubes arise, were recognized in AMF.reported; a beaded layer and a knobby layer. The beadedlayer commonly is the part of the innermost germinal wall Germination Orb: A germination orb is formed by aof the spores of genera Acaulospora and Kuklospora. It centrifugally rolled, hyaline to light-coloured hypha. Theis thin, ca. 0.5 µm thick and covered with granular orb is usually circular or somewhat elliptic when seen instructures excrescences (beads) that frequently disperse a plane view and located on the upper surface of thewhere the spores are crushed. In spore with three layered innermost germinal wall when observed in a cross view.germinal wall, the outer surface of the innermost layer is The germination orb is a transient structure andthe knobby layer, for example as in A. cavernata. This decomposes to a completely unrecognizable structure insurface resembles as if a plastic covering on the inner older spores. Such orbs are reported only in a few speciessurface of the inner most germinal layer: in one layered of the genus Acaulospora and Kuklospora. germinal wall spores like G. gigantea, this single layer initself show such an orientation of the knobby layer. Germination Shield: Except for the germination shield of

Thin, Semiflexible Layer: The semiflexible germinal layer other species of the genus Scutellospora are thin, uniform,is somewhat more rigid than the flexible layer and does elliptic or cardioid, hyaline to coloured lobes with a morenot wrinkle in crushed spores. The semiflexible layer or less incurved or incised margin. They commonly occuroccurs alone or adheres to another semiflexible layer in in mature spores of the species of genus Scutellospora.some species of the genera Acaulospora, e. g. in A. mellea The formation of this structure on the upper surface of theand A. scrobiculata and Kuklospora. innermost germinal wall ends the on to genetical

appendicula, A. fennica and A. gerdemannii. In Ac.

Pre-Germination Structures: As already mentioned three

spores of S. projecturata, the germination shields of the


195

development of spores of these fungi. Unlike orbs the REFERENCESgermination shields do not deteriorate with age.Kramadibrata et al. [41] have reported the formation of 1. Peyronel, B., 1923. Fructification de l’endophyte àshield by the coiled hyphae resembling therefore, the vésicules des mycorrhizes endotrophes. Bull. Soc.germination orbs of Acaulospora and Kukulospora Myc. de France 39.genus, in the species S.projecturata. Of the other 2. Thaxter, R., 1922. A revision of the Endogonaceae.members of the Phylum Glomeromycota, only P. Proc. Am. Acad. Arts. Sci.. 57: 291-351. scintillans and P. franciscana were found to form 3. Godfrey, R.M., 1957. Studies of British species ofgermination shields resembling in appearance to those of Endogone. I. Morphology and taxonomy. Trans. Br.the species of Scutellospora. However, like orbs of Mycol. Soc., 40: 117-135. Acaulosporathe germination shields in these species 4. Mosse, B., 1959. The regular germination of restingdecompose with age and are usually invisible in older spores and some observations on the growthspores. requirements of an Endogone sp. causing vesicular-

Germinal Wall: A germinal wall is a semiflexible layer 42: 273-286.from which a germ tube emerges. The layer is ornamented 5. Mosse, B., 1970. Honey-coloured, sessile Endogonewith knobs distributed on its lower surface. Once it is spores. I. Life history. Arch. Microbiol., 70: 167-175.differentiated, it remains unchanged as long as a spore 6. Mosse, B. and G.D. Bowen, 1968. A key to theremains. recognition of some Endogone spore types. Trans.

Germination Structure: Such a structure, 7. Fassi, B., 1965. Micorrhize ectotrofiche di Pinusresembling a germination shield of spores of genus strobus L. prodotte da un’ Endogone (EndogoneScutellospora, has been detected on the upper lactiflua Berk.). Allionia, 11: 7-15.surface of the second germinal wall of spores of Ap. 8. Gerdemann, J.W. and J.M. Trappe, 1974. Theappendicula [33]. No mention of its persistency is made Endogonaceae in the Pacific Northwest. Myc.anywhere. Memoir., 5: 1-76.

The germ tube of Glomus spp. either grows 9. Walker, C., 1985. Endogone lactiflua formingfrom the inner surface of the subtending hyphal wall ectomycorrhizas with Pinus contorta. Trans. Br.near the spore, a septum of the subtending hypha, or from Mycol. Soc., 84: 353-355.the spore wall itself. In all these cases, however, no 10. Tulasne, L.R. and C. Tulasne, 1845. Fungi nonnullidistinct pre-germination structure as above has been hypogaei, novi minus cogniti act. Giorn. Bot. Ital.,reported. 2: 35-63.

CONCLUSION Entrophospora, a new genus in the Endogonaceae.

The present review has been envisaged with an aim 12. Hall, I.R., 1977. Species and mycorrhizal infections ofto provide some insight into the taxonomic characteristics New Zealand Endogonaceae. Trans. Br. Mycol. Soc.,of AMF. From the review it becomes clear that the 68: 341-356. taxonomic position of different genera and species are 13. Benjamin, R.K., 1979. Zygomycete and their spores.difficult to identify on the morphological basis. Molecular In: Kendrick B. (ed.). The Whole Fungus. Vol. II.approach is more authentic in identify the exact taxonomic National Museums of Canada. Ottawa, Canada,position of different genera and specie of AMF. pp: 573-622.

KNOWLEDGE Systematique. Encycl. Mycol. 23, 941-2120. Paul

The authors acknowledge the facilities provided by 15. Walker, C., 1979. Complexipes moniliformis: a newthe Head, School of Studies in Botany, Jiwaji University, genus and species tentatively placed in theGwalior. Endogonaceae. Mycotaxon, 10: 99-104.

arbuscular mycorrhiza. Trans. Br. Mycol. Soc.,

Br. Mycol. Soc., 51: 469-483.

11. Ames, R.N. and R.W. Schneider, 1979.

Mycotaxon, 8: 347-352.

14. Moreau, F., 1953. Les Champignons. Tome II.

Lechevalier, Paris.


196

16. Mikola, P., 1965. Studies on the ectendotrophic 28. Redecker, D., J.B. Morton and T.D. Bruns, 2000.mycorrhiza of pine. Acta For. Fenn. 75: 1-56. Molecular phylogeny of the arbuscular mycorrhizal

17. Wilcox, H.E., R. Ganmore-Neumann and C.J.K. Wang, fungi Glomus sinuosum and Sclerocystis1974. Characteristics of two fungi producing coremioides. Mycologia, 92: 282-285.ectendomycorrhizae in Pinus resinosa. Can. J. Bot., 29. Morton, J.B. and D. Redecker, 2001. Two families of52: 2279-2282. Glomales, Archaeosporaceae and Paraglomaceae,

18. Danielson, R.M., 1982. Taxonomic affinities and with two new genera Archaeospora and Paraglomus,criteria for identification of the common based on concordant molecular and morphologicalectendomycorrhizal symbiont of pines. Can. J. Bot., characters. Mycologia, 93: 181-195.60: 7-18. 30. Oehl, F. and E. Sieverding, 2004. Pacispora, a new

19. Yang, C.S. and H.E. Wilcox, 1984. An E-strain vesicular arbuscular mycorrhizal fungal genus in theectendomycorrhiza form by a new species, Glomeromycetes. J. Appl. Bot., 78: 72-82. Tricharina mikolae. Mycologia, 76: 675-684. 31. Walker, C. and A. Schüßler, 2004. Nomenclatural

20. Yang, C.S. and R.P. Korf, 1985. A monograph of the clarifications and new taxa in the Glomeromycota.genus Tricharina and of a new segregate genus, Mycol. Res., 108: 979-982. Wilcoxina (Pezizales). Mycotaxon, 24: 467-531. 32. Sieverding, E. and F. Oehl, 2006. Revision of

21. Gibson, J.L., 1984. Glaziella aurantiaca Entrophospora and description of Kuklospora and(Endogonaceae) zygomycete or ascomycete? Intraspora, two new genera in the arbuscularMycotaxon, 20: 325-328. mycorrhizal Glomeromycetes. J. Appl. Bot. Food

22. Gibson, J.L., J.W. Kimbrough and G.L. Benny, 1986. Qual. 80, 69-81. Ultrastructural observations on Endogonaceae 33. Spain, J.L., E. Sieverding and F. Oehl, 2006.(Zygomycetes). II. Glaziellales ord. nov. and Appendicispora: a new genus in the arbuscularGlaziellaceae fam. nov.: new taxa based upon light mycorrhiza-forming Glomeromycetes, with aand electron microscopic observations of Glaziella discussion of the genus Archaeospora. Mycotaxon,aurantiaca. Mycologia, 78: 941-954. 97: 163-182.

23. Trappe, J.M. and N.C. Schenck, 1982. Taxonomy of 34. Walker, C., M. Vestberg, F. Demircik, H. Stockinger,the fungi forming endomycorrhizae. In: Schenck N. C. M. Saito, H. Sawaki, I. Nishmura and A. Schüßler,(ed.). Methods and principles of mycorrhizal 2007. Molecular phylogeny and new taxa in theresearch. Amer. Phytopath. Soc. St. Paul., MN, Archaeosporales (Glomeromycota): Ambisporapp: 1-9. fennica gen. sp. nov., Ambisporaceae fam. nov. and

24. Walker, C. and F.E. Sanders, 1986. emendation of Archaeospora and Archaeosporaceae.Taxonomic concepts in the Endogonaceae: Mycol. Res., 111: 137-13. III. The separation of Scutellospora gen. nov. 35. Palenzuela, J., N. Ferrol, T. Boller, C. Azcón-Aguilarfrom Gigaspora Gerd. and Trappe. Mycotaxon, and F. Oehl, 2008. Otospora bareai, a new fungal27: 169-182. species in the Glomeromycetes from a dolomitic

25. Morton, J.B. and G.L. Benny, 1990. Revised shrubland in the Natural Park of Sierra de Bazaclassification of arbuscular mycorrhizal fungi (Granada, Spain). Mycologia. (Zygomycetes): a new order, Glomales, two new 36. Morton, J.B., S.P. Bentivenga and J.D. Bever, 1994.suborders, Glomineae and Gigasporineae and two Discovery, measurement and interpretation ofnew families, Acaulosporaceae and Gigasporaceae, diversity in arbuscular endomycorrhizal fungiwith an emendation of Glomaceae. Mycotaxon, (Glomales, Zygomycetes). Can. J. Bot.,37: 471-491. 73(Suppl. 1), S25-S32.

26. Schüßler, A., D. Schwarzott and C. Walker 2001. A 37. Morton, J.B., 2002.International Culture Collection ofnew fungal phylum, the Glomeromycota: phylogeny Arbuscular and Vesicular-Arbuscular Mycorrhizaland evolution. Mycol. Res., 105: 1413-1421. Fungi. West Virginia University.

27. Almeida, R.T. and N.C. Schenck, 1990. A revision of 38. Berch, S. and R. Koske , 1986. Glomus pansilhalos, athe genus Sclerocystis (Glomaceae, Glomales). new species in the Endogonaceae, Zygomycetes.Mycologia, 82: 703-714. Mycological Research, 78: 832- 836.


197

39. Blaszkowski, J., M. Tadych and T. Madej, 2001. 41. Kramadibrata, K., C. Walker, D. Schwarzott andGlomus arenarium, a new species in Glomales A. Schüßler, 2000. A new species of Scutellospora(Zygomycetes). Acta Soc. Bot. Pol., 70: 97-101. with a coiled germination shield. Ann. Bot., 86: 21-27.

40. Morton, J.B., 1986. Three new species ofAcaulospora (Endogonaceae) from high aluminum,low pH soils in West Virginia. Mycologia,78: 641-648.

8.pdf

Documents