JOURNAL OF VIROLOGY, May 2011, p. 4792–4801 Vol. 85, No. 100022-538X/11/$12.00 doi:10.1128/JVI.02399-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

A Respiratory Syncytial Virus Replicon That Is Noncytotoxic andCapable of Long-Term Foreign Gene Expression�

Olga Malykhina,1,3† Mark A. Yednak,1†‡ Peter L. Collins,4 Paul D. Olivo,5§ and Mark E. Peeples1,2,3*Center for Vaccines & Immunity, The Research Institute at Nationwide Children’s Hospital, Columbus, Ohio 432051; Department ofPediatrics, The Ohio State University College of Medicine, Columbus, Ohio 432102; Integrated Biomedical Sciences Graduate Program,

The Ohio State University College of Medicine, Columbus, Ohio 432103; Laboratory of Infectious Diseases,National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland 208924;

and Apath, LLC, St. Louis, Missouri 631415

Received 17 November 2010/Accepted 27 February 2011

Respiratory syncytial virus (RSV) infection of most cultured cell lines causes cell-cell fusion and death. Cellfusion is caused by the fusion (F) glycoprotein and is clearly cytopathic, but other aspects of RSV infection mayalso contribute to cytopathology. To investigate this possibility, we generated an RSV replicon that lacks allthree of its glycoprotein genes and so cannot cause cell-cell fusion or virus spread. This replicon includes agreen fluorescent protein gene and an antibiotic resistance gene to enable detection and selection of replicon-containing cells. Adaptive mutations in the RSV replicon were not required for replicon maintenance. Cellscontaining the replicon could be cloned and passaged many times in the absence of antibiotic selection, with99% or more of the cells retaining the replicon after each cell division. Transient expression of the F and G(attachment) glycoproteins supported the production of virions that could transfer the replicon into most celllines tested. Since the RSV replicon is not toxic to these cultured cells and does not affect their rate of celldivision, none of the 8 internal viral proteins, the viral RNA transcripts, or the host response to these moleculesor their activities is cytopathic. However, the level of replicon genome and gene expression is controlled in somemanner well below that of complete virus and, as such, might avoid cytotoxicity. RSV replicons could be usefulfor cytoplasmic gene expression in vitro and in vivo and for screening for compounds active against the viralpolymerase.

Respiratory syncytial virus (RSV) is an important humanrespiratory pathogen, particularly for infants and older adults(12, 16). It is a nonsegmented, negative-sense RNA virus ofthe subfamily Pneumovirinae, family Paramyxoviridae, orderMononegavirales. All paramyxoviruses enter target cells bymembrane fusion mediated by the viral fusion (F) protein, inmost cases at neutral pH. They execute gene expression andgenome replication entirely in the cytoplasm and bud throughthe plasma membrane to produce progeny virions. RSV infec-tion of immortalized cells in culture results in syncytial cyto-pathology. These multinucleated giant cells form because the Fprotein reaches the plasma membrane in a functional form andcauses fusion between the plasma membranes of infected cellsand their neighboring cells. The attachment (G) glycoproteinenhances fusion activity, but the third, small hydrophobic (SH)glycoprotein does not (52).

The 15.2-kb RSV genome is protected by the nucleocapsid(N) protein in a helical nucleocapsid structure that is used bythe large viral polymerase (L) protein, assisted by the phos-phoprotein (P), to transcribe mRNAs and the full-length rep-

licative intermediate RNA, the antigenome. The transcriptionprocessivity (M2-1) protein is also involved in mRNA tran-scription. Like the genome, the antigenome is encapsidated. Itis copied by the polymerase to produce progeny genomes.

Deletion of all three glycoprotein genes from RSV or an-other paramyxovirus, Sendai virus, results in replicons that canbe propagated by supplying a heterologous attachment/fusionglycoprotein or the missing viral glycoprotein genes, respec-tively, in trans (41, 58). Clearly, these replicons can replicatewithin a cell and can be mobilized from cell to cell by providingthe missing proteins, but because the approaches used in theseexperiments rely on continuous virus spread, it is not clearwhether the replication of these viruses eventually kills thecells that they infect, in the absence of viral glycoprotein ex-pression.

Noncytopathic replicons have previously been generated forpositive-strand RNA viruses such as Sindbis virus and hepatitisC virus (HCV) by removing the viral glycoprotein and capsidgenes and inserting a gene for antibiotic selection (5, 19, 36).However, in addition to antibiotic selection, biological selec-tion was necessary for the isolation of noncytopathic Sindbisvirus and HCV genotype 1 replicons but not HCV genotype 2replicons (32). In the case of the Sindbis virus, a mutation inthe nonstructural protein 2 (nsP2) gene led to a noncytopathicphenotype in both the virus and the replicon (14, 19). Inde-pendent isolation of noncytotoxic HCV genotype 1 repliconsgenerally resulted in adaptive mutations in the NS5a gene,either point mutations or deletions (5), though mutations inother nonstructural proteins have also been found (35). The

* Corresponding author. Mailing address: The Research Institute atNationwide Children’s Hospital, 700 Children’s Drive, Columbus, OH43205. Phone: (614) 722-3696. Fax: (614) 722-3680. E-mail: Mark.Peeples@nationwidechildrens.org.

† These authors contributed equally to this work.‡ Deceased.§ Present address: Diagnostic Hybrids, Inc. (A Quidel Corporation),

Athens, OH.� Published ahead of print on 9 March 2011.

4792

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

role of these mutations in replicon maintenance is not yetclear.

To determine whether RSV genome replication and tran-scription are inherently cytopathic, we removed the three gly-coprotein genes, those for F, G, and SH, from a full-lengthRSV cDNA clone, replacing them with the blasticidin S deami-nase (bsd) selectable marker gene and launched this repliconin baby hamster kidney (BHK) cells. Inclusion of blasticidin inthe culture medium enabled the selection of replicon-contain-ing cells that were subsequently cloned. These cells continuedto divide, and the replicon was maintained in progeny cells ofeach generation. Mutations were not required for the estab-lishment of the replicon, indicating that wild-type RSV repli-cation in the absence of glycoprotein production is not cyto-pathic. By supplying F and G genes in trans, we were able tomobilize three replicon clones to 8 other cell lines.

Reporter genes have previously been expressed from recom-binant RSV and RSV minigenomes (38), but neither providelong-term expression of these genes. Infectious RSV ultimatelykills its host cell, and an RSV minigenome does not contain afull complement of RSV replication proteins and thereforereplicates and expresses genes transiently and only while theviral replication proteins are provided by cotransfected plas-mids.

Using reverse genetics, we were able to launch an autono-mous RSV replicon replication in vitro by plasmid transfection.Following launch, the replicon began to replicate on its own,no longer needing plasmids to supply replication proteins. Thereplicon was noncytotoxic in most of the cell lines tested andrelatively stable over many passages, making it a potentialvector for gene expression in vitro and in vivo. Additionally,RSV replicon-containing cells could provide a system forscreening libraries of compounds to identify novel viral inhib-itors of the RSV polymerase.

MATERIALS AND METHODS

Cells. The BHK cell line BHK-SR19-T7, carrying the noncytotoxic Sindbisvirus replicon that expresses T7 polymerase, was a gift from Charles Rice(Rockefeller University). It was maintained in minimal essential medium sup-plemented with 10% fetal bovine serum (FBS) and 4 �g/ml puromycin (1). Allother cell lines were maintained in Dulbecco’s modified Eagle medium (DMEM)supplemented with 7.5% FBS, except for Vero cells, which were grown in RPMIwith 7.5% FBS. All cells were incubated at 37°C in 5% CO2. Replicon-containingcells were maintained in the same medium as the parental cell line but weresupplemented with blasticidin. The concentration of blasticidin used for each cellline was determined by starting at 50 �g/ml and decreasing the amount if toxicitywas noted.

Construction of RSV replicon plasmid. The RSV replicon cDNA-containingplasmid MP295 was constructed from SN3 (52), from which the three glycopro-tein genes from the full-length RSV genomic cDNA plasmid MP224 had beendeleted and replaced with PvuI and XhoI sites (Fig. 1). SN3, like MP224,includes the green fluorescent protein (GFP) gene in the first position. Thehammerhead ribozyme sequence following the RSV trailer was replaced with theantigenomic hepatitis delta virus ribozyme sequence by moving the analogousBamHI/AgeI fragment containing most of the L gene and the ribozyme from thefull-length RSV cDNA clone D53/BsiWI into SN3 digested completely with AgeIand partially with BamHI to generate YM6. D53/BsiWI is a version of thepreviously described full-length RSV cDNA clone (13) in which (i) the hammer-head ribozyme was replaced with the antigenomic hepatitis delta virus ribozyme(45) and (ii) three nucleotide substitutions were introduced in the trailer regionat positions 10, 13, and 14 downstream of the L gene end signal, creating a BsiWIsite (GTATATT to GCATGCT, where the three nucleotide substitutions areunderlined) (24).

The bsd gene from pEF/Bsd (Invitrogen, Inc.) was mutated by a reverse PCR

method (7, 27) to remove an internal Pvul site without changing the encodedprotein. This modified bsd gene was PCR amplified with primers containing thePvul site (boldface) and the RSV GS signal (italics) (GCATGGATCCGATCGTGGATGGGGCAAATACTA) and the Xhol site (boldface) and a consensusRSV GE sequence (italics) (GCATGGGCCCTCTCGAGCCGGGTTTTTAAATAACTT). This PCR product was inserted into the Pvul and Xhol sites of YM6,yielding MP295.

Replicon launch, selection, and mobilization. The MP295 replicon waslaunched by transfecting BHK-SR19-T7 cells in 35-mm tissue culture wells withthe MP295 replicon cDNA plasmid (1.2 �g), along with pTM1-N (0.4 �g),pTM1-P (0.2 �g), pTM1-L (0.1 �g), and pTM1-M2-1 (0.1 �g), which are supportplasmids expressing the indicated RSV protein, in the absence of all antibiotics,as described previously for the recovery of complete virus (13). TranslT-LT1(Mirus, Corp.) was used as the transfection agent. Transcription of the trans-fected plasmids was mediated by T7 polymerase produced by the SinRep19-T7Sindbis virus replicon present in the BHK-SR19-T7 cells. The transient expres-sion of the viral N, P, L, and M2-1 proteins from the pTM1 plasmids enabledinitiation of self-sustaining gene expression and replication by the RSV replicon.

Replicon-containing cells were selected by treatment with blasticidin (Invivo-Gen, San Diego, CA) at 50 �g/ml beginning 2 to 3 days posttransfection, whenthe replicon-containing cells expressed GFP. At that time cells were also movedto a 100-mm tissue culture dish. After 1 week, green colonies were isolated andgrown as separate cultures. Alternatively, individual green cells were isolated byflow cytometry, distributed into a 96-well plate, and grown in the presence ofblasticidin. Wells with single green cell colonies and no clear (nongreen) cellswere expanded.

Replicons were mobilized into one-step virions (OSVs) by transfecting repli-con-containing cells with plasmids MP340 and MP341, which contain codon-optimized versions of the RSV strain D53 (A strain) F gene and the A2 G gene,respectively. Without codon optimization, the F gene cannot be expressed fromthe nucleus, probably due to cryptic splicing or cryptic polyadenylation (55).These plasmids were derived from pcDNA3.1 (Invitrogen), in which transcrip-tion is driven from a cytomegalovirus (CMV) promoter. OSVs were harvested at48 h posttransfection by scraping the cells from the tissue culture dishes into themedium with a rubber policeman, and the cells were vortexed to release looselybound virus and centrifuged at 1,500 rpm in a Heraeus Megafuge 1.0 centrifugefor 5 min to remove the cells. The medium was then removed, leaving the cellpellet and approximately 0.5 ml of medium at the bottom of the tube, andcentrifuged again to remove any remaining cells. The medium was quickly frozenon dry ice and thawed at 37°C to disrupt any cells that might still be present. This

FIG. 1. Derivation of MP295 replicon cDNA. MP224 is the origi-nal, full-length RSV genomic cDNA including the GFP gene. SN3 wasgenerated from it by removal of the three glycoprotein genes, replacingthem with an intergenic region containing two introduced unique re-striction sites, PvuI and XhoI (52). These constructs contain the orig-inal hammerhead ribozyme (HRbz). The hammerhead ribozyme inSN3 was replaced with the hepatitis D virus ribozyme (DRbz) in YM6.The bsd gene unit was subcloned into YM6 using PvuI and XhoI togenerate MP295, a glycoprotein-free replicon cDNA. The black box atthe left (3�) end of the genome represents the leader, and that at theright (5�) end represents the trailer sequence. Transcription to producea complete RNA copy of each antigenome initiates at a T7 promoterto the left (not shown) and terminates at the T7 terminators to theright (not shown) of each construct. The ribozyme then executes cleav-age that removes all nonviral sequences from the 3� end. The 5� end ofthe antigenome transcript begins with the foreign GGG sequence fromthe T7 promoter. This sequence is probably lost during replicationbecause it is not present in the replicon clones that we have sequenced.

VOL. 85, 2011 RESPIRATORY SYNCYTIAL VIRUS REPLICON 4793

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

OSV-containing medium was then used to inoculate other cell lines to initiatethe replicon in those cells. The new replicon-containing cells were selected withblasticidin at 10 to 50 �g/ml, depending on the sensitivity of the cell line, andcloned as described above. Finally, the cell lines were tested to be certain thatthey did not contain BHK cells, using the actin sequencing protocol describedbelow.

Replicon sequencing. Replicon-containing cell clones were isolated from sep-arate replicon-containing cell populations by physically picking the colonies 2 to4 weeks after the replicon was launched. The clones were grown for an additional2 to 4 weeks before the RNA was extracted. Total RNA was extracted from fiveindependent replicon-containing BHK-SR19-T7 cell clones, and replicon cDNAwas prepared by reverse transcription (RT)-PCR. Pairs of primers were used toamplify cDNA fragments that were overlapping. Each fragment was sequencedwith an ABI Big Dye (version 3.1) kit, and the sequence was determined by theTRINCH Core Sequencing Facility.

To sequence the genome termini, replicon-containing BHK-SR19-T7 cellswere lysed in phosphate-buffered saline (PBS) containing 1% Triton X-100.After centrifugation at 5,000 � g for 5 min to pellet the nuclei and cell debris, thesupernatant was combined with CsCl to a final concentration of 40% CsCloverlaid with layers of 30% CsCl, 25% CsCl, and 5% sucrose, all in 25 mMTris-hydrochloride (pH 7.5), 50 mM NaCl, 2 mM EDTA, and 0.2% (wt/vol)sodium lauroyl sarcosinate (Sarkosyl) (56). The gradient was centrifuged in aSorvall Ultraspeed centrifuge at 38,000 rpm at 4°C for 19 h. The visible bandcontaining the nucleocapsids was removed with a Pipetman pipette, diluted inPBS, and pelleted through 15% sucrose at 20,000 � g for 1 h. The pellet wassolubilized in 2 ml of LEH buffer (10 mM HEPES [pH 7.5], 100 mM LiCl, 1 mMEDTA) containing 1% SDS, followed by extraction with RNA Bee reagent(Tel-Test, Friendswood, TX). The resulting genomic RNA was used in 5� and 3�rapid amplification of cDNA ends (RACE; Invitrogen) to determine the se-quence of the replicon termini.

Actin sequencing to determine the cell source. Total cellular RNA was ex-tracted with RNA Bee reagent (Tel-Test), and cDNA was prepared by RT-PCRusing random hexamers. A pair of primers designed to amplify either the primateor the hamster actin mRNA, 5�-GCTCGTTGTCGACAACGGCTC and 5�-AAACATGATCTGGGTCATCTTTTC, was used in a PCR (94°C for 30 s, 54°C for30 s, and 72°C for 1 min for 40 cycles). The amplified PCR product was thensequenced from each of the original primers using the Big Dye (version 3.1) kit(ABI) and read by the TRINCH Core Sequencing Facility.

Analysis of viral protein synthesis. Replicon-containing A549, BHK, HeLa,and Vero cells were compared to cells acutely infected with recombinant, greenfluorescent protein-expressing RSV (rgRSV) at a multiplicity of infection of 3.At 24 h postinoculation (p.i.), 80 to 90% of both sets of cells were green. Cellswere metabolically labeled with 20 �Ci [35S]methionine/cysteine (Met/Cys)/ml(MP Biomedicals, Irvine, CA) for 6 h in 6-well tissue culture dishes in 2 ml ofmedium. The medium was a 9:1 mix of Met/Cys-free DMEM and completeDMEM with 10% FBS. Cells were rinsed with PBS and lysed with 300 �l ofradioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 1% TritonX-100, 0.1% SDS, 0.5% sodium deoxycholate, 50 mM Tris, pH 7.5), and theprotein content of each sample was determined with a bicinchoninic acid proteinassay (Pierce, Rockford, IL).

Lysates in triplicate (2 �g) from the 4 cell lines were immunoprecipitated with6.5 �l of goat anti-RSV polyclonal antibody (Chemicon International) and 25 �lof protein G-agarose beads (KPL, Gaithersburg, MD). Immunoprecipitation wasperformed as follows: the sample-antibody mixture was incubated for 18 h at 4°C,the protein G-agarose beads were added, the mixture was incubated for 18 h at4°C, and the beads were washed two times with RIPA buffer containing 0.5 MNaCl, two times with RIPA buffer containing 0.15 M NaCl, and once with 50 mMTris (pH 7.4) containing 0.15 M NaCl and 0.25 mM EDTA. Samples were boiledin sample buffer containing 2-mercaptoethanol and separated by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (33). Gels were soaked in 10%glacial acetic acid and 20% methanol for 1 h, followed by 20% methanol and 3%glycerol for 16 h, and dried. Images were collected on film and digitally with aTyphoon phosphorimager (GE Healthcare). The amount of N protein was quan-tified using the ImageQuant program (version 5.0; Molecular Dynamics). Toconfirm that the immunoprecipitation was efficient, supernatants from the orig-inal precipitations were added to a second aliquot of RSV-specific antibody andsubjected to a second round of immunoprecipitation. The amount of viral pro-tein in the second round was less than 10% of the amount in the initial precip-itation, indicating that the initial precipitation had been efficient.

Quantification of replicon genome by real-time PCR. Infected and replicon-containing cells grown in a 12-well plate were gently lysed in 10 mM NaCl, 10mM Tris, pH 7.5, 1.5 mM MgCl2, 1% Triton X-100, 0.5% deoxycholate, completeprotease inhibitor, and 1 M CaCl2. This lysis disrupts cells without disturbing the

viral nucleocapsids. Half of the lysate from each sample was digested withmicrococcal nuclease for 1 h at 37°C to remove free mRNA, and the other halfwas similarly incubated but without digestion. RNA Bee reagent (Tel-Test) wasused to extract the total RNA remaining after digestion. cDNA synthesis wasperformed on 6 �l of total RNA using a high-capacity cDNA reverse transcrip-tion kit (Applied Biosystems). Two microliters of cDNA was used in real-timePCR with Power SYBR green PCR master mix (Applied Biosystems). Primersspecific for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA fromhuman (GGTCGGAGTCAACGGATTTGGT and GCAAATGAGCCCCAGCCTTCTCC) and monkey (GGTCGGAGTCAATGGATTTGGT and GCAAATGAACCCCAGCCTTCTCC) were used to amplify GAPDH as an internalcontrol. RSV N-gene primers (CAGATCTGGTCTTACAGCCGTG and AGCTGTTGGCTATGTCCTTGG) were used to amplify a portion of the viral ge-nome. The RSV genome quantity is expressed as a ratio between the first PCRcycle in which the N-gene product and the GAPDH mRNA were detected.

Growth rate of replicon-containing cells. Equal quantities of replicon-contain-ing and uninfected A549, BHK, HeLa, and Vero cells were plated in 5 plates foreach condition. Every 24 h the cells were trypsinized and suspended in PBS, 1%paraformaldehyde, and 2% FBS and quantified with flow cytometry. Only thereplicon-containing BHK cell lines had been cloned. The other replicon-contain-ing cell lines were derived from the mobilization of OSVs from individual BHKcell clones.

Bioassay for type I IFN. RSV-infected and replicon-containing cells weregrown in 12-well plates. At 40 h p.i., medium was collected from replicon-containing and RSV-infected A549 and HeLa cells. The medium was treatedwith 15 �l of 1 N HCl for 1 h to destroy any virions present, and then the pH wasneutralized with 25 �l of 7.5% NaHCO3. The medium, in parallel with a knownamount of interferon (IFN) alpha-2b (Intron/Schering-Plough, Kenilworth, NJ),was diluted 1:2 eight times in a 96-well dilution plate and then transferred toDAOY cells (an IFN-sensitive medulloblastoma cell line) in a 96-well plate.After 24 h, the medium was removed and cells were inoculated with vesicularstomatitis virus. Two days later the dead cells were washed away, and theremaining cells were fixed and stained with crystal violet (0.01% crystal violet,1.85% HCHO, 0.05 M Na2HPO4).

Staining viral antigens in replicon-containing cells. Replicon-containing celllines were plated in a 96-well plate, fixed with 3% paraformaldehyde for 20 minat 20°C, permeabilized with 0.1% Triton X-100 in PBS for 30 min at 33°C, andincubated with a 1:500 dilution of a goat anti-RSV polyclonal antibody (Chemi-con, International) for 30 min at 33°C, followed by a 1:100 dilution of rhodamine-conjugated anti-goat secondary antibody (KPL, Gaithersburg, MD) for 60 min.Before the addition of each antibody, the cells were washed three times with PBSand blocked with 50 �l of a 1:20 dilution of milk diluent (KPL) for 30 min at 33°Con a shaker.

RESULTS

Generation of an RSV replicon. We deleted the three gly-coprotein genes, those for SH, G, and F, from a full-lengthrecombinant GFP-expressing (rg)RSV antigenomic cDNA. Intheir place, we inserted a blasticidin S deaminase (bsd) gene, togenerate MP295 (Fig. 1). To launch the RSV replicon, we usedBHK-SR19-T7 cells that produce T7 polymerase from an en-dogenously maintained Sindbis virus replicon (1). BHK-SR19-T7 cells were transfected with MP295 and the 4 plasmidsthat express the viral proteins necessary for RSV genome rep-lication and gene expression, N, P, L, and M2-1. Within 2 daysgreen cells were visible by fluorescence microscopy, indicatingthat the RSV replicon had begun to replicate and express itsgenes in those cells. Cells were passaged into a 150-mm tissueculture dish, and blasticidin was added to the medium. Overthe next 2 weeks, colonies of green cells appeared, and most ofthe clear (nongreen) cells were killed by the blasticidin.

To confirm that these cells had not been infected with com-plete virus, spent medium from the uncloned replicon-contain-ing BHK-SR19-T7 cultures was centrifuged at a low speed toremove floating cells and used to inoculate HeLa cells. Nogreen cells appeared over the following 48 h, while controlvirus inoculation of parallel cultures with rgRSV resulted in

4794 MALYKHINA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

green cells within 24 h (data not presented). We also extractedRNA from the uncloned replicon-containing cells and testedfor the presence of SH, G, F, and M RNA sequences byRT-PCR. Only the M primers yielded a PCR product from thereplicon-containing cells (Fig. 2), confirming that the viral gly-coprotein genes were missing.

Cloning of replicon-containing cells. Well-isolated greencolonies were picked and passaged. The green cells that grewinto colonies survived either because the wild-type replicon isnaturally not cytopathic or because replicon variants were bi-ologically selected for their ability to replicate without killingBHK cells. Some of these clones were composed of small cells,similar to the original BHK-SR19-T7 cells, while others werecomposed of cells approximately twice that size (Fig. 3A).

Each clone maintained its original phenotype during subse-quent passages. Either replicon or cell variants could be re-sponsible for the enlarged cell phenotype. This question will beaddressed below.

Replicon mobilization. The replicon that was launched inBHK-SR19-T7 cells was apparently not cytopathic, but it ispossible that some of these cells were killed by the repliconwhile others survived. To directly examine the cytotoxicity ofthe replicon, we mobilized the replicon into virions by provid-ing the RSV F and G proteins in trans. Replicon-containingcells were transfected with plasmids expressing codon-opti-mized versions of the RSV G and F genes driven by a CMVpromoter. At 48 h posttransfection, OSVs were harvested andused to inoculate fresh BHK-SR19-T7 cells. Even though T7polymerase was not needed to sustain the replicon at thispoint, we inoculated BHK-SR19-T7 cells because they hadbeen used in the initial launch and we wanted to compare theirphenotypes. Green cells appeared among the inoculated cellswithin 24 h, indicating transfer of the replicon. Expression ofthe vesicular stomatitis virus G protein in trans also mobilizedthe replicon into OSVs capable of transmitting the replicon tofresh cells (data not shown). After 1 week in culture, 50% to70% of the OSV-inoculated, replicon-containing (green) cellshad grown into colonies, similar to the frequency of isolatedcells that grow into colonies in the absence of the replicon,indicating that the replicon was not cytopathic.

Most of these colonies were composed of small cells, but alow number of colonies were composed of large cells. To de-termine whether a particular replicon variant caused the largecell phenotype, OSVs derived from large phenotype replicon-containing cell clones (Fig. 3B) were used to inoculate freshcells, resulting in colonies of both large and small cell pheno-types (Fig. 3C and D). Likewise, OSVs from small cell pheno-type replicon-containing clones (Fig. 3E) were used to inocu-late fresh cells, resulting in colonies of both small and large cellphenotypes (Fig. 3F and G). These results indicate that thelarge cell phenotype is not caused by the replicon.

The large cells had a much slower growth rate than the small

FIG. 2. RT-PCR analysis of viral RNA from replicon-containingcells. RNA was extracted from uncloned replicon-containing BHK-SR19-T7 cells (C) (lane 1) or the supernatant (S) (lane 2) from thesecells or from RSV-infected cells (lane 3) and their supernatant (lane4). A reaction without RNA was included as a negative control (lane5). Random hexamers were used to prime the RT reaction. Specificprimer pairs for each of the viral genes were employed for PCR.

FIG. 3. Fluorescent photomicrographs of BHK-SR19-T7 cells containing the RSV replicon, as indicated by the expression of GFP. (A) Twoneighboring phenotypically distinct clones. The cell clone in the lower left corner has a large cell phenotype, while the clone in the upper rightcorner has the small cell phenotype. The small cell phenotype is similar in appearance to the majority of the cells in the parental cultures.(B) Cloned cell line with the large cell phenotype. OSVs mobilized from this clone were used to inoculate BHK-SR9-T7 cells, and clones of bothlarge (C) and small (D) cell phenotypes appeared. (E) Cloned cell line with the small cell phenotype. OSVs mobilized from this clone were usedto inoculate BHK-SR9-T7 cells, and clones of both large (F) and small (G) cell phenotypes appeared. The image in panel A was photographedusing a �10 objective and enlarged here to compensate for the difference in magnification with the images in panels B to G, which werephotographed with a �20 objective.

VOL. 85, 2011 RESPIRATORY SYNCYTIAL VIRUS REPLICON 4795

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

cells (data not shown), which may explain the relatively lownumber of large compared to small cell colonies. It was possi-ble that these large cells might have been a minor populationof contaminating human cells, which are also used in the lab-oratory. To test this possibility, we sequenced a portion of theactin transcript that differs between hamster and human. Theactin sequence was that of hamster, indicating that the largecells were not a contaminating, nonhamster cell line. It ap-pears, then, that these large cells represent either a preexistingsubpopulation or a small proportion of cells that receive theRSV replicon and are for some reason induced to becomelarge cells. Because the parental BHK-SR19-T7 cells were veryhomogeneous and small, it seems unlikely that the large cellswere preexisting in the culture.

Mobilization of replicon to other cell types. To determinewhether the RSV replicon could establish noncytotoxic repli-cation in other cell types, we used OSVs to transfer repliconsto eight other cell lines: A549 (human adenocarcinomic alve-olar basal epithelial cells), DAOY (human medulloblastomacells), HeLa (human epithelial cervical cancer cells), HEp-2(human epidermoid cancer cells), Huh-7 (human hepatocarci-noma cells), Huh-7.5 (Huh-7-derived cells with a defect inRIG-I), HEK-293 (human embryonic kidney cells), and Vero(African green monkey kidney cells). At 2 days postinoculationwith OSVs, green cells were detected in all of these cell lines,indicating that the replicon had entered and begun to expressviral genes. At this point, blasticidin was added to each set ofcells. Because different cell types varied widely in their sensi-tivity to blasticidin, we used the lowest concentration thatwould kill each cell line in the absence of the replicon. Blasti-cidin treatment caused the clear cells, those that lacked thereplicon, to die. The green, replicon-containing cells of all celltypes tested survived and continued to divide for 4 weeks ofculture and beyond, with one exception, DAOY cells. Thereplicon initiated replication in relatively few DAOY cells, andthese cells did not divide. After 4 weeks there were no remain-ing green DAOY cells. The other 7 cell types containing thereplicon were tested by actin transcript sequencing to ensurethat they did not represent BHK cells that had been carriedover with the OSVs.

Stability of replicon in culture. We initially picked greencolonies from tissue culture dishes by identifying them under amicroscope, loosening them from the plastic with trypsin, andharvesting them with a Pipetman pipette; but cultures grownfrom these physically isolated colonies always included someclear cells, despite the presence of blasticidin in the medium.These clear cells could have been accidentally carried alongwith the green cells during the isolation procedure, but it wasalso possible that replicon-containing cells are capable of beingcured of the replicon.

To determine whether clear cells could arise from replicon-containing cells, we deposited individual green replicon-con-taining BKH-SR19-T7 cells into 96-well dishes by flow cytom-etry sorting and examined each well daily for the first week.Wells that initially contained a single green cell, without anyclear cells, and that grew into a single colony were expanded.Any clear cell that subsequently appeared in these wells musthave been derived from these replicon-containing cells.

We tested the stability of three of these independent repli-con-containing BHK-SR19-T7 cell clones through 12 passages

in the presence or absence of a low concentration of blasticidin(4 �g/ml) over 8 weeks (Fig. 4, squares). Clear cells did appearin all three cultures, indicating that cells could be spontane-ously cured of the replicon. However, the clear cells did notovergrow the green, replicon-containing cells. In fact, the pro-portion of replicon-containing cells remained in the majority inall three cell lines, representing 50% to 70% of the populationby passage 12. Because these replicon-containing cells doubleapproximately every 24 h, 8 weeks would represent approxi-mately 50 cell doublings. Therefore, loss of the replicon from30% to 50% of the cells over 50 passages represents a rate of0.6% to 1% loss per cell doubling. In other words, 99% ormore of the daughter cells retained the replicon after each celldivision. Surprisingly, the blasticidin treatment had little or noeffect on the level of clear cells in these cultures. We laterrealized that BHK-SR19-T7 cells at relatively high cell density,as in this experiment, are resistant to this low level of blastici-din. A 10-fold higher concentration is required to kill BHKcells lacking expression of the bsd gene product in a mixedculture. Therefore, the blasticidin-treated cell clones essen-tially represented a duplicate of the untreated replicon-con-taining cell clones in this experiment.

FIG. 4. Replicon stability in cloned cells passaged with and withoutblasticidin. The three panels indicate independent BHK-SR19-T7 cellclones containing a replicon. The replicon-containing cells were pas-saged in the presence of 4 �g/ml blasticidin (squares) or in the absenceof blasticidin (circles). Cells at each passage were frozen and stored inliquid nitrogen. After collection of cells at all of the time points, allcells were thawed, cultured for 2 days, and analyzed by flow cytometryto quantify the proportion of green cells. Cells from some of the timepoints did not survive and account for the absence of some data points.

4796 MALYKHINA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

Source of clear cells. The clear cells that appear duringpassage of cloned replicon-containing cell lines could have lostthe replicon or might, alternatively, harbor a replicon whoseGFP gene was mutated, resulting in the loss of GFP expressionor the loss of its ability to fluoresce. To test these possibilities,we isolated clear cells from 4 replicon-containing cultures byflow cytometry and grew them in the presence of 10 �g/mlblasticidin. All of these cells died within a week, indicating thatthey no longer contained the replicon. This result also indi-cates that the clear cells in these cultures are not innatelyresistant to blasticidin. Therefore, the finding that clear cellssurvive blasticidin treatment in a mixed culture is likely due tothe presence of replicon-containing cells and their ability tometabolize blasticidin in the medium, enabling the clear cellsto survive.

To confirm the finding that clear cells no longer contain thereplicon, we examined 4 separate replicon-containing cell linesthat had each originated from a single green cell. Each cell lineincluded clear cells at the time of staining. Two different rep-licon-containing BHK-SR19-T7 cell clones, one A549 clone,and one Vero cell clone were stained with RSV antiserumfollowed by anti-IgG-rhodamine. All replicon-containing cells(green) contained RSV antigens (red), but none of the clearcells did (Fig. 5), indicating that the clear cells had been curedof the replicon.

Replicon sequence. To determine whether surviving repli-cons contained mutations, we sequenced replicons from fiveindependent BHK-SR19-T7 clones. Each clone was grown for4 to 8 weeks to generate enough cells for nucleocapsid isola-tion by use of a CsCl gradient and subsequent genomic RNAextraction. The replicon genomes were copied and amplifiedby RT-PCR as several overlapping segments, and the PCRproducts were sequenced. The genome termini were se-quenced by 5� and 3� RACE. Two of the 5 completely se-quenced replicons, Rep295.3 and Rep295.4, had no mutations,indicating that the wild-type replicon is capable of establishinginfection without killing its host cell. All but the 3� terminus(99.5%) of Rep295.1 was also sequenced without finding amutation; Rep295.2 contained a single mutation, an A inser-tion 26 codons from the C terminus of the NS1 gene. Rep295.5contained two mutations near the end of the P gene, one ofwhich was silent and one of which resulted in an amino acidchange from asparagine to serine, as well as two base changesin the following P/M intergenic region. All 4 of these mutationswere A-to-G transversions.

Effect of replicon on cell growth. The replicon is not cyto-pathic, since replicon-containing cells grow into colonies andcan readily be further expanded. However, the replicon or thecellular responses to the replicon might affect the physiology ofthe cell. As a gross measure of cell physiology, we comparedthe growth rate of replicon-containing cells to that of theirparental cell line over a 5-day span. Equal numbers of parentaland replicon-containing BHK-SR19-T7, Vero, A549, andHeLa cells were plated in replicate wells, and the number ofcells was determined each day (Fig. 6). No significant differ-ence in the growth rate between uninfected and replicon-con-taining cells was detected.

Effect of the cell on viral replication. To evaluate the level ofvirus replication in replicon-containing A549, HeLa, and Verocells, we compared the genome levels in these cells with those

in acutely infected cells of the same type at 24, 36, and 48 h p.i.by real-time PCR (Fig. 7, left column). In all cultures in thisexperiment, greater than 80% of the cells contained replicatingRSV, as determined by GFP expression. The RSV genomelevel in replicon-containing cells was significantly lower thanthe genome levels in acutely infected cells, being between 2%and 35% that of the highest level of acutely infected cells. Thelower levels of genome in replicon-containing cells indicatethat replicon expansion is in some way controlled in these cells.

FIG. 5. Replicon-containing cells from a clonal BHK-SR19-T7population and clear cells that appeared in the culture during pas-sage. Cells were stained with goat anti-RSV polyclonal antibody,followed by a rhodamine-conjugated anti-goat secondary antibody.Phase-contrast detection of a single microscope field showing allcells (A), green, replicon-containing cells (B), and red, RSV anti-gen-containing cells (C).

VOL. 85, 2011 RESPIRATORY SYNCYTIAL VIRUS REPLICON 4797

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

To determine how viral protein production in replicon-con-taining cells compared to acute virus infection, cultures weremetabolically labeled with [35S]Met/Cys for 6 h and immuno-precipitated with polyclonal antiserum against RSV. Viral pro-teins were separated by SDS-PAGE, and RSV N protein wasdetected and quantified by phosphorimaging. In all cultures inthis experiment, greater than 80% of the cells contained the

replicon, as determined by GFP expression. Viral protein pro-duction in the acute infection with RSV peaked at differenttimes in the different cell lines (Fig. 7, right column). The viralprotein production in replicon-containing cell clones was con-sistently lower (5% to 25%) than the peak protein level during

FIG. 6. Growth rate of replicon-containing cells compared to thatof parental cells. Equal numbers of cells from A549 (A), BHK (B),HeLa (C), and Vero (D) replicon-containing cell clones and parentalcells were plated in 6-well tissue culture dishes. The number of cellswas determined every 24 h over 4 to 5 days until one of the culturesbecame confluent. Cells were trypsinized, suspended in PBS (1% para-formaldehyde, 1% FBS), and counted with a flow cytometer. Only thereplicon-containing BHK cells had been cloned before this assay. Theother replicon-containing cell lines were initiated with OSVs fromthese replicon-containing BHK cell clones, with the attached numberidentifying which BHK clone was the source of the OSV.

FIG. 7. Levels of viral genome and protein in replicon-containingcells compared to rgRSV-infected cells. For the viral protein compar-ison, replicon-containing BHK (B), A549 (A), HeLa (H), and Vero(V) cells were labeled for 6 h, and RSV-infected cells were labeled for6 h at 24, 36, and 48 h p.i. with 20 �Ci/ml [35S]Met/Cys. Cells were thenlysed, and equal amounts of total protein lysates were immunoprecipi-tated with goat RSV antiserum. The immunoprecipitates were sepa-rated on a 10% SDS-polyacrylamide gel under reducing conditions andimaged on a Typhoon phosphorimager. The N-protein bands of RSVand replicon were quantified and compared. Real-time PCR was im-plemented to compare viral genome levels in A549, HeLa, and Verocells. Mild lysis buffer was used to lyse replicon-containing cells andRSV-infected cells at 24, 36, and 48 h p.i. Micrococcal nuclease wasused to digest unprotected RNA in half of the lysate, followed by RNAextraction. GAPDH mRNA in the half of the lysate not treated withnuclease was used to normalize the samples in real-time PCR. (A) N-protein detection in acutely infected BHK cells at 24 and 36 h p.i. (B24,B36) and replicon-containing BHK cells (B1, B4, B5). The real-timePCR data for BHK cells are missing because the primers for theprimate GAPDH internal control did not function on the hamstertranscript. (B) Real-time PCR and N-protein detection data foracutely infected A549 cells (A24, A36, A48) and replicon-containingA549 cells (A1, A4, A5). (C) Real-time PCR and N-protein detectiondata for acutely infected HeLa cells (H24, H36, H48) and replicon-containing HeLa cells (H4, H5). (D) Real-time PCR and N-proteindetection data for acutely infected Vero cells (V24, V36, V48) andreplicon-containing Vero cells (V4, V5). AU, arbitrary units; *, statis-tical significance was measured with a one-tailed t test with 4 degreesof freedom and P equal to 0.05.

4798 MALYKHINA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

the acute infection of the same cell type, with replicon-con-taining BHK cell clones being present at the low end of thisrange, 5 to 12%, and the primate cell lines being present atsomewhat higher levels, 13 to 25%. This reduced level of viralprotein production in replicon-containing cells roughly corre-lates with the lower genome level in these cells.

IFN production by replicon-containing A549 and HeLacells. All 4 of the cell lines tested have a suppressed level ofreplicon replication and gene expression. To determine if theIFN system is involved in this suppression, we examined alpha/beta IFN (IFN-�/�) production with a bioassay. The replicon issuppressed in Vero cells, even though they do not produceIFN-�/� (15), and therefore, suppression does not requireIFN-�/�, at least not in these cells. The levels of IFN-�/�production from replicon-containing A549 and HeLa cellswere compared to those from acutely infected cells. No IFN-�/� was detected in the medium from RSV-infected or repli-con-containing HeLa cells, as has been reported for someHeLa cell lines (8). IFN was detected in the medium fromRSV-infected and replicon-containing A549 cells (Table 1).However, the level of IFN-�/� produced by replicon-contain-ing A549 cells was approximately 14-fold lower than that pro-duced by acutely infected cells. It appears that A549 cellsrespond less vigorously to the replicon than to the acute infec-tion, in approximate proportion to the lower levels of genomepresent and of viral proteins produced (Fig. 7B).

DISCUSSION

We have constructed and launched an RSV replicon thatlacks all three of its glycoprotein genes. This replicon is able tosustain long-term replication in many cultured cell types with-out obvious cytopathology. It can express foreign genes, suchas GFP and bsd, and can be mobilized into virions by providingthe two critical glycoproteins, G and F, in trans. RSV replicon-containing cells can readily be isolated, cloned, and expanded.RSV is an ideal candidate virus for the production of a non-cytopathic replicon because it does not result in inhibition ofhost cell protein synthesis (34) as many other viruses do.

Replicon survival did not require mutations in the repliconbecause two of the five replicons that were completely se-quenced and one replicon that was 99.5% sequenced con-tained no mutations. However, the remaining two repliconscontained mutations. The single mutation in Rep295.2 was anA insertion in a stretch of 6 A’s in the NS1 gene. Insertion ordeletion mutations of this type have previously been observedin RSV (20) (data not shown). Interestingly, all four mutationsin Rep295.5 were A-to-G transversions, suggesting that eitherthe T7 polymerase used to launch the replicon or the RSVpolymerase that copied the genome thereafter made this mis-take repeatedly within this region. It is more likely that the

RSV polymerase was responsible for these mutations becauseA-to-G hypermutation in a limited region has previously beendetected in mutants isolated from a persistent infection (10) ofanother paramyxovirus, measles virus.

The fact that mutations are not required for survival of theRSV replicon indicates that the wild-type replicon is not cyto-toxic. This result is similar to that for the HCV genotype 2replicon (32). However, it is strikingly different from the resultsfor replicons derived from Sindbis virus and HCV genotype 1(35), in which mutations in the viral genome enabling host cellsurvival were required to establish replicon-containing cell cul-tures (14, 19).

The lack of cytotoxicity or even delayed cell growth in RSVreplicon-containing cells, which express all of the viral RNAsand proteins except for the glycoproteins, indicates that thereplicon gene products and functions are not cytopathic, per se,nor are the host cell responses to the replicon. Infection of thesame cell lines with complete RSV does result in cell death, soit is likely that one or more of the genes that are missing in thereplicon are responsible for cytopathology. The viral F proteinalone is cytopathic because it causes cells to fuse and theresulting syncytia are not long-lived (4), but it is possible thatother aspects of the F protein or another viral glycoprotein arealso cytotoxic. Alternatively, since acute infection producesbetween 3- and 50-fold more viral genomes and proteins thanthe replicon (Fig. 7), it is possible that the higher level of RSVgenome, viral transcript, and/or viral protein produced inacutely infected cells or the cellular response to the higherlevel of one or more of these viral components causes thecytopathology.

Both RSV replication and viral protein production are re-duced in replicon-containing cells. It is not clear which reduc-tion is the cause because fewer genomes would lead to fewerviral proteins, but the opposite is equally true. It is possiblethat accumulation of one of the viral proteins suppresses rep-lication or transcription. For instance, the M2-2 protein hasbeen shown to suppress transcription (11), the NS1 protein hasbeen shown to inhibit genome replication (53), and the Mprotein has been shown to inhibit transcription in RSV (21)and other negative-strand viruses (9, 44, 50). If any of theseviral proteins are more stable than the others, it may dampenRSV replication. It is also possible that one of the missingglycoproteins is needed in some unknown way for the virus toreplicate to its maximal level within a cell.

It is also possible that a cellular factor(s) is controlling thereplicon at the level of genome replication, transcription, ortranslation. Although suppression did not depend on IFN-�/�production, a different cellular response may be responsible. Ifso, identifying that response might provide a target that couldbe harnessed to dampen acute RSV infection. We are pres-ently examining the differences in gene expression in unin-fected, replicon-containing, and acutely infected cells.

Establishment of an HCV replicon is greatly facilitated by acellular mutation that blocks the RIG-I system for recognizingviral pathogens in Huh-7.5 cells (49). Huh-7.5 was an HCVreplicon-containing Huh-7 cell line that was cured of its repli-con (6). Huh-7 cells were unable to support replication withHCV replicon and whole-virus genotype 1, while Huh-7.5 cellsdid (6). To test the importance of RIG-I in the establishmentof the RSV replicon, we compared its ability to establish itself

TABLE 1. Interferon released by replicon-containing A549 cells,determined by bioassay

A549 cell content Type I interferon concn (U/ml)

rgRSV....................................................................... 50 � 0Rep295.1 ..................................................................3.6 � 2.4Rep295.4 ..................................................................4.2 � 1.8Rep295.5 ..................................................................3.1 � 0

VOL. 85, 2011 RESPIRATORY SYNCYTIAL VIRUS REPLICON 4799

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

in both the Huh-7 parental cell line and Huh-7.5 cells. TheRSV replicon was able to establish itself in both cell lines,indicating that blockage of the RIG-I recognition pathway isnot necessary for establishment of the RSV replicon.

The RIG-I recognition system leads to IFN-�/� production,which might control replication or expression of the RSV rep-licon. We found that A549 cells containing the RSV replicondid respond by producing IFN-�/�, but at a level approxi-mately 14-fold lower than that by the same cell line acutelyinfected with RSV. While the response to this low level ofIFN-�/� could contribute to the reduction in replicon genomeand protein levels in A549 cells, it cannot explain the fact thatVero and HeLa cells also control the level of the RSV replicon.Vero cells do not produce IFN-�/� (15), and we were unableto detect any IFN-�/� production by HeLa cells. These resultsstrongly suggest that neither RIG-I nor the IFN-�/� system isrequired for the establishment of the RSV replicon or itscontrol. Of the nine cell lines tested, only one, DAOY, wasunable to maintain the replicon. DAOY cells are highly sen-sitive to IFN-�/� (R. Durbin and J. Durbin, unpublished data),so it is possible that these cells produced and responded to it inan overly exuberant manner, resulting in cell death.

The lack of cytopathology in the RSV replicon-containingcells may help explain the ability of RSV to establish per-sistent infections of cultured cells (2, 43, 46). The virusreleased by persistently infected cells often produces smallplaques in fresh cells, suggesting a defect in F-protein func-tion. Such a defect would slow virus spread and reduce thecytopathic effects of cell-cell fusion, such that the virus itselfwould be noncytopathic. Persistent RSV infections have alsobeen described in mice, in patients with chronic obstructivepulmonary disease, and in human dendritic cells maintainedex vivo (12, 23, 26, 48, 57).

Recently, recombinant RSV and Sendai virus replicons lack-ing one or more of their glycoprotein and/or M genes havebeen launched from cDNA and maintained by virus passage incells expressing the missing viral proteins or a foreign glyco-protein capable of replacing the function of the native viralglycoproteins (18, 25, 28–30, 39–42, 47, 51, 54, 58). In theseexperiments, cells infected with gene-deleted viruses have notbeen examined for long-term survival, nor have replicon-con-taining cells been selected and grown in pure culture for char-acterization, so their ability to coexist with a host cell over along period of time and through many cell divisions is notknown.

The RSV replicon-containing cultures in our study lost thereplicon at a rate of 0.6% to 1% per cell division over 12 cellpassages, approximately 50 cell doublings. The mechanism ofthis loss is not known but may simply involve cell divisions inwhich all of the replicon genomes segregate into one daughtercell, leaving the other daughter cell replicon free.

A temperature-sensitive (ts) Sendai virus variant that couldbe maintained in 99% of the infected cells grown at the non-permissive temperature of 38°C for 180 cell doublings has beendescribed (37). This level of replicon maintenance is muchhigher than that for our RSV replicon, in the absence of aneffective concentration of blasticidin. This apparent differencemay be due to the fact that most ts mutants are leaky and asmall amount of infectious Sendai virus may be produced dur-ing nonpermissive temperature incubation or during cell pas-

saging. Only a small amount of virus would be required toinfect the few replicon-free daughter cells produced each cycle.In addition, this ts Sendai virus contained 35 amino acidchanges from its parent strain. It is not clear which of thesemutations were necessary for its noncytopathic phenotype. Wehave found that the RSV replicon without any mutations isnoncytopathic. We have also found that the inclusion of theappropriate concentration of blasticidin in the medium canprevent the slow loss of the RSV replicon by killing the cellsthat have lost their replicon.

The RSV replicon is capable of long-term expression offoreign genes, as shown here by the example of GFP and theblasticidin S deaminase gene. It may be useful as a cytoplasmicvector for long-term gene expression in cultured cells. RSVreplicon-containing cells may also be a useful tool for high-throughput screening to identify antiviral compounds targetingthe replicative machinery of RSV. To that end, we have re-cently inserted a luciferase gene into the RSV replicon (un-published data). Because we have been able to mobilize thereplicon as OSVs by providing the RSV G and F proteins intrans while retaining its native targeting ability, some form ofthe replicon may be useful as an attenuated vaccine for RSVand/or for expressing a foreign viral protein(s). The RSV rep-licon could also be useful as a self-limiting gene therapy vector,as recently demonstrated for Sendai virus replicons (3, 17, 18,22, 30, 31, 51, 58). The RSV replicon has the advantages ofrelative stability in a cell population over many cell divisions, alack of cytotoxicity in nearly all the cell lines tested, the abilityto express foreign genes, and as an RNA virus, the inability forits genome to be incorporated into the host DNA. Finally,understanding the mechanism by which the RSV replicon iscontrolled in cells might provide insights for controlling RSVreplication.

ACKNOWLEDGMENTS

We thank Charles Rice for the BHK-SR19-T7 cells, Russell andJoan Durbin for help with the IFN assay, Cynthia McAllister for helpwith flow sorting, Barb Newton and Steven Kwilas for excellent tech-nical assistance, Beth McNally and Emilio Flano for their help with thequantitative PCR, and Rachel Fearns for the full-length RSV cDNAclone, D53/BsiWI.

This work was supported by Apath, LLC, and by grants AI047213and HL051818 from the National Institutes of Health. P.L.C. wassupported by the NIAID, NIH, Intramural Research Program.

REFERENCES

1. Agapov, E. V., et al. 1998. Noncytopathic Sindbis virus RNA vectors forheterologous gene expression. Proc. Natl. Acad. Sci. U. S. A. 95:12989–12994.

2. Baldridge, P., and L. B. Senterfit. 1976. Persistent infection of cells in cultureby respiratory syncytial virus. Proc. Soc. Exp. Biol. Med. 151:684–688.

3. Ban, H., et al. 2007. Expression and maturation of Sendai virus vector-derived CFTR protein: functional and biochemical evidence using a GFP-CFTR fusion protein. Gene Ther. 14:1688–1694.

4. Barretto, N., L. K. Hallak, and M. E. Peeples. 2003. Neuraminidase treat-ment of respiratory syncytial virus-infected cells or virions, but not targetcells, enhances cell-cell fusion and infection. Virology 313:33–43.

5. Blight, K. J., A. A. Kolykhalov, and C. M. Rice. 2000. Efficient initiation ofHCV RNA replication in cell culture. Science 290:1972–1974.

6. Blight, K. J., J. A. McKeating, and C. M. Rice. 2002. Highly permissive celllines for subgenomic and genomic hepatitis C virus RNA replication. J. Vi-rol. 76:13001–13014.

7. Byrappa, S., D. K. Gavin, and K. C. Gupta. 1995. A highly efficient proce-dure for site-specific mutagenesis of full-length plasmids using Vent DNApolymerase. Genome Res. 5:404–407.

8. Cantell, K. 1961. Production and action of interferon in HeLa cells. Arch.Gesamte Virusforsch. 10:510–521.

4800 MALYKHINA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.

9. Carroll, A. R., and R. R. Wagner. 1979. Role of the membrane (M) proteinin endogenous inhibition of in vitro transcription by vesicular stomatitisvirus. J. Virol. 29:134–142.

10. Cattaneo, R., et al. 1989. Mutated and hypermutated genes of persistentmeasles viruses which caused lethal human brain diseases. Virology 173:415–425.

11. Cheng, X., H. Park, H. Zhou, and H. Jin. 2005. Overexpression of the M2-2protein of respiratory syncytial virus inhibits viral replication. J. Virol. 79:13943–13952.

12. Collins, P. L., and B. S. Graham. 2008. Viral and host factors in humanrespiratory syncytial virus pathogenesis. J. Virol. 82:2040–2055.

13. Collins, P. L., et al. 1995. Production of infectious human respiratory syn-cytial virus from cloned cDNA confirms an essential role for the transcrip-tion elongation factor from the 5� proximal open reading frame of the M2mRNA in gene expression and provides a capability for vaccine develop-ment. Proc. Natl. Acad. Sci. U. S. A. 92:11563–11567.

14. Dryga, S. A., O. A. Dryga, and S. Schlesinger. 1997. Identification of muta-tions in a Sindbis virus variant able to establish persistent infection in BHKcells: the importance of a mutation in the nsP2 gene. Virology 228:74–83.

15. Emeny, J. M., and M. J. Morgan. 1979. Regulation of the interferon system:evidence that Vero cells have a genetic defect in interferon production.J. Gen. Virol. 43:247–252.

16. Falsey, A. R., and E. E. Walsh. 2005. Respiratory syncytial virus infection inelderly adults. Drugs Aging 22:577–587.

17. Ferrari, S., et al. 2007. Sendai virus-mediated CFTR gene transfer to theairway epithelium. Gene Ther. 14:1371–1379.

18. Ferrari, S., et al. 2004. A defective nontransmissible recombinant Sendaivirus mediates efficient gene transfer to airway epithelium in vivo. GeneTher. 11:1659–1664.

19. Frolov, I., et al. 1999. Selection of RNA replicons capable of persistentnoncytopathic replication in mammalian cells. J. Virol. 73:3854–3865.

20. Garcia-Barreno, B., A. Portela, T. Delgado, J. A. Lopez, and J. A. Melero.1990. Frame shift mutations as a novel mechanism for the generation ofneutralization resistant mutants of human respiratory syncytial virus. EMBOJ. 9:4181–4187.

21. Ghildyal, R., J. Mills, M. Murray, N. Vardaxis, and J. Meanger. 2002.Respiratory syncytial virus matrix protein associates with nucleocapsids ininfected cells. J. Gen. Virol. 83:753–757.

22. Griesenbach, U., et al. 2006. Effect of tolerance induction to immunodom-inant T-cell epitopes of Sendai virus on gene expression following repeatadministration to lung. Gene Ther. 13:449–456.

23. Guerrero-Plata, A., E. Ortega, and B. Gomez. 2001. Persistence of respira-tory syncytial virus in macrophages alters phagocytosis and pro-inflammatorycytokine production. Viral Immunol. 14:19–30.

24. Hanley, L. L., et al. 2010. Roles of the respiratory syncytial virus trailerregion: effects of mutations on genome production and stress granule for-mation. Virology 406:241–252.

25. Hirata, T., et al. 2002. An improved method for recovery of F-defectiveSendai virus expressing foreign genes from cloned cDNA. J. Virol. Methods104:125–133.

26. Hobson, L., and M. L. Everard. 2008. Persistent of respiratory syncytial virusin human dendritic cells and influence of nitric oxide. Clin. Exp. Immunol.151:359–366.

27. Hu, C., and K. C. Gupta. 2000. Functional significance of alternate phos-phorylation in Sendai virus P protein. Virology 268:517–532.

28. Inoue, M., et al. 2003. A new Sendai virus vector deficient in the matrix genedoes not form virus particles and shows extensive cell-to-cell spreading.J. Virol. 77:6419–6429.

29. Inoue, M., et al. 2003. Nontransmissible virus-like particle formation byF-deficient Sendai virus is temperature sensitive and reduced by mutations inM and HN proteins. J. Virol. 77:3238–3246.

30. Inoue, M., et al. 2004. Recombinant Sendai virus vectors deleted in both thematrix and the fusion genes: efficient gene transfer with preferable proper-ties. J. Gene Med. 6:1069–1081.

31. Kanzaki, S., A. Shiotani, M. Inoue, M. Hasegawa, and K. Ogawa. 2007.Sendai virus vector-mediated transgene expression in the cochlea in vivo.Audiol. Neurootol. 12:119–126.

32. Kato, T., et al. 2003. Efficient replication of the genotype 2a hepatitis C virussubgenomic replicon. Gastroenterology 125:1808–1817.

33. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

34. Levine, S. 1977. Polypeptides of respiratory syncytial virus. J. Virol. 21:427–431.

35. Lohmann, V., F. Korner, A. Dobierzewska, and R. Bartenschlager. 2001.Mutations in hepatitis C virus RNAs conferring cell culture adaptation.J. Virol. 75:1437–1449.

36. Lohmann, V., et al. 1999. Replication of subgenomic hepatitis C virus RNAsin a hepatoma cell line. Science 285:110–113.

37. Nishimura, K., et al. 2007. Persistent and stable gene expression by a cyto-plasmic RNA replicon based on a noncytopathic variant Sendai virus. J. Biol.Chem. 282:27383–27391.

38. Olivo, P. D., P. L. Collins, M. E. Peeples, and S. Schlesinger. 1998. Detectionand quantitation of human respiratory syncytial virus (RSV) using minige-nome cDNA and a Sindbis virus replicon: a prototype assay for negative-strand RNA viruses. Virology 251:198–205.

39. Oomens, A. G., K. P. Bevis, and G. W. Wertz. 2006. The cytoplasmic tail ofthe human respiratory syncytial virus F protein plays critical roles in cellularlocalization of the F protein and infectious progeny production. J. Virol.80:10465–10477.

40. Oomens, A. G., A. G. Megaw, and G. W. Wertz. 2003. Infectivity of a humanrespiratory syncytial virus lacking the SH, G, and F proteins is efficientlymediated by the vesicular stomatitis virus G protein. J. Virol. 77:3785–3798.

41. Oomens, A. G., and G. W. Wertz. 2004. The baculovirus GP64 proteinmediates highly stable infectivity of a human respiratory syncytial virus lack-ing its homologous transmembrane glycoproteins. J. Virol. 78:124–135.

42. Oomens, A. G., and G. W. Wertz. 2004. trans-Complementation allows re-covery of human respiratory syncytial viruses that are infectious but deficientin cell-to-cell transmission. J. Virol. 78:9064–9072.

43. Peeples, M., and S. Levine. 1981. Characteristics of a persistent respiratorysyncytial virus infection in HeLa cells. Virology 113:141–149.

44. Perez, D. R., and R. O. Donis. 1998. The matrix 1 protein of influenza A virusinhibits the transcriptase activity of a model influenza reporter genome invivo. Virology 249:52–61.

45. Perrotta, A. T., and M. D. Been. 1991. A pseudoknot-like structure requiredfor efficient self-cleavage of hepatitis delta virus RNA. Nature 350:434–436.

46. Pringle, C., R. P. V. Shirodaria, P. Cash, D. J. Chiswell, and P. Malloy. 1978.Initiation and maintenance of persistent infection by respiratory syncytialvirus. J. Virol. 28:199–211.

47. Sastre, P., A. G. Oomens, and G. W. Wertz. 2007. The stability of humanrespiratory syncytial virus is enhanced by incorporation of the baculovirusGP64 protein. Vaccine 25:5025–5033.

48. Schwarze, J., D. R. O’Donnell, A. Rohwedder, and P. J. Openshaw. 2004.Latency and persistence of respiratory syncytial virus despite T cell immu-nity. Am. J. Respir. Crit. Care Med. 169:801–805.

49. Sumpter, R., Jr., et al. 2005. Regulating intracellular antiviral defense andpermissiveness to hepatitis C virus RNA replication through a cellular RNAhelicase, RIG-I. J. Virol. 79:2689–2699.

50. Suryanarayana, K., K. Baczko, V. ter Meulen, and R. R. Wagner. 1994.Transcription inhibition and other properties of matrix proteins expressed byM genes cloned from measles viruses and diseased human brain tissue.J. Virol. 68:1532–1543.

51. Tanaka, S., et al. 2007. Impact of deletion of envelope-related genes ofrecombinant Sendai viruses on immune responses following pulmonary genetransfer of neonatal mice. Gene Ther. 14:1017–1028.

52. Techaarpornkul, S., N. Barretto, and M. E. Peeples. 2001. Functional anal-ysis of recombinant respiratory syncytial virus deletion mutants lacking thesmall hydrophobic and/or attachment glycoprotein gene. J. Virol. 75:6825–6834.

53. Teng, M. N., and P. L. Collins. 1998. Identification of the respiratory syn-cytial virus proteins required for formation and passage of helper-dependentinfectious particles. J. Virol. 72:5707–5716.

54. Teng, M. N., et al. 2000. Recombinant respiratory syncytial virus that doesnot express the NS1 or M2-2 protein is highly attenuated and immunogenicin chimpanzees. J. Virol. 74:9317–9321.

55. Ternette, N., D. Stefanou, S. Kuate, K. Uberla, and T. Grunwald. 2007.Expression of RNA virus proteins by RNA polymerase II dependent expres-sion plasmids is hindered at multiple steps. Virol. J. 4:51.

56. Udem, S. A., and K. A. Cook. 1984. Isolation and characterization of measlesvirus intracellular nucleocapsid RNA. J. Virol. 49:57–65.

57. Wilkinson, T. M., G. C. Donaldson, S. L. Johnston, P. J. Openshaw, and J. A.Wedzicha. 2006. Respiratory syncytial virus, airway inflammation, and FEV1decline in patients with chronic obstructive pulmonary disease. Am. J. Re-spir. Crit. Care Med. 173:871–876.

58. Yoshizaki, M., et al. 2006. Naked Sendai virus vector lacking all of theenvelope-related genes: reduced cytopathogenicity and immunogenicity.J. Gene Med. 8:1151–1159.

VOL. 85, 2011 RESPIRATORY SYNCYTIAL VIRUS REPLICON 4801

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 18

Oct

ober

202

1 by

84.

245.

222.

110.