International Conference on

Biodiversity

Abs Soc Indon Biodiv vol. 4 | no. 3 |pp. 49‐90 | May 2017 

ISSN: 2407‐8069  

Kawah

 Putih Lake of Sou

th Ban

dung

; pho

to by  A. D

urad

jak 

Selected manuscripts will be available at 

Organized by 

SECRETARIAT ADDRESSSekretariat Masyarakat Biodiversitas Indonesia, Kantor Jurnal Biodiversitas, Jurusan Biologi Gd. A, Lt. 1, FMIPA UNS, Jl. Ir.Sutami 36A Surakarta 57126, Jawa Tengah, Indonesia. Tel. +62-897-6655-281. Email: biodiversitas@gmail.com. Website:biodiversitas.mipa.uns.ac.id/snmbi.html

Organized by Selected manuscriptswill be available at

Abstrak Seminar Nasional MBI, UI Depok, 20 Desember 2014 v

7.

THIS PAGE INTENTIONALLY LEFT BLANK

TIME SCHEDULEInternational Conference on Biodiversity

Society for Indonesian Biodiversity (SIB)Bandung, Indonesia, 20-21 May 2017

TIME ACTIVITIES PERSON IN CHARGE SITE

May 20, 2017

07.30-08.00 Registration Committee Lobby08.00-08.15 Opening ceremony Chairman of the SIB R1

08.15-08.30 Photo session and coffee break Committee R1, Lobby08.30-10.00 Panel I Moderator R1

Prof. Dr. Sahrul AnnuarDr. Parikesit

10.00-11.30 Panel II Moderator R1Prof. Dr. Anne Russon *)Dr. Morio Tsukada

11.30-13.00 Rest, prayer, lunch & Poster session Committee Lobby

13.00-14.00 Parallel presentation IGroup 1: AO-01 to AO-07 Moderator R2Group 2: BO-12 to BO-18 Moderator R3Group 3: CO-11 to CO-17 Moderator R4Group 4: DO-11 to EO-04 Moderator R5

14.00-15.00 Parallel presentation IIGroup 5: AO-08 to BO-04 Moderator R2Group 6: BO-19 to CO-03 Moderator R3Group 7: CO-18 to DO-03 Moderator R4Group 8: EO-05 to EO-12 Moderator R5

15.00-15.15 Coffee break, prayer Committee Lobby

15.15-16.15 Group 9: BO-05 to BO-11 Moderator R2Group 10: CO-04 to CO-10 Moderator R3Group 11: DO-04 to DO-10 Moderator R4Group 12: EO-13 to EO-20 Moderator R5

16.15-16.30 Announcement of the Best Presenters

Closing ceremony & other explanation

Chairman of the Board ofAssessorsChairman of the Committee

R2

May 21, 201707.30- ... City tour [optional] Committee Lobby

iv

Upcoming events:

1. July 5-8, 2017 – Derawan, Berau, East Kalimantan (International Conference on Biodiversity)http://biodiversitas.mipa.uns.ac.id/S/gen/schedules.html

2. September 2-3, 2017 – Bogor, West Java (National Seminar)http://biodiversitas.mipa.uns.ac.id/S/gen/schedules.html

3. September 23-24, 2017 – Palu, Central Sulawesi (International Conference on Biodiversity)http://biodiversitas.mipa.uns.ac.id/S/gen/schedules.html

4. October 14-15, 2017 – Pontianak, West Kalimantan (International Conference on Biodiversity)http://biodiversitas.mipa.uns.ac.id/S/gen/schedules.html

5. November 4-5, 2017 – Medan, North Sumatra (International Conference on Biodiversity)http://biodiversitas.mipa.uns.ac.id/S/gen/schedules.html

6. December 8-10, 2017 – Bali (International Conference on Biodiversity)http://biodiversitas.mipa.uns.ac.id/S/gen/schedules.html

TABLE OF CONTENTSInternational Conference on Biodiversity

Society for Indonesian Biodiversity (SIB)Bandung, Indonesia, 20-21 May 2017

CODE TITLE AUTHOR(S) PAGES

Genetic diversityAO-01 Polymorphism and development of gene-based SNAP

Marker for Phalaenopsis flower color characteristicHaristianita Dewi Mega, SukmaDewi, Sudarsono Sudarsono

49

AO-02 An efficient and reliable DNA typing of cultivars andplus tree clones in Acacia mangium using multiplex-PCR of SCAR markers

AYPBC Widyatmoko, SusumuShiraishi

49

AO-03 Genetic variation of growth and disease resistance trainsin open-pollinated provenance progeny trials ofFalcataria moluccana growing on two rust-affected sitesat age 18 months

Liliana Baskorowati, David Bush,Mudji Susanto, Dedi Setiadi

50

AO-04 Transferability of Simple Sequence Repeat (SSR)markers developed in two bamboo species collectedfrom Karangwangi Village, Cianjur, West Java,Indonesia

Annisa, Novio Ananti Yusril, JokoKusmoro, Johan Iskandar

50

AO-05 Biodiversity: Issues and challenges in the era ofglobalization

Partha Pratim Medhi 50

AO-06 Identification of The Insulin-Like Growth Factor I (IGF-1) gen polymorphism in native chicken and broilerchicken using PCR-RFLP

Pipih Suningsih Effendi 51

AO-07 Molecular phylogeny of Styrax sumatrana inferred fromtrnL-trnF cpDNA sequence

Arida Susilowati, HentiHendalastuti Rachmat

51

AO-08 Gene flow and selection evidence of sandalwood undervarious population structures in Gunung Sewu, and itseffects on genetic differentiation

Yeni W. N. Ratnaningrum, SaptoIndrioko, Eny Faridah, AtusSyahbudin

51

AO-09 Housekeeping gene as a source of calibrator candiate forHER-2 scoring in breast cancer study based on qPCR

Rismaya, Sri Budiarti, Desriani, 52

AO-10 Confirmation on species and prevalence of Omotemnusminiatocrinitus Chevrolat (Coleoptera: Dryophthoridae)on snakefruit growing areas in Yogyakarta and Central

Rangga Arinta Wisastra, EdhiMartono, Suputa

52

vi

Java, Indonesia

AP-01 Characterization of soybean genotypes tolerant todrought stress based on physiological characters atreproductive stage

M. Muchlish Adie, AydaKrisnawati

52

AP-02 The effect of seed position in pot on the seed viabilityand vigor from several local accession of yam bean(Pachyrizus erosus)

Ayda Krisnawati, M. MuchlishAdie

53

AP-03 The diversity of leaf trichome on soybean lines and itsassociation to oviposition of whitefly eggs.

Apri Sulistyo, Kurnia ParamitaSari, Purwantoro

53

AP-04 The genetic relationship of Indonesian soybean varietiesbased on agro-morphological characters

Purwantoro, Apri Sulistyo, NovitaNugrahaeni

53

AP-05 Microsatellite-based genetic diversity within andbetween species of Peranakan Ongole and Madura cattlebreeds in Java, Indonesia

Sutarno, N. Kurninaningrum, E.Herawati, A.D. Setyawan

54

Diversity of speciesBO-01 Intensity of Trichodina sp. protozoon of tawes, nilem,

mujahir and gourami cultivated in a polyculturesystem

Rokhmani, Prasetyarti Utami 54

BO-02 Diversity of epiphytic Bryophyte at Mount Telomoyo,Central Java, Indonesia in dry season

Anita Gustinawati, Briskha LejarN., Fiki Ratna Sari

55

BO-03 Selection and characterization of soil microorganismsfor using biodegradation of crude oil contaminatedmedia

Muhammad Fauzi, PujawatiSuryatmana, Mieke RochimiSetiawati, Asri Peni Wulandari

55

BO-04 Diversity of arbuscular mycorrhizal fungi trapped fromplants rhizosphere of peat swamp forest

Hanna Artuti Ekamawanti,Abdurrani Muin, Annas Azhari

55

BO-05 Identification of wild animal in degradation peatlandforest in a forest concession of Central Kalimantan,Indonesia with camera trap method

Roy Rendra, Siti Maimunah,Bernatt Ripoll

56

BO-06 Orangutan survey in a degraded peatland forestconcession of Central Kalimantan, Indonesia

Tedy Farmana, Siti Maimunah,Bernatt Ripoll

56

BO-07 Autecology of Myrmechopytes in Bengkulu Province,Indonesia

Safniyeti, Sulistijorini,Chikmawati,

56

BO-08 Effect of seed biopriming with endophytic bacteria onseed growth of rice at saline medium condition

Listiani Sugiyono, Mieke RochimiSetiawati, Tualar Simarmata,Fiqriah H. Khumairah

57

BO-09 Isolation and antibacterial activities of actinomycetesisolated from mangrove rhizosphere in mangrove forestof Torosiaje, Gorontalo, Indonesia

Yuliana Retnowati, SukartiMoeljopawiro, Tjut SugandawatyDjohan, Endang SutaringingsihSoetarto, Langkah Sembiring

57

BO-10 Distribution and diversity of antibiotics-producingactinomycetes in mangrove ecosystem of Torosiaje,Gorontalo, Indonesia

Yuliana Retnowati, SukartiMoeljopawiro, Tjut SugandawatyDjohan, Endang SutaringingsihSoetarto, Langkah Sembiring

58

vii

BO-11 Corticolous lichen diversity as bioindicator of air qualityin Kamojang, West Java, Indonesia

Ririn Eka Permatasari,Muhammad Feisal Jatnika, JokoKusmoro, Prihadi Santoso, IinSupartinah Noer

58

BO-12 Supporting factors for increasing the intensity ofsubterranean termites invasion in the Acacia crassicarpaplantation

Noor F. Haneda, Ichma Y.Retmadhona, Dodi Nandika

58

BO-13 A preliminary conservation: study on Bengkulu’s burgoegg

Heri Dwi Putranto, Gading PutraHasibuan, Yossie Yumiati, JohanSetianto

59

BO-14 Alarming call from Mursala Island, Central Tapanuli,Indonesia: The urgent task for conserving the previouslyreported extinct dipterocarp, Dipterocarpus cinereus

Henti Hendalastuti Rachmat, AtokSubiakto, Kesuma Wijaya

59

Dian Akbarini, Johan Iskandar, 60

BO-16 Zonation design on nesting habitat of green turtle intropical megadiversity construction

Putri Indrawati, Susanti 60

BO-17 The role of compost in enhancing plant growth on tailingex-gold mining

Wiwik Ekyastuti 60

BO-18 Rare actinomycetes of mangrove rhizosphere from EastSegara Anakan, Cilacap, Indonesia and their capabilitiesin inhibiting Multiple Drug Resistance bacterial growth

Dini Ryandini, Agus Irianto, OckyK. Radjasa

60

BO-19 Fish succession in Jatigede Reservoirat District of Sumedang, West Java, Indonesia

Titin Herawati, Ayi Yustiati,Atikah Nurhayati

61

BO-20 Isolation and screening of cellulolytic fungi fromSalacca edulis leaf litter

Siti Lusi Arum Sari, RatnaSetyaningsih, Novita Fitriatul AiniWibowo

61

BO-21 Yeasts diversity in animal products with lipolytic andproteolytic activity

Roostita L. Balia, Ratu Safitri, SriR. Rahayuningsih, Ida Indrawati,Gemilang Lara Utama

61

BO-22 Diversity of ethanol resistant yeasts isolated from fruitwastes of Bandung’s Central Market, Indonesia

Gemilang Lara Utama, DwiWahyudha Wira, Patar Manurung

62

BP-01 Isolation, antimicrobial of lactic acid bacteria andmolecular characterization using 16 S RNA from virgincoconut oilWest Sumatra, Indonesia

Horas Rajagukguk, Safrizayanti,Siti Zulaiha, Sanusi Ibrahim,Sumaryati Syukur

62

BP-02 Nepenthes spp. identification in a degraded peatlandforest concession of Central Kalimantan, Indonesia

Diah Setyawati, SuaibatulAslamiah, Siti Maimunah

63

BP-03 Diversity and status conservation of parrots in TamanWisata Alam Gunung Meja, Manokwari, Papua,Indonesia

Imanius Doansiba, HermanusWarmetan, Hendrik Burwos,Hermanus J. Sikoway

63

BP-04 Diversity of soybean lines resistance to whitefly Bemisiatabaci attack

Kurnia Paramita Sari, ApriSulistyo, Rahma Sheila Y,Purwantoro

63

BO-15 Study on a collaborative planning Biodiversity Park fordevelopment of The Biodiversity Park of Pelawan, Kepulauan Bangka Belitung, Indonesia

viii

BP-05 Characterization of the plant morphology taro localPapua, Indonesia

Joko Restuono, Abner Basna 63

BP-06 Diversity of bacterial gut of common carp as a biologicalcontrol agent for Aeromonas

Yuniar Mulyani, I Nyoman P.Aryantha, Sony Suhandono, AdiPancoro

64

Diversity of ecosystemCO-01 Diversity of soil fauna at three level diversity of tree

species in Pinang-Pinang Plot, Tropical RainforestPadang, Indonesia

F. Marsandi, Hermansah,Agustian, Syafrimen

64

CO-02 The effect of salinity on growth and survival rate ofglass eel Anguilla bicolor bicolor

Ade Yulita Hesti Lukas, DanielDjoko Setiyanto, Tatag Budiardi,Agus Oman Sudrajat, RidwanAffandi

64

CO-03 Edge effects on biomass, growth, and tree speciesdiversity of degraded peatland in West Kalimantan,Indonesia

Dwi Astiani, Lisa M. Curran,Mujiman, Dessy Ratnasari,Ruspita Salim, Nelly Lisnawaty

65

CO-04 Abundance of plant parasitic nematodes generaassociated with BP 308 and BP 42 clone of robustacoffee in Java, Indonesia

Mutala'liah, Siwi Indarti, NugrohoSusetya Putra

65

CO-05 The dynamics of mangrove forest community in itsfunction as carbon storage in Jakarta Bay, Indonesia

Nilam Sari, Mufti P. Patria, TriEdhi Budhi Soesilo, IwanGunawan Tejakusuma

65

CO-06 The dynamics of population and occupation JavanLutung (Trachypithecus auratus, E. Geoffroy, 1812) inthe Natural Tourism Park Pananjung Pangandaran, WestJava, Indonesia

Ruhyat Partasasmita, MuhammadReyyan Puja Laksana, Erri NoviarMegantara

66

CO-07 Assessment of future fisheries biodiversity using amultidimensional scaling approach

Isah Aisyah, Agus Heri Purnomo,Asep K. Supriatna

66

CO-08 Status and threats to coral reef ecosystems in the coastalof Balikpapan, East Kalimantan, Indonesia

Asep Agus Handaka Suryana,Nurudin

67

CO-09 Spatial analysis of rare and threatened raptor diversity inTelaga Warna, Bogor, Indonesia landscape

Susanti Withaningsih, FirmanHadi, Parikesit, Johan Iskandar,Erri N. Megantara

67

CO-10 Introduction of study domestication of manggabai fish(Glossogobius giuris) in different environment

Yuniarti Koniyo, Juliana 67

CO-11 Differences on pollination and flowering of sandalwoodalong landscape gradients in Gunung Sewu, and itsconsequences on the reproductive outputs

Yeni W.N. Ratnaningrum, SaptoIndrioko, Eny Faridah, AtusSyahbudin

68

CO-12 Social capital of the community in the management ofDanau Sentarum National Park, West Kalimantan,Indonesia

Emi Roslinda, Dudung Darusman,Didik Suharjito, Dodik RidhoNurrochmat

68

CO-13 Local biodiversity vis-à-vis resource-poor people:Revealing subsidies from nature

Parikesit 68

ix

CO-14 Mapping of the bundle of forest ecosystem services inWest Java, Indonesia

Hikmat Ramdan 69

CO-15 Tenuipalpus mites (Acari: Tenuipalpidae) on orchidvariants in Malang Raya, East Java, Indonesia

Ulya Wildaniyah, NugrohoSusetya Putra, Suputa

69

CO-16 Biodiversity of Arbuscular Mycorrhizal Fungi and itspotential use for agriculture: Experience from some sitesin West Java, Indonesia

Anne Nurbaity, Titun Supriatun 69

CO-17 Potato Cyst Nematode in East Java, Indonesia: Newlyinfected areas and identification

Happy Cahya Nugrahana, SiwiIndarti, Edhi Martono

70

CO-18 The presence of Functional of Group Species (FGS) onsecondary succession processes in ManglayangMountain forests, Sumedang, West Java, Indonesia

Ichsan Suwandhi, Ihak Sumardi,M. Fakhri W. Sadeli

70

CO-19 The invasion of alien plant species seed in the seedbank: Its implications for abundance and germination ofnative seeds in Mount Manglayang natural forest, WestJava, Indonesia

Ichsan Suwandhi, Ihak Sumardi,Destriana Anelasari

71

CO-20 Diversity of Tripsin activity of sengon inhibitor fromUromycladium tepperianum fungus attack on threelocations of different growth place

Alfi Rumidatul, I Nyoman P.Aryantha, Endah Sulistyawati

71

CO-21 Study of provisioning services on agroforestry systemin Citatah Karst, District of West Bandung, West Java,

Indonesia

Indri Wulandari, Teguh Husodo,Nurullia Fitriani, Erri N.Megantara

71

CP-01 Vegetation structure and composition of coastal forest inLeuweung Sancang Nature Reserve, Indonesia

Tina Safaria Nilawati, YusufHilmi Adisendjaja, Afri Irawan

72

CP-02 Status of population, occupation and seasonal habitatdisplacement of alien bird species in West Java tropicalforest, Indonesia

Ruhyat Partasasmita 72

CP-03 The birds diversity in the vegetation landscape at themontane zone of Mount Tangkuban Perahu, West Java,Indonesia

Ruhyat Partasasmita, Tedi Setiadi 72

CP-04 Analysis of lower plant in Nature Reserve of DungusIwul, Bogor, West Java, Indonesia

Inge Larashati Subro 73

CP-05 Ecological species of lower plant in the peat forestHampangen, Central Kalimantan, Indonesia

Inge Larashati Subro 73

Ethnobiology & SocioeconomicsDO-01 The relationship between community and biodiversity in

corridor of Betung Kerihun and Danau SentarumNational Park, West Kalimantan, Indonesia

Mohamad Arif Rifqi, Heriyadi,Muhammad Syukur Wahyu Putra

73

DO-02 Socio-ecological preferences of determination orangutanrelease site; Study case Mendalam Watershed in KapuasHulu, West Kalimantan, Indonesia

Mohamad Arif Rifqi, Heriyadi,Muhammad Syukur Wahyu Putra

74

x

DO-03 Promoting cultural keystone species development forcommunity benefits: Case study on areca nut utilizationin East Nusa Tenggara, Indonesia

Gerson N. Njurumana, MarianyM. Da Silva, Oskar K. Oematan,S. Agung Sri Raharjo, M.Hidayatullah

74

DO-04 Eusideroxylon zwageri conservation base on localwisdom: A case study on Hutan Ulin Mungku Baru,Palangka Raya District, Central Kalimantan, Indonesia

Siti Maimunah, Faridh AlmuhayatUhib Hamdani, Indartik, MegaLugina

74

DO-05 Biodiversity forest garden system under managementlocal wisdom in West Kutai District, Indonesia

Marten Apuy, Abubakar M.Lahjie, B.D.A.S. Simarangkir,Yosep Ruslim, R. Kristiningrum

75

DO-06 Economic valuations of mangrove forest ecosystem inGampong Kuala Langsa, Langsa City, Aceh, Indonesia

Suri Nurul Alida, Mufti PetalaPatria

75

DO-07 Farmers and tumpang sari: Case study in PalintangHamlet, Cipanjalu Village, Bandung, West Java,Indonesia

Budiawati S. Iskandar, JohanIskandar, Hikmat A. Wibawa

76

DO-08 Strategy of development marine culture through SWOTanalysis approach in Gorontalo Utara District, Indonesia

Citra Panigoro, Juliana 76

DO-09 Technology hunting of Deer Timor (Cervus timorensis)by ethnic Wandamen in Kabupaten Teluk Wondama,West Papua, Indonesia

Stalin Zedrik Kubiari Wosiri,Hermanus Warmetan, MarianaHermina Peday, And Hermanus J.Sikoway

76

DO-10 Preliminary study on utilization and management ofsustainable use of bamboo in West Java, Indonesia

Budi Irawan, Johan Iskandar, 77

DO-11 Valuation of economic losses and conflicts mitigation oflong-tailed monkey-Karangwangi people’s in SouthCianjur, West Java, Indonesia

Ega Oktavianus Putra, RuhyatPartasasmita, Johan Iskandar

77

DO-12 Mathematical methods in conservation biology A.K. Supriatna, M. Z. Ndii, N.Anggriani, E. Carnia

78

DO-13 The analysis of Cirata Dam’s fisheries resourcedepletion, West Java, Indonesia

Zuzy Anna 78

BioscienceEO-01 The effects of bacterial endophytes from potato roots

and tubers on potato growth and Cyst Nematode(Globodera rostochiensis)

Noor Istifadah, Nurhayati Pratama,Syahrizal Taqwim, Toto Sunarto

78

EO-02 Supplementation of VCO rich in medium chain fattyacids, vitamins.omega-3, results an increase HDL, lowertriglyceride, in blood serum of Mus musculus

Sumaryati Syukur, Syafrizayanti,Siti Zulaiha, Mutiara Ismet, TeguhWicaksono, Horas Raja Guguk

79

EO-03 Potency of compounds active extract leaf clove(Syzygium aromaticum) as aphrodisiac

Syahran Wael, Tri RiniNuringtyas, Nastiti Wijayanti,Pudji Astuti

79

EO-04 Kidney histological in streptozotocin-induced maleWistar rats after administration of temulawak rhizome(Curcuma xanthorrhiza) and belimbing wuluh fruit(Averrhoa bilimbi) combined extract

Ema Purnama Sari, Madihah, TiaSetiawati, Nining Ratningsih

79

xi

EO-05 Preliminary phytochemical screening and analgesiceffects of the fruit of the sugar palm (Arenga pinnata)ethanol extract

Evi Sovia, Dian Anggraeni 80

EO-06 Carbon sequestration and growth of Anthocephaluscadamba plantation in East Kalimantan, Indonesia

Agus Sarjono, Abubakar M.Lahjie, B.D.A.S. Simarangkir,Yosep Ruslim, R. Kristiningrum

80

EO-07 Performance of probiotic character of Bacillus andSaccharomyces encapsulated in skim milk

Ratu Safitri, Yuli Andriani, SarahDewi Fakhrudin, Roostita Balia

81

EO-08 Steeping potential of Usnea baileyi as antioxidants onrats spermatogenesis (Rattus norvegicus) exposed bylead acetate

Dwi Nur Laksono, Iin SupartinahNoer

81

EO-09 A flooded rice, a solution for degradation forest in aconcession forest area of Central Kalimantan,Indonesia

Fujiasi Asih, Nurul Hidayati,Pienyani Roshawanti

81

EO-10 The contribution of mathematics to the field ofconservation biology

Meksianis Z. Ndii, NursantiAnggriani, Asep K. Supriatna

82

EO-11 Effect of various encapsulant material on viabilityof probiotic Leuconostoc mesenteroides as antiHelicobacter pylori agent

Sri Rejeki Rahayuningsih, RatuSafitri, Nia Rossiana, PoniahAndayaningsih

82

EO-12 Captive breeding and restocking in a conservation model Meksianis Z. Ndii, Asep KSupriatna

82

EO-13 Changing of polyaromatic hydrocarbon (PAH)compound by Pseudomonas aeruginosa on oil sludgebiodegradation

Nia Rossiana, Mia Miranti,Fauziah Nurhusnayain, YayatDhahiyat

83

EO-14 The role of gelatin hydrolysate from pygostyle of broilerby through enzymatic hydrolysis process Aspergillusniger to prophylaxis of osteoporosis white rat (Rattusnorvegicus)

Yasmi Purnamasari Kuntana,Roostita Balia, Sayuti Murad, YuliAstuti Hidayat

83

EO-15 Antimicrobial potency from endophytic bacteria ofbignay plant (Antidesma bunius) against pathogenicbacteria

Ida Indrawati, Nia Rossiana,Anditafitrimutiara Rizki, PoniahAdyaningsih

84

EO-16 Potential use of kangkong seed (Ipomoea aquatica) asalternative feed to increase quail egg production(Coturnix-coturnix japonica)

Astuti Kusumorini, MiftahNurfarid, Ana Rochana, RachmatWiradimadja, Ramadhani EkaPutra

84

EO-17 Effectiveness of subculture Helicoverpa armigerapolyhedrosis virus (HaNPV1) formulation indry powder and carrier by water, talcum, and cornstarch

Mia Miranti, Melanie, RizkaKusuma Putri

84

EO-18 Chitosan application effect on plant growth and theexistence of stunting disease in pepper seedling

Emerensiana Uge, Sri Sulandari,Sedyo Hartono, SusamtoSomowiyarjo

85

EO-19 Microalgae Haematococcus pluvialis protect againstnaphthalene-induced cataract formation in mice lens

Agus Salim 85

EO-20 Viability of Lactobacillus bulgaricus, Lactobacillusacidophilus and Saccharomyces cerevisiae before andafter spray-drying in maltodextrin

Yuli Andriani, Ratu Safitri, SriRejeki Rahayuningsih

85

xii

EP-01 In vitro screening of potential probiotic lactic acidbacteria from Indonesian fermented food

Gunawan Priadi, FitriSetiyoningrum, Fifi Afiati,Rohmatusholihat, PuspitaLisdiyanti

86

EP-02 Different levels of the fermented yellow corn meal indiets for jelawat, Leptobarbus hoevenii Bleeker

Hendry Yanto, Junianto, RitaRostika, Yuli Andriani, DediJusadi

86

EP-03 The palatability of cajuput leaves waste as thesubstitution feed of sheep

Ana Widiana, Deydra Fitria Nur,Iman Hernaman

86

EP-04 Effects of organic fertilizer and plant spacing on early-medium maturity soybean

Henny Kuntyastuti, Sri Ayu DwiLestari, Sutrisno

87

EP-05 Topical treatment for streptozotocin-induced diabeticmice with ointment based on djenkol (Archidendronpauciflorum) fruit peel extract

Desak Made Malini, FitriKamilawati, Madihah, And JohanIskandar

87

EP-06 Host preference of Bemisia tabaci Bedjo 87

EP-07 Avocado paste as fat substitute in ice cream Ervina, Eliyano Abdillah,, IwanSurjawan

88

EP-08 Hematological effect of sappan wood (Caesalpiniasappan) extract tablet on iron overload condition of rats

Kenti Prahmanti, Desak MadeMalini, Lelani Reniarti, RatuSafitri

88

EP-09 Iron chelating activity of Caesalpinia sappan extract intablets dosage form on iron overload condition of therats

Ahmad Sazali, Ani MelaniMaskoen, Nining Ratningsih, RatuSafitri

88

EP-10 The use of Verticillium sp. and Lactobacillus sp. forfermentation of ramie (Boehmeria nivea) biomass tochanges nutrients and parameters silage

Asri Peni Wulandari, Cesilia TiurMariana Saragi, M. Nurzaman

89

EP-11 Effects of organic and inorganic fertilizers on the yieldof early-medium maturity soybean

Sri Ayu Dwi Lestari, HennyKuntyastuti

89

Note: A. Genetic Diversity, B. Diversity of Species, C. Diversity of Ecosystem, D. Ethnobiology and Socioeconomics, E.Bioscience (Life Science and Technology); O. Oral, P. Poster

ABS SOC INDON BIODIVVol. 4, No. 3, May 2017 ISSN: 2407-8069Pages: 49-90 DOI: 10.13057/asnmbi/m040301

ABSTRACTInternational Conference on Biodiversity

Society for Indonesian Biodiversity (SIB)Bandung, Indonesia, 20-21 May 2017

Genetic diversity

AO-01Polymorphism and development of gene-basedSNAP Marker for Phalaenopsis flower colorcharacteristicHaristianita Dewi Mega1,♥, Sukma Dewi1, SudarsonoSudarsono2

1 Orchid Group Research, Department of Agronomy and Horticulture,Institut Pertanian Bogor. Kampus IPB Darmaga, Jl. Meranti, Babakan,Dramaga, Bogor 16680, West Java, Indonesia. Tel.: +62-251-8629353,♥email: megadewiindica@yahoo.co.id2 Plant Molecular Biology of Plant Breeding and Biotechnology,Department of Agronomy and Horticulture, Institut Pertanian Bogor.Kampus IPB Darmaga, Jl. Meranti, Babakan, Dramaga, Bogor 16680,West Java, Indonesia.

Flavonoid and carotenoid are two major plant pigmentcontaining on Phalaenopsis flower color. The biosynthesisof pigment catalyzed by an enzyme which are involvingsome major genes. In order to revealed the polymorphismfrom domain sequences of candidate genes; ph-PSY(Phytoene Synthase) and ph-F3'5'H (Flavonoid 3'5'-Hydroxylase) underlying Phalaenopsis flower colorphenotype within 3 natural Phalaenopsis genotypes withdifferent major flower color, the genomic gene sequencewas performed using primer designed from SRA(Sequences Read Archive) database of Phal. equestrisIllumina genome sequence successfully amplified DNAfragments genes, 531-1819 bp, respectively. SingleNucleotide Polymorphism developed into SNAP markerthat was preliminary profiled. A close evolutionaryrelationship between Phalaenopsis genes sequences andthose from some genera was demonstrated from thesequence identity and conserve domain against thedatabase. The discovered motif of sequences related toBLAST analysis which demonstrated specific domains ofthose targeted-genes. The SNAP markers were used togenotype 30 Phalaenopsis ‘species’ and 44 progeniesderived from Phal. 'Salu Spot' x Phal. bellina. The genotypeof 30 Phalaenopsis species was clustered into three main

groups with high flower color variability. We could use themarkers to predict the flower characters among progeniesof Phal. 'Salu Spot' x Phal. bellina.

Cluster analysis, F3’5’H gene, gene identification, orchid,plant pigment, PSY gene, SNAP, SRA

AO-02An efficient and reliable DNA typing of cultivarsand plus tree clones in Acacia mangium usingmultiplex-PCR of SCAR markersAYPBC Widyatmoko1,♥, Susumu Shiraishi2

1Center for Forest Biotechnology and Tree Improvement. Jl. PalaganTentara Pelajar KM 15 Purwobinangun, Pakem, Sleman 55582,Yogyakarta, Indonesia. Tel.: +62-274-895954, Fax.: +62-274-896080,♥email: aviwicaksono@yahoo.com2 Laboratory of Silviculture, Faculty of Agriculture, Kyushu University.Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan.

By combining the high reproducibility of SCAR and thehigh efficiency of multiplex-PCR, we develop a new cloneidentification system for managing cultivars and plus treeclones in Acacia mangium using multiplex-PCR of SCARmarkers (MuPS). Fifty-eight polymorphic RAPD fragmentswere selected and used for developing SCAR markers. Ofthese 58 SCAR markers, 23 markers were polymorphic,and the remaining 35 were monomorphic. One of thepolymorphic markers was co-dominant. Eighteen markerswere selected from the polymorphic markers, and threeMuPSs which consist of six SCAR markers, respectively,were constructed. Based on the results of evaluation of thereproducibility of MuPS profiles, the demand for templateDNA quality, and application to some PCR machines andtwo DNA polymerases, it was proved that the clonejudgments by this method possessed high reliability andcompatibility. The MuPS developed in A. mangium wasapplied into A. auriculiformis which is closely relative tothe former, and twelve of 18 markers could be utilized inthis species as well.

Acacia, clone identification, Multiplex-PCR, SCAR

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9050

AO-03Genetic variation of growth and disease resistancetrains in open-pollinated provenance progenytrials of Falcataria moluccana growing on tworust-affected sites at age 18 monthsLiliana Baskorowati1,♥, David Bush2, Mudji Susanto1,Dedi Setiadi1

1Center for Forest Biotechnology and Tree Improvement. Jl. PalaganTentara Pelajar KM 15 Purwobinangun, Pakem, Sleman 55582,Yogyakarta, Indonesia. Tel.: +62-274-895954, Fax.: +62-274-896080,♥email: liliana.baskorowati@gmail.com2 CSIRO Black Mountain ACT 2601, Australia

Two Falcataria moluccana (Miq.) Barneby & J.W.Grimes(sengon) progeny trials, incorporating 100 differentfamilies from 12 provenances growing on two highly gallrust (Uromycladium falcatarium) prone sites were used toestimate genetic parameters and potentially identify therust-resistant material. The analysis was performed toassess provenance-and family-level survival, rustincidence, and growth at the two progeny trials. Height,diameter, survival and rust incidence was measured at twoprogeny trials at 18 months-of-age located at Jember andLumajang, East Java. Rust incidence at the two trial siteswas severe, with only 39% overall survival (35% and 43%at Jember and Lumajang, respectively). The analysisrevealed significant genetic variation at the provenancelevel for survival, rust incidence and growth. Nostatistically meaningful narrow-sense heritability of thesetraits was indicated, though this is probably reflective ofthe inadequate within-family replication and effectsassociated with uneven stocking resulting from rust-induced mortality. The significant genotype-by-environment (provenance-by-site) interaction was alsoindicated, though the performance of some of the best-andworst-performing provenances was relatively stable,allowing recommendations of suitable provenances forfurther testing on rust-prone sites.

Falcataria moluccana, multilocation, growth, geneticparameter, progeny trial

AO-04Transferability of Simple Sequence Repeat (SSR)markers developed in two bamboo speciescollected from Karangwangi Village, Cianjur,West Java, IndonesiaAnnisa♥, Novio Ananti Yusril, Joko Kusmoro, JohanIskandarDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:annisa.annisa4@gmail.com

Bamboo has been known as a versatile plant with variouspractical useful. This report describes the transferability ofSSR markers developed in India and China to bamboo

species collected from Karangwangi district, Cianjur, WestJava, Indonesia and their potential for Indonesian bamboogenetic diversity study. Ten SSR primer pairs developedfrom Phyllostachys edulis from China and Bambusaarundinacea from India were used to be applied in 15bamboos species from Karangwangi district (Bambusablumeana J.A & J.H. Schultz, B. vulgaris Schrad. Ex.Wndl. var. vulgaris, B. vulgaris Schrad. Ex. Wndl. var.striata, B. maculata Widjaja, B. glaucophylla Widjaja,Dinochloa scandens (Blume ex Neese) Kuntze,Gigantochloa pseudoarundinacea (Steud.) Widjaja, G.apus J.A & J.H. Schultz. Kurz., G. atter (Hassk). Kurz, G.atroviolacea Widjaja, G. hasskarliana (Kurz.) Backer exHeyne, Schizostachyum, sp., and S. iraten Widjaja).Twelve out of 15 samples were able to be amplified withthe SSR primers. The number of alleles detected at eachlocus ranged from 2-8, with PIC value ranged from 0.50 to0.88. The high levels of transferability of SSR primerspairs marker used in this research may be applicable foranalysis of intra-and inter-Indonesian bamboo speciesgenetic diversity study

Bamboo, Karangwangi, microsatellite, transferability

AO-05Biodiversity: Issues and challenges in the era ofglobalizationPartha Pratim MedhiNorth Eastern Hill University, Umshing Mawkynroh, Shillong,Meghalaya 793022, India. Tel.: +91-364-230 7930, ♥ email:medhi.partha@gmail.com

The environment is the gift of nature which nourishes themankind. With the advancement of technology over thecenturies, the pace of globalization has expedited thousandfold. However, activities like overexploitation, habitat lossand climate change, are currently causing adversetransformations in ecosystems and unprecedented loss ofbiological diversity. Globalization needs a globalconsensus to tackle environmental problems. The firstdecade of this century has seen the efforts and steps takenby the global community in dealing with the emergingissues and challenges involving biodiversity. VariousInternational instruments starting from Convention onBiological Diversity (CBD) till COP 13 held in Cancun,Mexico December 2016 calls for protection of biodiversityloss at the global, national and regional level. However, theloss of Biodiversity even impacts farmers and TraditionalKnowledge Holders in their stake of Access and BenefitSharing (ABS) mechanism. This paper tries to analyze andexamine the various aspects of biodiversity protection andsuggests measures for the effective legal mechanism in theera of Globalization.

ABS, biodiversity, CBD, environment, globalization

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 51

AO-06Identification of the Insulin-Like Growth Factor I(IGF-1) gen polymorphism in native chicken andbroiler chicken using PCR-RFLPPipih Suningsih EffendiDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Indonesia. Jl. Lingkar Kampus Raya, Kampus UI, Gedung ELt. 2, Depok 16424, West Java, Indonesia. Tel.: +62-21-7270163 Fax.:+62-21-78849010. ♥email: pipih_suningsih@yahoo.com

Identification of gene diversity is closely related andproduction levels. One of the genes that suspected to havean influence on the nature of growth is the Insulin-likeGrowth Factor I (IGF-1). Restriction fragment lengthpolymorphisms and polymerase chain reaction allow theidentification of genetic diversity directly at the DNA level.This study aims to identify the diversity of IGF-1 and findout the variation of genes at several native chicken andbroiler. A total number of samples were 100 heads from arenative chicken and broiler chicken (Gallus domesticus).Native chicken that consists of four types of 15 kampungchicken, 16 kedu chicken, 15 sentul chicken and 15 pelungchicken, 23 arab chicken and 16 broiler chicken. UsingPCR-RFLP method by Pst 1 restriction enzyme.Genotyping the IGF-1 gene resulted in two alleles, namelyA and B, with three genotypes, namely AA, AB and BB.The average frequency of the A allele followed by nativechicken and broiler chicken was higher (0.68) than the Ballele (0.32). AA genotype had the highest averagefrequency (0.56) than the AB genotype (0.40) and the BBgenotype (0.04).

Broiler chicken, IGF-I, genetic polymorphism, nativechickens

AO-07Molecular phylogeny of Styrax sumatrana inferredfrom trnL-trnF cpDNA sequenceArida Susilowati1,♥, Henti Hendalastuti Rachmat2

1 Faculty of Forestry, Universitas Sumatera Utara. Jl. Tri Dharma UjungNo 1, Kampus USU Medan. North Sumatera Indonesia, ♥ email:arida_iswanto@yahoo.co.id2Forest Research and Development Center, Forest Research andDevelopment Agency, Ministry of Environment and Forestry. Jl. GunungBatu No. 5, Bogor. P.O. Box 165 Bogor 16610, West Java, Indonesia

Styrax sumatrana was locally known as Kemenyan Tobaamong local peoples. This species is economicallyimportant and has been massively cultivated for their resinsince centuries in several sites of the North SumatraProvince, Indonesia both in private lands and community.Common and previous identification of the Styrax specieswas generally based on morphology, wood anatomy andpalynology. However, more recent years the use of DNA asa molecular marker is suitable for discriminating manyclosely related species. The objective of the study is todelineate the phylogenetic position of S. sumatrana

growing in North using trnL-trnFcpDNA region. Wecollected three population of S. sumatrana originated fromPhakphak Barat, Humbang Hasundutan and TapanuliUtara, each represented by 10 individuals. Alignment of thetrnL-trnF chloroplast regions contained 941 bp and wefound 5 single nucleotide polymorphisms those determined4 distinct haplotypes for all analyzed individual.Phylogenetic analysis of the species with those other 26Styrax species available placed S. chinensis and S.suberifolius as the closest sister species for S. sumatrana.

Kemenyan toba, trnL-trnF cp DNA, phylogeny, Styraxsumatrana

AO-08Gene flow and selection evidence of sandalwoodunder various population structures in GunungSewu, and its effects on genetic differentiationYeni W. N. Ratnaningrum1,♥, Sapto Indrioko2, EnyFaridah3, Atus Syahbudin4

1 Laboratory of Forest Seed Technology, Faculty of Forestry, UniversitasGadjah Mada. Jl. Agro No.1, Bulaksumur, Caturtunggal, Kec. Depok,Sleman 55281, Yogyakarta, Indonesia. Tel.: +62-274-550541, ♥ email:yeniratnaningrum@gmail.com2 Laboratory of Forest Genetic, Faculty of Forestry, Universitas GadjahMada. Jl. Agro No. 1, Bulaksumur, Caturtunggal, Depok, Sleman 55281,Yogyakarta, Indonesia 3 Laboratory of Plant Physiology, Faculty ofForestry, Universitas Gadjah Mada. Jl. Agro No.1, Bulaksumur,Caturtunggal, Depok, Sleman 55281, Yogyakarta, Indonesia 4

Laboratory of Dendrology and Ethnobotany, Faculty of Forestry,Universitas Gadjah Mada. Jl. Agro No.1, Bulaksumur, Caturtunggal,Depok, Sleman 55281, Yogyakarta, Indonesia

This study combined field observations and isoenzymeanalysis to determine gene flow and selection evidence ofsandalwood (Santalum album Linn.) under variouspopulation structures in Gunung Sewu, southern Java,Indonesia and its effects on genetic differentiation. Thisendangered economic-important species was the origin tothe south-eastern islands, but is recently occurred as newlandraces in Java island, Indonesia. Results suggested that(i) natural barriers contributed to the habitat fragmentationand disrupted gene flow among populations; (ii) the levelof gene flow affected selection processes, with regard tothe bottleneck effects and genetic drifts, which resulted inthe differences in allelic richness and population diversity;and (iii) the variation in gene flow and selection processesresulted in genetic differentiation among populations. Geneflow was restricted and the considerable genetic drift wasoccurred at the condition where the genetic base is lower,the population was highly clonalized, gene flow wasrestricted, and/or the outcross-mating was inhibited. Thegenetic differentiation was highest between populationswithin Timor island, and between Gunung Sewu (Javaisland) and Sumba-Timor islands. Populations were notclustered based on their geographical sites of occurrence,but more by their similarity of genetic structures. Thegenetic differentiations might be best explained by thecombined effect of the differences on genetical processes,with regard to the gene flow and selection events. Both

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9052

differences were existed due to the differences on (i)population structures including landscape types, degree ofclonality and genetic composition at parents level, and (ii)the geographical evolutionary and disturbances histories ofpopulation, which contribute to the equilibrium betweengene flow and drift. These findings emphasized theimportance of larger gene flow and populations' geneticbase to naturally maintain the genetical processes ofsandalwood population under various landscapesstructures.

Gene flow, genetic differentiation, population structures,Santalum album, selection evidence

AO-09Housekeeping gene as a source of calibratorcandidate for HER-2 scoring in breast cancerstudy based on qPCRRismaya1,♥, Sri Budiarti1, Desriani2, ♥♥

1Program of Plant Breeding and Biotechnology, Institut Pertanian Bogor.Kampus IPB Darmaga, Jl. Meranti, Babakan, Dramaga, Bogor 16680,West Java, Indonesia. Tel.: +62-251-8629353, ♥email:rismayaorion@gmail.com2Research Center for Biotechnology, Indonesian Institute of Sciences. Jl.Raya Jakarta-Bogor Km 46, Cibinong, Bogor 16911, West Java,Indonesia. Tel.: +62-21-87907604/87907636, Fax.: +62-21-87907612,♥♥email: desrianilipi@gmail.com, gerodes@yahoo.com

HER-2 amplification in breast cancer gives an implicationin therapy and prognosis. FDA have been approvedFluorescence In situ hybridization (FISH) for HER-2amplification and immunohistochemistry (IHC) for proteinexpression measurement. In this recently times,quantitative PCR techniques have been reported as analternative method for HER-2 amplification determination.Here in this report, we investigated new reference genecoming from housekeeping gene as an alternative calibratorfor Her-2 amplification scoring based on qPCR methods.We compared two recommended housekeeping gene, 18SsRNA and beta-actin, as a candidate for HER-2 calibrator.For methods development, optimization and comparisonstudy between 18S sRNA and beta-actin, we used non-invasive samples (DNA buccal cells). Selected candidatereference further was tested to breast cancer sample thatalready determined for its IHC status. Beta-actin is shownas the best candidate for HER-2 scoring statusdetermination. qPCR concordance result with IHC shown100% among ten test sample. The qPCR efficiency and %CV value shown as a requirement as a theory. qPCRefficiency was 101%, while CV value was around 1,2%.Our result showed a significant correlation with existingmethods, which could complement with those FDAapproved methods.

Breast cancer, FISH, HER-2, IHC, housekeeping gene,qPCR

AO-10Confirmation on species and prevalence ofOmotemnus miniatocrinitus Chevrolat (Coleoptera:Dryophthoridae) on snakefruit growing areas inYogyakarta and Central Java, IndonesiaRangga Arinta Wisastra1,♥, Edhi Martono2, Suputa2

1 Tanjung Balai Asahan Agricultural Quarantine, Jl. Perintis KemerdekaanKM. 9, Simpang Empat, Asahan 21271, North Sumatra, Indonesia.♥email: ranggaarinta@gmail.com2 Department of Plant Pests and Diseases, Faculty of Agriculture,Universitas Gadjah Mada, Jl. Flora No. 1, Bulaksumur, Caturtunggal,Depok, Sleman 55281, Yogyakarta, Indonesia

This experiment was aimed as confirmation on the speciesof Omotemnus miniatocrinitus in snakefruit growing areasbased on its morphological and molecular characteristicsand its distribution in Yogyakarta and Central Java,Indonesia. Insect samples were obtained from the areaswith the hand-picking method. Survey on distribution areaswas conducted at several snakefruit production centers inYogyakarta and Central Java. The results showed that,based on morphological characteristics, species of testedinsects was O. miniatocrinitus, i.e. snout beetle, wholebodies were brown, medium-sized, with an average size of14.51 x 3.67 mm. It had black elliptic longitudinal patternwith two tip parts tapering at median prothorax, blacktriangle patterns were also seen at right and left parts ofbasal prothorax, and the black extending pattern was foundat the lateral part. The distinct black conglobate pattern wasnoticed at median and posterolateral elytra. Based on themolecular characteristics, O. miniatocrinitus have the mostsimilarity with Rhynchophorus palmarum which belongs toDryophthoridae family with 0.799 homology score.Distribution areas of O. miniatocrinitus in snakefruitgrowing areas included: districts of Pakem, Turi, andTempel, District of Sleman, Special Province ofYogyakarta; districts of Srumbung, and Salam, District ofMagelang; districts of Kepil, Sukoharjo, Leksono, andSelomerto, District of Wonosobo; districts of Madukara,Banjarmangu, and Sigaluh, District of Banjarnegara,Province of Central Java.

Distribution areas, molecular, morphology, Omotemnusminiatocrinitus, snakefruit

AP-01Characterization of soybean genotypes tolerant todrought stress based on physiological characters atreproductive stageM. Muchlish Adie♥, Ayda KrisnawatiIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8 Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: mm_adie@yahoo.com

Drought stress is one of the major constraints withinsoybean development in the tropical area of Indonesia,which mostly cultivated at dry season. A total of 19

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 53

soybean genotypes was characterized for their droughttolerance in Probolinggo, East Java, Indonesia (Indonesia)from May-August 2015. The experiment was arranged inrandomized block design with two environments, and eachgenotype had four replications. The optimal environmentwas irrigated during the growth period, and droughtenvironment was irrigated only up to 40 days afterplanting. The range of seed yield at normal environmentwas 1.64-3.41 t/ha (average 2.43 t/ha) and at drought,environment was 1.16-2.45 t/ha (average 1.92 t/ha). Theyield decrease from normal to stress environment wasranged from 4.87-55.25% (average 20.99%). Fivegenotypes showed yield decrease under 10%, and two ofthem had seed yield over 2 t/ha. The drought-tolerantsoybean genotype is characterized by physiologicalcharacteristics of high root dry weight, and followed by arelatively stable of the dry weight of plant parts above theground between the two environments. In this study, twogenotypes (G 511 H/Anjs/Anjs///Anjs-6-11 and Grobogan)were tolerant to drought stress and produce a high yield.Those genotypes could be used as a source of tolerantgenes to drought stress at reproductive stage.

Drought, physiological characters, soybean, tolerant

AP-02The effect of seed position in pot on the seedviability and vigor from several local accession ofyam bean (Pachyrhizus erosus)Ayda Krisnawati♥, M. Muchlish AdieIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8 Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: my_ayda@yahoo.com

The yam bean (Pachyrhizus erosus L.) seeds are formed inrelatively long pods containing between 6-12 seeds/pod. Atotal of six local yam bean accessions from Indonesia wasstudied for its seed position in pod related to seed viabilityand vigor. Field research was carried out in Malang(Indonesia) from May-October 2016. After the pods hadbeen matured, 25 pods were detached from each accession.Each pod was divided into three parts, i.e. base, middle,and tip part. The seeds of each part are mixed and taken asmany as 20 seeds for germinating. The germination testwas performed using sterilized sand medium. The designwas a completely randomized design with two factors andrepeated three times. The first factor was three seedpositions (base, middle, and tip) and the second factor wassix accessions of Indonesian local yam bean. Seed positionat the tip of the pod gave the highest germination value(94.87%) followed by a middle part (90.76%) and the basepart (88.96%). Vigor parameter which measured by speedgermination index (SGI) and germination energy (GE)showed consistency, i.e. highest value was on the seedposition at the middle part, followed by base and tip part ofthe pod. The highest dry weight of stem and root wasproduced by seeds from middle part of the pod, followedby seeds from base and tip part. In the optimal

environment, it can use the seeds of all parts, but in theenvironmental stress condition, it is advisable to use seedsfrom the middle position of the pod to obtain plant growthsimultaneity in the field.

Seed position, viability, vigor, yam bean

AP-03The diversity of leaf trichome on soybean lines andits association to oviposition of whitefly eggsApri Sulistyo♥, Kurnia Paramita Sari, PurwantoroIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8, Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: apri.sulistyo@gmail.com

Leaf trichome is one character that has an important role inantixenosis mechanism. The purpose of this study was todetermine the diversity of leaf trichome in soybean linesand to study their relationship with whitefly preference forlaying eggs. The study was conducted at screen house fromAugust to October in 2016. A total of 91 soybean linesobtained from three cross populations and five soybeanvarieties as checks were used in this study. Each soybeanlines was grown on four polybags and arranged in arandomized block design with two replicates. A free choicetest was used to determine the preference of whitefly inlaying eggs. Observations of leaf trichomes and number ofwhitefly eggs were performed in the laboratory using alight microscope. The results showed that there weresignificant differences in the amount of leaf trichomeamong the soybean lines tested. There was a significantpositive correlation (P < 0.05) between the number of leaftrichomes and the number of whitefly eggs. Imago ofwhitefly tends to like soybean lines with dense leaftrichomes to lay their eggs.

Dense trichome, host plant preferred, soybean lines, whitefly

AP-04The genetic relationship of Indonesian soybeanvarieties based on agro-morphological charactersPurwantoro♥, Apri Sulistyo, Novita NugrahaeniIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8 Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: pur_bagus@yahoo.co.id

Since the first Indonesian soybean varieties were releasedin 1918, many genetic improvements achieved. Most ofthem are obtained through hybridization. This study aimsto determine the genetic relationship of soybean varieties inIndonesia. The research was conducted at KendalpayakExperimental Station from March to June in 2016. A totalof 69 soybean varieties were used in this study. Allvarieties were planted and arranged in a randomized blockdesign with 3 replications. Fourteen agro-morphological

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9054

characters consist of 7 qualitative characters and 7 quantitativecharacters used to calculate the genetic distance of thetested soybean varieties. The results showed that at 75%similarity level obtained 7 clusters. Cluster 1 consists of 17varieties characterized by late maturity and medium seed-sized. Cluster 2 is the largest cluster with 24 varietieshaving characteristics of early to medium age and classifiedas small seed-sized. In cluster 3 there are 18 varieties thathave characteristics of large seeds and classified as mediumaged. Cluster 4 consisting of 17 varieties is characterizedby very late maturity and small seed-sized. While clusters5, 6 and 7 each consist of 1 variety. Based on clusteranalysis it is seen that there are varieties obtained fromcrosses with one of the same elders can split into differentclusters, even with their own elders. This suggests that theelders who have been used in crossbreeding can increasediversity in the basic population, as well as demonstrate thesuccess of selection activities that have been done byIndonesian soybean breeders.

Cluster analysis, genetic distance, similarity, soybeanvarieties

AP-05Microsatellite-based genetic diversity within andbetween species of Peranakan Ongole and Maduracattle breeds in Java, IndonesiaSutarno1,♥, N. Kurninaningrum2, E. Herawati1, A.D.Setyawan1

1Department of Biology, Faculty of Mathematics and Natural Sciences,Universitas Sebelas Maret.Jl. Ir. Sutami 36A Surakarta 57126, CentralJava, Indonesia. Tel./Fax. +62-271-663375, email:nnsutarno@yahoo.com; volatileoils@gmail.com2 Center for Research and Development of Medicinal Plants andTraditional Medicine Tawangmangu. Jl. Raya Lawu No. 11, Kalisoro,Tawangmangu, Karanganyar 57792, Central Java, Indonesia

Indonesia has several species of local cattle, bothindigenous (Bos javanica/banteng, Bali cattle) or crosseswith exotic cattle (Bos indica/Zebu cattle and Bostaurus/European cattle). Peranakan Ongole (PO) andMadura cattle are mostly raised in Java. PO cattle is adescendant of zebu cattle that have adapted to localclimatic of Indonesia, while Madura cattle is a crossbreedbetween Bali cattle and zebu cattle. The aims of thisresearch were to investigate the genetical characteristics ofinter and intra-species of Peranakan Ongole and Maduracattle by using DNA microsatellite marker. The bloodsamples from 20 individuals for each species are extractedusing Wizard Genomic DNA Purification Kit fromPromega (USA). The amplification is carried out byPolymerase Chain Reaction (PCR) for 32 cycles using 5microsatellite locus including BM1824, ETH225,INRA005, MM12, and TGLA227. The research result ofthe genetical characteristics of Peranakan Ongole andMadura cattle are shown by the calculation of Na(Observed number of alleles), Ne (Effective number ofalleles), I (Shannon's Information Index), OHm (Observed

Homozygosity), EHm (Expected Homozygosity), EHt(Expected Heterozygosity), OHt (ObservedHeterozygosity), PIC (Polymorphism Information Content)which are calculated using POPGENE program version1.31. The data showed that there was a genetic diversity ofinter and intra-species of Madura cattle and PeranakanOngole. The average value of Shannon's Information Indexof all microsatellite locus for Peranakan Ongole is 0.76 and1.12 for Madura cattle. Meanwhile, the I average of inter-species is 1.03. The average value of PIC intra-species ofPeranakan Ongole is 0.43 and Madura cattle is 0.63. Theaverage value of Inter-species PIC is 0.57. It can beconcluded that all locus had fulfilled the standard whichwas considered to be informative in observing the geneticpopulation because it has PIC value > 0.5, in particular forthe intra species of Madura cattle.

DNA microsatellite, Genetic diversity, Madura cattle,Peranakan Ongole

Diversity of Species

BO-01Intensity of Trichodina sp. protozoon of tawes,nilem, mujahir and gourami cultivated in apolyculture systemRokhmani1,♥, Prasetyarti Utami2

1 Laboratory of Entomology and Parasitology, Fakultas Biologi,Universitas Jenderal Soedirman. Jl. Dr. Soeparno 63 Grendeng,Purwokerto, Banyumas 53122, Jawa Tengah. Tel.: +62-281-638794, Fax.+62-281-631700, ♥ email: rokhmanitatiek@gmail.com2 Faculty of Mathematics and Natural Sciences, Universitas Terbuka. Jl.Pd. Cabe Raya, Pd. Cabe Ilir, Pamulang, Kota Tangerang Selatan 15418,Banten, Indonesia

Trichodina sp. protozoon, is one among those parasiteswhich able to infect all freshwater fish like: gourami,nilem, mujair and tawes, cultivated in either mono orpolyculture. The occurrence of this infection to the fish fryof up to 80% had ever been reported before. Currently,there are still many Banyumas fish-farmers cultivated theirfreshwater fish in a polyculture technique and put thegourami fish together with nilem, tawes and nila. Researchwhich was purposed to note the intensity of Trichodina sp.protozoon on each type of fish like gourami, nilem, nilaand tawes cultivated in a polyculture technique. Theresearch was done in a survey with sampling area of fishfarmers' ponds of the Purwoksari-Baturraden, Banyumas.Isolation and identification of the protozoon were done inEntomology-Parasitology laboratory of the Faculty ofBiology Universitas Jenderal Soedirman, Purwokerto. Datashowed the intensities of Trichodina sp. varied subsequentlyin either film, nila, tawes or gurame 6.8; 5.8; 5.2 and 2.2.

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 55

Trichodina, intensity, cultivation, gourami, polyculture

BO-02Diversity of epiphytic Bryophyte at MountTelomoyo, Central Java, Indonesia in dry seasonAnita Gustinawati♥, Briskha Lejar N., Fiki Ratna SariFaculty of Biology, Universitas Gadjah Mada. Jl. Teknika Selatan, SekipUtara, Sinduadi, Mlati, Sleman 55281, Yogyakarta, Indonesia. Tel.: +62-274-580839, email: anitagustinawati@gmail.com

Mount Telomoyo, Central Java, Indonesia has a tropicalforest with a diversity of epiphytic Bryophyte. Diversityand abundance of Bryophytes depend on the altitude andepiphyte host tree (phorophytes). Nowadays, Mt.Telomoyo has been undergoing land forest constriction dueto settlement and agriculture by the locals. It impacted tothe diversity of epiphytic Bryophyte which was growth onphorophytes. This research aims to identify the diversity ofepiphytic Bryophyte at Mt. Telomoyo in the dry season.Until now, research about the diversity of epiphyticBryophyte at Mt. Telomoyo along dry conditions has neverbeen done. The results were important as a database aboutresistance genes of bryophyte on dry conditions. Thecollecting method of bryophyte samples was performed byexploration method, that was by taking bryophyte samplesfrom eight stations at 1120 to 1340 m above sea level. Inaddition, the measurement of environmental parameterswas including, air temperature, altitude, humidity and lightintensity. Then, the samples were collected with driedherbarium techniques, and to be identified with a semi-permanent preparation and analyzed using literature. Theidentification results were presented descriptively andmade determination key. This research shows that there are17 species of epiphytic Bryophyte at Mt. Telomoyo,namely Lejeunea flava, Lejeunea holtii, Lejeunea aloba,Hygrolejeunea, Frullania riojaneriensis, Porella sp.,Isopterygium albescens, Leucobryum javense,Macromitrium reinwardtii, Octobleparum albidum,Rhizogonium spiniforme, Sematophyllum saproxylophyllum,Sematophyllum tristiculum, Thuidium investe, Aerobryopsislongissima, Meteriopsis ancistrodes, and Rhacopilumspectabile. Epiphytic Bryophytes could be classified into 3groups as Hepaticopsida, Bryopsida acrocarpus, andBryopsida pleurocarpus. epiphytic Bryophyte specieswhich have been broadly distributed along Mount Telomoyowas Leucobryum javense and Octobleparum albidum.

Diversity, dry season, epiphytic Bryophyte, MountTelomoyo

BO-03Selection and characterization of soilmicroorganisms for using biodegradation of crudeoil contaminated media

Muhammad Fauzi1,♥, Pujawati Suryatmana1, MiekeRochimi Setiawati1, Asri Peni Wulandari2

1Department of Soil Science, Faculty of Agriculture, UniversitasPadjadjaran. Jl. Raya Bandung Sumedang Km. 21 Jatinangor, Sumedang45363, West Java, Indonesia. Tel./Fax. +62-022-7796316, ♥email:muhammadfauzi2791@gmail.com2Departmen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia

This study aims to find the microorganisms which have theability to degrade the hydrocarbon in crude oilcontaminated soil. The crude oil comes from PT. PertaminaRU VI (Indonesia's largest state-owned oil and gascompany) units in Balongan, Indramayu, West Java-Indonesia. This study was carried out from September toOctober 2016 in Laboratory of Microbiology, Departmentof Soil Science and Land Resource Management, Facultyof Agriculture, University of Padjadjaran. The strains werefrom that lab. The microorganisms that were used:Azospriullum sp., Acinetobacter sp., Pseudomonas cepacia,Bacillus subtilis, Penicillium sp., and Aspergillus sp. withtwo replications. The strains were selected based on thecriteria that they were able to display good growth in crudeoil. Their ability to degrade hydrocarbon contamination inthe medium were contaminated with crude oil and theirability especially microbial-dissolver phosphate to dissolvethe phosphate substance. This study showed thatAcinetobacter sp. had higher total plate count thanazosprillum sp. that known as nitrogen fixation microbial.Pseudomonas cepacia, as phosphate dissolving bacterial,was higher than Bacillus subtilis, and Penicillium sp., asphosphate dissolving fungi, was higher than Aspergillus sp.For phosphate solubilization capability microbial,Pseudomonas cepacia had wider halo zone compare toBacillus subtilis, while Penicillium sp. had wider thanAspergillus sp. Meanwhile the efficiency of biodegradationof hydrocarbon, Pseudomonas cepacia was more efficientin the medium than Bacillus subtilis, Penicillium sp. wasmore efficient than Aspergillus sp, and Acinetobacter sp.was more efficient than Azosprillum sp.

Biodegradation, crude oil, hydrocarbon, microorganisms

BO-04Diversity of arbuscular mycorrhizal fungi trappedfrom plants rhizosphere of peat swamp forestHanna Artuti Ekamawanti♥, Abdurrani Muin, AnnasAzhariFaculty of Forestry, Universitas Tanjungpura. Jl. Prof. Hadari Nawawi,Pontianak 78121, West Kalimantan, Indonesia. Tel.: +62-561-765342,583865, 732500, Fax.: +62-561-765342, ♥email: hanna.artuti@gmail.com

A research to obtain the information of arbuscularmycorrhizal (AM) fungi diversity and its association withseveral plants of peat swamp forest Sei Bakau Besar,Pontianak district-West Kalimantan was carried out.Samples of root and peat soil were collected from plantsrhizosphere of ramin (Gonystylus bancanus), jelutung

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9056

(Dyera costulata), pelawan (Tristania sp.), rumput ijuk(Eleocharis atropurpurea), pakis resam (Gleichenialinearis), pasir-pasir (Mezzetia parviflora), kacang ruji(Pueraria sp.), kirinyu (Euphatorium odorata), kangkung(Ipomea reptan) and cengkodok (Melastoma affine).Spores of AM fungi trapped using maize (Zea mays) as hosplant in culture pots were belong to Glomus (14 sporetypes) and Acaulospora (1 spore type) genus. There were15 spore types trapped from rhizosphere of ramin, jelutungand pelawan; 14 spore types from rumput ijuk and pakisresam; 13 spore types from kacang ruji and pasir-pasir; 12spore types from kirinyu; 11 spore types from kangkung;and 10 spore types from cengkodok. AM colonizationwhich found in root samples showed that all tested plantsspecies were AM fungi host plants with the percentage ofmycorrhizal colonization between 13.3% (pelawan andkirinyu) and 46.7% (jelutung). AM fungi diversity found inseveral plants of peat swamp forest are potential naturalresources as biological agents for rehabilitation of degradedpeat swamp forests.

Acaulospora, diversity, Glomus, peat swamp forests,rehabilitation

BO-05Identification of wild animal in degradationpeatland forest in a forest concession of CentralKalimantan, Indonesia with camera trap methodRoy Rendra1, Siti Maimunah1,♥, Bernatt Ripoll2

1 Department of Forestry Science, Faculty of Agriculture and Forestry,Universitas Muhammadiyah Palangkaraya. Jl. RTA Milono KM 1, 5,Langkai, Pahandut, Kota Palangkaraya 73111, Central Kalimantan,Indonesia. Tel.: +62-536-3222184, ♥email: sitimararil@gmail.com2 Borneo Nature Foundation. Jalan Bukit Raya No. 82 Bukit Raya,Palangka Raya 73112, Central Kalimantan, Indonesia

Indonesia is a tropical country with the high biodiversity ofwild animal, and more of those wild animal status are in theblacklist and almost rarely threatened, it caused by morecase, that is hunting, forest conversion for a human activitylike mining, farming, and forest fire. We need to protectand continued monitoring the wild animal for naturalbalance. Automatically observation of wild animal we needto facilitate the conservation program like camera trapmethod. The camera trap is one of a method to observedthe wild animal with recording the animal activity for moretime how we need. This research has done in PT HutanAmanah Lestari (HAL) concession in Barito Selatan andBarito Timur¸ Central Kalimantan, Indonesia toobservation wild animal in this area and analysis wildanimal in this area. PT HAL is a non-comersial concessionwith degradation peatland forest dominant and has theobject to protect the area with full forest restorationactivity. In the high forest density in PT HAL concession,we have observed with 5 camera trap from June untilDecember 2016. The result of this research we have foundmore of picture and video of wild animal in 5 point ofcamera trap position with specific animal activity that are

short-tailed macaque, wild cat and squirrel in one pointwith higher land with Combretocarpus trees dominant inthis area, orangutan activity in point 3 and deer, pangolin,sun bear, bird and wild pig in all of camera trap position.That area has the last wild animal during damageexperience and consents only in the high-density area. Itcan configure how about the high biodiversity of this areabefore damage experience is happening.

Camera trap, degradation peatland forest, wild animal

BO-06Orangutan survey in a degraded peatland forestconcession of Central Kalimantan, IndonesiaTedy Farmana1, Siti Maimunah1,♥, Bernatt Ripoll2

Department of Forestry Science, Faculty of Agriculture and Forestry,Universitas Muhammadiyah Palangkaraya. Jl. RTA Milono KM 1, 5,Langkai, Pahandut, Kota Palangkaraya 73111, Central Kalimantan,Indonesia. Tel.: +62-536-3222184, ♥email: sitimararil@gmail.com2 Borneo Nature Foundation. Jalan Bukit Raya No. 82 Bukit Raya,Palangka Raya 73112, Central Kalimantan, Indonesia

Orangutan in Borneo is on the red list of IUCN in 2008.Orangutan population in Borneo is lessened for 50% in 60years. Orangutan habitat 55% are lessened for 20 yearscaused by oil palm concession, forest fire and humanactivities (WWF 2009). The aims of this research are toknow orangutan population of Degraded peatland forest atPT Hutan Amanah Lestari concession. Strip transect andrecce walks (White and Edwards, 2000) are the idealmethods to know the orangutan population. Theemphasizing of this method are to observe all of theanimals and others object (nest) in the track (Burnham etal., 1980). In the fact we must cut the straight on thetransect and this transect straight with the main river flowfor reducted transect variation and get the accurate densityestimates in the area (Cassey and Mcardle 1999). The resultof this research, we found the orangutan nest in 6 transects,that are transected 1 is 24 nests; transect 2 is 27 nests;transect 3 is 12 nests; transect 4 is 25 nests; transect 5 is 24nests and transect 6 is 22 nests; total 134 nests of anorangutan. In the survey, we can see 2 orangutans in thetransect.

Degradation peatland forest, orangutan, survey,

BO-07Autecology of Myrmecophytes in BengkuluProvince, IndonesiaSafniyeti1,♥, Sulistijorini2, ♥♥, Tatik Chikmawati2, ♥♥♥

Department of Biology, Faculty of Mathematics and Natural Sciences,Institut Pertanian Bogor. Jl. Meranti Kampus IPB, Babakan, Dramaga,Bogor 16680, West Java, Indonesia. Tel.: +62-251-8625481, ♥email:safniyety@gmail.com, ♥♥sulistijorini@gmail.com, ♥♥♥

tchikmawati@yahoo.com

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 57

Myrmecophytes are plant used as an alternative traditionalmedicine by people of Bengkulu Province, Indonesia, yetthere is no reports on autecological matters of these plants.The autecological aspect of myrmecophytes assess theinteraction of these species with its environment, includingbiotic components such as the host trees, epiphytes belongto the same host and animal occupants on the tuber ofmyrmecophytes. The aim of this study was to identify thespecies and characteristics of the host tree, other epiphytesplants, and the animal occupants. Data were collected usingpurposive sampling which enables to find and collectmyrmecophytes on certain known areas. Data analysis wascarried out by identifying the host trees, other epiphytes,and animal occupants. The results showed that there aretwo species of myrmecophytes namely Hydnophytumformicarum and Myrmecodia tuberosa. They are attachedand hang on nine species of host trees with thecharacteristics of a high tree, large diameter, mostly rough-barked, some are cracked and mossy. These plants livealong with 13 other epiphytic species consisted of ferns andorchids. The animals found living inside the tubers are ants,cockroaches, and termites.

Animals, characteristics, diversity, epiphytic, host tree

BO-08Effect of seed biopriming with endophytic bacteriaon seed growth of rice at saline medium conditionListiani Sugiyono♥, Mieke Rochimi Setiawati, TualarSimarmata, Fiqriah H. KhumairahDepartment of Soil Science, Faculty of Agriculture, Universitas,Padjadjaran. Jl. Raya Bandung Sumedang Km. 21 Jatinangor, Sumedang45363, West Java, Indonesia. Tel./Fax. +62-022-7796316, ♥email:listiani.sugiyono@unpad.ac.id

Plant growth on salinity affects almost all aspects of plantsuch morphological, physiological, and biochemicalprocesses including seed germination, vegetative plantgrowth and water and nutrient uptake, due to a low osmoticpotential of soil solution (osmotic stress). There is a need todevelop simple biological methods for salinity stressmanagement, such as biopriming seeds with endophyticbacteria and their interaction with crop plants. Soaking theseeds in the bacterial suspension for precalculated period toallow the bacterial imbibition into the seed, it increasesspeed and uniformity of germination. In this study,endophytic bacteria were isolated from inside the roots ofrice (Oryza sativa L.) plants grown in the field saline lands12 isolates from rice were resulted in improved growth ofthe plants under saline condition. The experiment wasconducted in the Laboratory of Soil Microbiology,Department of Soil Science and in the greenhouse ofAgriculture Faculty, Universitas Padjadjaran. Theexperiment was arranged in the completely randomizeddesign with 13 treatments and 3 replications. The treatmentwere 12 isolates endophytic bacteria and control. The resultof the experiment showed that several isolates (C2B2,K10P4, C1A2, C3A1) 23-25% enhancement of

germination, seedling vigor and plant height (vegetativegrowth) under saline condition. These results suggestedthat the endophytic bacteria had beneficial and good traitsas biological agent candidate to promote rice plant growthon saline lands.

Biopriming, endophytic bacteria, rice plant, saline lands

BO-09Isolation and antibacterial activities ofactinomycetes isolated from mangrove rhizospherein mangrove forest of Torosiaje, Gorontalo,IndonesiaYuliana Retnowati1,2,♥, Sukarti Moeljopawiro2, TjutSugandawaty Djohan2, Endang SutaringingsihSoetarto2, Langkah Sembiring2

1 Department of Biology, Faculty of Mathematics and Natural Sciences,Universitas Negeri Gorontalo. Jl. Jenderal Sudirman No. 6, KotaGorontalo 96128, Gorontalo, Indonesia. Tel.: +62-435-821125, Fax.: +62-435-821752, ♥email: yuliana_ri@yahoo.com2 Faculty of Biology, Universitas Gadjah Mada. Jl. Teknika Selatan, SekipUtara, Sinduadi, Mlati, Sleman 55281, Yogyakarta, Indonesia

Antibiotics-producing Actinomycetes have been exploredfrom the various environment, especially extremeenvironment. Mangrove forest of Torosiaje in GorontaloProvince, Indonesia have the unique geomorphologicalcondition. There is karst ecosystem that consists of twotype, fringe, and overwash mangrove. This study wasdesigned to obtain Actinomycetes isolates from sevenkinds of mangrove rhizospheres and to analyze theantibacterial activities of Actinomycetes isolates againstpathogenic bacteria. The soil sample was collected fromseven kinds of mangrove rhizospheres, i.e. Rhizophoramucronata and Bruguiera gymnorrhiza in overwashmangrove, Rhizophora apiculata, Bruguiera gymnorrhizain the middle zone of Fringe mangrove, Avicennia marina,Xylocarpus sp., Ceriops tagal and Sonneratia alba in upperZona of fringe mangrove. The pre-treatment of soil samplewas based on the wet dry method on 60oC for 15 minutes.Starch Casein Agar supplemented by cycloheximide andnystatin was used as an enrichment medium for theselective isolation of Actinomycetes. Antibacterial activitytest of Actinomycetes isolates was based on agar blockmethod against Gram-positive and Gram-negative bacteria,i.e. Escherichia coli, Staphylococcus aureus and Bacillussubtillis. The diameters of inhibition zone andActinomycetes colony were measured to determine theindex of inhibition zone. Totaly 167 Actinomycetes isolateswere isolated from 7 kinds of mangrove rhizospheres and77 isolates of them shown the antibacterial activities. Theywere 52 isolates as narrow spectrum activities and 25isolates as broad spectrum activities. The antibiotic-producing Actinomycetes isolates shown diversitymorphology characters dominated by white of aerial colonyand yellowish to brown of diffused pigment. The 77Actinomycetes isolates were organized in 15 clusters andidentified as Streptomyces, Amycolatopsis,

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9058

Saccharomonospora, and Nocardiopsis.

Actinomycetes, antibacteria, color grouping, overwash, fringe

BO-10Distribution and diversity of antibiotics-producingactinomycetes in mangrove ecosystem of Torosiaje,Gorontalo, IndonesiaYuliana Retnowati1,♥, Sukarti Moeljopawiro2, TjutSugandawaty Djohan2, Endang SutaringingsihSoetarto2, Langkah Sembiring2

1 Department of Biology, Faculty of Mathematics and Natural Sciences,Universitas Negeri Gorontalo. Jl. Jenderal Sudirman No. 6, KotaGorontalo 96128, Gorontalo, Indonesia. Tel.: +62-435-821125, Fax.: +62-435-821752, ♥email: yuliana_ri@yahoo.com2 Faculty of Biology, Universitas Gadjah Mada. Jl. Teknika Selatan, SekipUtara, Sinduadi, Mlati, Sleman 55281, Yogyakarta, Indonesia

Antibiotics-producing Actinomycetes have been exploredfrom the various environment, especially extremeenvironment. Mangrove forest of Torosiaje in GorontaloProvince, Indonesia have the unique geomorphologicalcondition. Mangrove forest of Torosiaje is karst mangroveecosystem that consists of two type, fringe, and overwashmangrove. Fringe mangrove divided in two zones, middleand upper zone. This study was designed to analyze thedistribution and diversity of antibiotics-producingActinomycetes on rhizospheres of various types ofmangrove at mangrove forest of Torosiaje, Gorontalo. Soilsamples were collected in 0-10 cm depth from 7 kinds ofmangrove rhizospheres, i.e., Rhizophora mucronata andBruguiera gymnorrhiza at overwash mangrove type,Rhizophora apiculata, Bruguiera gymnorrhiza at a middlezone of fringe mangrove, Avicennia marina, Xylocarpus sp,Ceriops tagal and Sonneratia alba at upper zone of fringemangrove. The pre-treatment of soil sample were based onthe wet dry method on 60oC for 15 minutes. Starch CaseinAgar supplement by cycloheximide and nystatin was usedas an enrichment medium for the selective isolation ofActinomycetes. Screening of antibiotics-producingActinomycetes based on agar block method againstEscherichia coli, Staphylococcus aureus, and Bacillussubtillis. The diversity of antibiotics-producingActinomycetes were analyzed based on the numericalphenetic taxonomy of ARDRA fingerprinting by MSP Irestriction endonuclease enzyme. Totaly 167Actinomycetes isolates were isolated from 7 kinds ofmangrove rhizospheres. The population of Actinomyceteson overwash mangrove, a middle zone and an upper zoneof fringe mangrove was 11.8 x 106, 50.7 x 102 and 96.1 x102 CFU/g respectively. Seventy-seven Actinomycetesisolates were shown the antibacterial activity, consist of 52isolates against Gram-positive bacteria (narrow spectrum)and 25 isolates against both of Gram-positive bacteria andGram-negative bacteria (broad spectrum). The most of thehigh inhibition activity-Actinomycetes isolates were foundin Xylocarpus sp and Avicennia marina rhizosphere in theupper zone. The diversity of Actinomycetes was analyzed

based on the numerical phenetic taxonomy of ARDRAfingerprinting by dendrogram construction. The resultshowed that there were 47 clusters that consist of 1 to 5isolates on each cluster. The antibiotics-producingActinomycetes isolates were identified as Streptomyces,Amycolatopsis, Saccharomonospora, and Nocardiopsis.

Actinomycetes, ARDRA, mangroves, overwash, fringe

BO-11Corticolous lichen diversity as bioindicator of airquality in Kamojang, West Java, IndonesiaRirin Eka Permatasari1,♥, Muhammad Feisal Jatnika1,Joko Kusmoro2, Prihadi Santoso2, Iin Supartinah Noer2

1Graduate Program of Environmental Study (PSMIL & DIL), UniversitasPadjadjaran. Jl. Sekeloa Selatan I Bandung 40132, West Java, Indonesia.Tel.: +62-22-2508871; Fax.: +62-22-2504982, ♥email:ririnbio08@gmail.com2Department of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia.

Lichen is widely known as a bioindicator of environmentalstress, especially air quality. This study was conducted toassess corticolous lichen diversity around power housegeothermal plant area, and the use of the lichen species as abioindicator of air quality. Sixteen sites located on fourtransects based on European Guideline (EU) method andpoint center quarter method. The frequency of occurrenceof lichen species was recorded using 50 cm2 on the treebark of each cardinal point (N, E, W, S). Those were usedto estimate lichen diversity and to evaluate the degree of airquality. The research result is 75 species corticolous lichenwho has 17 families and 39 genera have been discovered.The dominate family is Graphidaceae who has 23 species,and the co-dominate is Parmeliaceae whom has 12 species.Based on the results of the EU indicates that the area has adiversity that is as high as in the plot is 0.5 km south ofgeothermal power plants and the lowest in plot 2 km westof geothermal power plants Lichen's species whom tolerantto heavy pollution is Cryptothecia striata, Cryptothecia sp.,Heterodermia japonica, and Dirinaria applanata;Heterodermia leucomela, Parmotrema tinctorum,Parmotrema reticulata as tolerant lichen to light pollution;Heterodermia rugulosa and Letharia vulpina as indicatorspecies of good air quality.

Air quality, bioindicator, corticolous lichen

BO-12Supporting factors for increasing the intensity ofsubterranean termites invasion in the Acaciacrassicarpa plantationNoor F. Haneda1, Ichma Y. Retmadhona1,♥, DodiNandika2

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 59

1 Department of Silviculture, Faculty of Forestry, Institut Pertanian Bogor.Jl. Lingkar Akademik Kampus IPB Darmaga, Bogor 16680, West Java,Indonesia 2 Program of Tropical Silviculture, School of Graduates,Institut Pertanian Bogor. Jl. Lingkar Akademik Kampus IPB Darmaga,Bogor 16680, West Java, Indonesia. Tel. +62-251-8626806, ♥email:ichma.yeldha@gmail.com3Department of Forest Products, Faculty of Forestry, Institut PertanianBogor. Jl. Lingkar Akademik Kampus IPB Darmaga, Bogor 16680, WestJava, Indonesia

Invasion of subterranean termites on plants frequently leadsto decreased yields and death on plants, resulting inconsiderable economic losses. The damage rate caused bytermites is influenced by many factors such as termitepreference rates for plant species, plant health, andenvironmental conditions. A large number of theirpopulation and the high intensity of attacks cause thesepests are difficult to be controlled. This study aimed toinvestigate supporting factors the intensity invasion (IS) ofsubterranean termites invasion on Acacia crassicarpaplantation. The sample plots were determined by transectand stratified random sampling methods and the samplingintensity was 0.6% of the total plots.The nine selected plotswere distinguished based on the age class 1, 2, and 3 years.The highest IS value occurred in 3 years class, which was4.13%. The intensity of the ground termites attacksincreased with the age of the tree. It could be assumed thatthe 3-year-old plot provided a more suitable condition.Average temperature and humidity in 3-year plots were31.2 0C and 67.5%. The C-organic content in the researchlocation was very high (33.5%), because it had a peat soiltype with a more than 6 meters of depth. Conditions in thesample plot may also be affected by crown closures.Conditions on the 1-year-old plot tended to have very openconditions, so that sunlight was able to penetrate directly.

Acacia crassicarpa, intensity of attack, stratified randomsampling, transect

BO-13A preliminary conservation: Study on Bengkulu’sburgo eggHeri Dwi Putranto1,♥, Gading Putra Hasibuan2, YossieYumiati3, Johan Setianto4

1 Department of Animal Science, Faculty of Agriculture, UniversitasBengkulu. Jl. W.R. Supratman, Kandang Limun, Bengkulu 38371,Indonesia. Tel./Fax. +62-736-21290, ♥email: heri_dp@unib.ac.id,tora_rendai@yahoo.com2 Graduate School of Natural Resources and Environmental Management,Faculty of Agriculture, Universitas Bengkulu. Jl.W.R. Supratman,Kandang Limun, Bengkulu 38371, Indonesia. Tel./Fax. +62-736-212903 Office of Environment and Forestry Services, Bengkulu Province. Jl.Pembangunan, Padang Harapan, Bengkulu 38225, Indonesia. Tel./Fax.+62-736-20091/228564 Program of Agribusiness, Faculty of Agriculture, Universitas DehasenBengkulu. Jl.Raya Meranti, Sawah Lebar, Bengkulu 38222, Indonesia.Tel./Fax. +62-736-997384

Sumatra island's endemic chicken subspecies, well knownas burgo or berugo or Rejang chicken, has beendomesticated widely in the southern part of Sumatraespecially in Bengkulu, South Sumatra and Jambi,

Indonesia. Researchers of Faculty of AgricultureUniversitas Bengkulu have been conducted severalcontinuous studies to reveal the scientific informationregarding this crossbred chicken recently. As a first stepto maintain its population in-situ and ex-situ, a study onburgo egg performances was conducted. A micro-nutritional treatment by utilizing 4 doses of supplementedkatuk extract in water was applied for 16 female burgoaged 10 to 11 months. Water and feed provided ad libitumfor about 8 weeks. The results showed thatsupplementation of 4 doses of katuk extract had nosignificantly effect on some egg produced, egg weight,eggshell weight, and thickness. A sexually mature femaleburgo can produce approximately 22.38 eggs and averageweight was 37.76 gr per egg. The average weight of burgoegg shell approximately 4.97 g per egg and egg shellthickness approximately 0.48 mm per egg.

Bengkulu, burgo, conservation, chicken, egg

BO-14Alarming call from Mursala island, CentralTapanuli, Indonesia: The urgent task forconserving the previously reported extinctdipterocarp, Dipterocarpus cinereusHenti Hendalastuti Rachmat1,♥, Atok Subiakto1,Kesuma Wijaya2

1Forest Research and Development Center, Forest Research andDevelopment Agency, Ministry of Environment and Forestry. Jl. GunungBatu No. 5, Bogor. P.O. Box 165 Bogor 16610, West Java, Indonesia.♥email: hendalastuti@yahoo.co.uk2Riau Islands Province Environment and Forest Services, Dompa OfficialComplex, Buiding C2, Tanjung Pinang, Kepualaun Riau, Indonesia

In 1998, IUCN declared that the Mursalan (CentralTapanuli, Indonesia) endemic Dipterocarpus cinereus wasextinct in the wild, but brief exploration found there werefew numbers still growing in the island. The objectives ofthe research were: (i) To describe the forest threats inMursala island; (ii) To determine the vegetationcomposition and association. Identifying forest conditionwas done descriptively through observations and interview.The vegetation analysis was carried out by the purposivestratified technique with total 20 plots (r= 17.8 m). Theresult showed that the island has been facing forestdeterioration mainly caused by conversion and timberextraction. Vegetation analysis determined 5 dominantspecies and that D. cinereus is still growing in the middlepart until the top of the ridges. Importance Value Index(IVI) for the top five species were 32.37, 39.47, 17.43,15.18 1nd 11.04 respectively for D. cinereus, S. acuminata,A. pinata, S. falcifera and H. sangal. Association onlyfound to that D. cinereus with S. falcifera and D. cinereuswith A. pinata. Non-timber product potency of the islandincluded tourism, coral, mangroves, and other fisheries-related fields. Our study also determined that calling forspecies conservation is not only needed for D. cinereus butalso island ecosystem as a whole.

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9060

Dipterocarpus cinereus, Mursala island, vegetationcomposition

BO-15

Dian Akbarini1,2,♥, Johan Iskandar2,3, ♥♥

1 Board of Development Planning and Regional Development Research ofCentral Bangka District. Jl. Titian Puspa 2, Koba, Kabupaten BangkaTengah, Kepulauan Bangka Belitung, Indonesia. ♥email:akbarini@gmail.com2Department of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21, Jatinangor,Sumedang 45363, West Java, Indonesia. Tel +62-22-7797712. email:johan.iskandar@unpad.ac.id and Graduate3Graduate Program of Environmental Study (PSMIL & DIL), UniversitasPadjadjaran. Jl. Sekeloa Selatan I Bandung 40132, West Java, Indonesia.Tel.: +62-22-2508871; Fax.: +62-22-2504982

Pelawan Biodiversity Park is located in Village of Namang,Subdistrit of Namang, District of Bangka Tengah,Kepulauan Bangka Belitung, Indonesia. The PelawanBiodiversity Park has size approximately 47 hectares whichare intended to use as one of conservation areas in Bangkadue to owns various distinctive plants and animals,especially Tristaniopsis merguensis. A preliminary reviewof park management planning was undertaken betweenJanuary and March 2017. The purpose of this preliminaryreview was to obtain information on planning andmanaging Pelawan Biodiversity Park which has animportant function for conservation, ecotourism andresearch area in the District Central Bangka. The methodused is qualitative with field data collections, namelyobservation, deep interview with informants and analysis ofdocumentations. The results of the study show that in theplanning of management of Pelawan Biodiversity Park hasnot been collaboratively implemented among stakeholders.In addition, the potential of biodiversity of the PelawanBiodiversity Parks has not been properly analyzed and usedto develop for conversation, ecotourism and research area.

Biodiversity Park, Collaborative Planning, conservation,ecotourism, research area

BO-16Zonation design on nesting habitat of green turtlein tropical megadiversity constructionPutri Indrawati♥, SusantiDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Negeri Semarang. Jl. Sekaran, Gunung Pati, Sekaran, Gn.Pati, Kota Semarang 50229, Central Java, Indonesia. Tel.: +62-24-8508112, ♥email: putrindrawati@gmail.com

IUCN (International Union for Conservation of Nature)states that green turtles, Chelonia mydas (Linnaeus, 1758),are included in the Red List of Threatened Species.

Indonesian waters are considered the most importantmigration routes at the intersection of the Pacific andIndian Oceans. However, the sustainability of the greenturtle population is increasingly threatened with increaseddamage to nesting habitats. Therefore, it is indispensablefor the recovery of the population through the conservationof the environment and the rehabilitation of the areas thatbecome the habitat of nesting green turtles. Based on thesestatements, the authors designed the zoning habitat of greenturtle eggs in the conservation of tropical megadiversity.Zoning is based on the green turtle nesting habitat in a casestudy in Teluk Penyu, Cilacap District, Central Java,Indonesia. Zoning consists of 5 zones, including nestinggreen turtles zones, interzone, resident zones, tourist zone,and zone of fisheries activity by humans. This zoning as areclamation model where the green turtle laying eggs verysupports the survival of green turtles. The advantage of thiszonation is the maintenance of harmony between humanactivities and the proliferation of green turtles in adjoiningareas.

Conservation, green turtle, habitat, zonation

BO-17The role of compost in enhancing plant growth ontailing ex-gold miningWiwik EkyastutiFaculty of Forestry, Universitas Tanjungpura. Jl. Prof. Hadari Nawawi,Pontianak 78121, West Kalimantan, Indonesia. Tel.: +62-561-765342,583865, 732500, Fax.: +62-561-765342, ♥email:wieky_serdam@yahoo.co.id

The conditions of tailing ex-gold mining in WestKalimantan, Indonesia is very marginal. The texture ofthese soil is dominated by sand, nutrient-poor, pH acidicand low organic matter. These conditions inhibit thegrowth of plants. The addition of compost can overcomethe problem of low organic matter. How this role inenhancing plant growth is still unknown. The study aimedto measure the effect of composting on tailing of ex-goldmining on (i) the growth of some plant species and (ii)physical and chemical changes in tailing. The experimentwas conducted using a completely randomized design. Theaddition of compost is done as much as 2 kilograms perplanting hole. The results showed that compostingsignificantly improved the plant growth. Improvement ofphysical-chemical of tailing also occurs characterized byincreased pH, reduced sand dominance and the organicmaterial increased in tailing. The role of compost is veryimportant in enhancing plant growth on the tailing ex-goldmining.

Compost, ex-gold mining, tailing

Study on a collaborative planning BiodiversityPark for development of The Biodiversity Park ofPelawan, Kepulauan Bangka Belitung, Indonesia

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 61

BO-18Rare actinomycetes of mangrove rhizosphere fromEast Segara Anakan, Cilacap, Indonesia and theircapabilities in inhibiting Multiple Drug Resistancebacterial growthDini Ryandini1,♥, Agus Irianto1, Ocky K. Radjasa2

1 Faculty of Biology, Universitas Jenderal Soedirman. Jl. Dr. Soeparno 63,Purwokerto, Banyumas 53122, Central Java, Indonesia. Tel. +62-281638794,Fax: +62-281-631700, ♥email: dini_ryandini@yahoo.com,dh11460@gmail.com2 Faculty of Fisheries and Marine Science, Universitas JenderalSoedirman. Jl. Dr. Soparno, Komplek GOR Soesilo SoedarmanKarangwangkal, Purwokerto, Banyumas 53122, Central Java, Indonesia

Morphological observation and biochemical assays arecommon methods for identifying actinomycetes. These,however, are not effective to distinguish Streptomyces fromnon-Streptomyces (rare actinomycetes) within theActinomycetes. Thus, this study used two pairs of designed16S rRNA primers (16S Str-F: GCAAGTCGAACGATGAASCM, R: TGGTAAGGTTCTTCGCGTTG,16S NStr-F: CTCTTTCASCASSGACGAG, R: GTCACCGGACCCGAAG) to select the rare actinomycetes fromStreptomyces of Actinomycetes group collected from EastSegara Anakan (Cilacap, Indonesia) mangrove rhizosphere.The bands showed that five isolates out of 26actinomycetes performed as rare actinomycetes whereasthe remaining 21isolates indicated as Streptomyces. Therare actinomycetes were also known as the potential agentsin inhibiting the growth of multi drug resistant bacteria

MDR bacteria inhibition, rare actinomycetes, SegaraAnakan, specific primer,

BO-19Fish succession in Jatigede Reservoirat District of Sumedang, West Java, IndonesiaTitin Herawati♥, Ayi Yustiati, Atikah NurhayatiFaculty of Fisheries and Marine Science, Universitas Padjadjaran. Jl. RayaBandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363,West Java, Indonesia. Tel.: +62-22-87701519, Fax.: +62-22-87701518,♥email: herawati.h19@gmail.com

The aim of the research is to determine the successionfishes in the Jatigede Reservoir; the research uses surveymethod from January 2016 to March 2017. Samplecollecting is done in five stations. Samples are identified byits species. The analyzed parameter includes species andabundance. Research shows that the fishes that now lives inJatigede Reservoir are indigenous fish from Cimanuk riverand the fishes that are introduced and restocked to fill thewaters. The indigenous fish that not survive in thelacustrine area will move to riverine area which is S'sCimanuk river upstream and fishes that can adapt will liveand repopulate. In the beginning of inundation at January2016. Indigenous fishes that are very hard to found areBeardless Barb, Snakehead, Silver Rasbora, while the

dominant fishes that caught are Barbodes, Hampala Barb,Catfish, Spotted Barb, and Arelot. In March 2017, thefishes that live in Jatigede reservoir are, Barbodes(Barbodes balleroides), Beardless Barb (Diplocheilichthyspleurotaenia), Hampala (Hampala macrolepidotta),Snakehead (Chana striata), Catfish (Mystus gulio), SpottedBarb (Mystacoleucus marginatus), Tilapia (Oreochromisniloticus), Nile Tilapia (Tilapia mozambica), Silver Barb(Barbodes gonionotus), Hike (Osteochillus sp), Carp(Osteochillus haseltii), Rasbora (Rasbora argyrotaenia),Three Spotted (Trichogaster pectoralis), Plecos(Liposarcus pardalis), Carp (Cyprinus carpio), Arelot(Mastacembelus erythrotaenia), Halfbeak (Dermogenyspusillus), Barb (Barbodes sp), Catfish (Clarias batracus),Shark Catfish (Pangasius hypopthalmus), and Milkfish(Chanos chanos).

Indigenous species, introduction, Jatigede reservoir,restocking, succession

BO-20Isolation and screening of cellulolytic fungi fromSalacca edulis leaf litterSiti Lusi Arum Sari♥, Ratna Setyaningsih, NovitaFitriatul Aini WibowoDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Sebelas Maret.Jl. Ir. Sutami 36A Surakarta 57126, CentralJava, Indonesia. Tel./Fax. +62-271-663375, email:arumprasoho@gmail.com

Cellulases are the main enzyme in a bioconversion oflignocellulosic biomass. Fungal cellulases have beenproven to be a better candidate for this process than othermicrobial cellulases since they secrete free cellulasecomplex including endoglucanases, cellobiohydrolases, andβ-glucosidase. This study was conducted to isolate andscreen cellulolytic fungi from Salacca leaf litter. Therewere about 12 fungal isolates which were obtained in thisresearch and 8 isolates showed cellulolytic activity. Basedon morphological characters, these cellulolytic fungi wereidentified as belonging to 4 genera, i.e. Penicillium,Aspergillus, Paecilomyces, and Thielaviopsis. Based onclear zone formation, isolate SLL03, SLL06 and SLL10showed hight cellulolytic activity. Whereas, based on 18SrRNA gene sequence, these isolates were identified asAspergillums flavus (SLL03), Penicillium sp. (SLL06),Thielaviopsis ethacetica (SLL10). Therefore, these isolateswould be good candidates for cellulase producer.

Cellulase, cellulolytic, fungi

BO-21Yeasts diversity in animal products with lipolyticand proteolytic activity

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9062

Roostita L. Balia1,♥, Ratu Safitri2, Sri R. Rahayuningsih2,Ida Indrawati2, Gemilang Lara Utama3

1 Faculty of Animal Husbandry, Universitas Padjadjaran. Jl. RayaBandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363,West Java, Indonesia. Tel.: +62-22-7798241, ♥email: roostita@gmail.com2 Department of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia3 Faculty of Agro-Industrial Technology, Universitas Padjadjaran. Jl. RayaBandung-Sumedang Km 21 Jatinangor, Sumedang 45363, West Java,Indonesia

Aims of the study were to identify yeasts diversity inanimal products that have an ability in hydrolyzing lipidand protein. Yeasts isolated and purified from 1 g sampleof animal products (meat and gut of chicken, cow, sheepand carp fish) using Malt Extract Agar/MEA (Oxoid Ltd.)with 10 ppm amoxicillin addition then incubated for 48h atroom temperature (23-28°C). The yeast cell was identifiedunder a microscope for size and shape and tested withRapID Yeast Plus System. The ability of yeasts inhydrolyze lipid and protein identified with diffusion wellmethod using modified MEA with 10 ppm amoxicillin andadded by 3% coconut milk for plant-based lipid, 3% fullcream cow milk for animal-based lipid and 3%skim milkpowder for protein. Yeast isolated from each sample andidentified as Candida guilliermondii from chicken’s meat,Trichosporon beigelii from chicken’s gut, carp fish’s meatand gut, Cryptococcus humicolus from beef and sheep’smeat and Candida tropicalis from cow's and sheep's gut.T.beigelii shown best lipolytic and proteolytic activity withclear zone measured of 26 mm towards plant-based lipid,29 mm towards animal-based lipid and 28 mm of theproteolytic clear zone.

Animal products, lipolytic, proteolytic, yeast

BO-22Diversity of ethanol resistant yeasts isolated fromfruit wastes of Bandung’s Central Market,IndonesiaGemilang Lara Utama1,♥, Dwi Wahyudha Wira2, PatarManurung2

1 Faculty of Agro-Industrial Technology, Universitas Padjadjaran. Jl. RayaBandung Sumedang Km 21, Jatinangor, Sumedang 45363, West Java,Indonesia. Tel.: +62-22-7798844, Fax.: +62-22-7795780, ♥email:lugemilang@gmail.com2 Faculty of Medicine, Universitas Padjadjaran. Jl. Raya BandungSumedang Km 21, Jatinangor, Sumedang 45363, West Java, Indonesia

The research aimed to determine the diversity of ethanol-fermenting yeasts from fruit wastes of Bandung's CentralMarket. Banana and papaya waste taken as two dominantwastes with the amount of 33.30% and 18.18% respectivelyfrom total wastes. Yeasts isolated and purified from 1 gwaste sample with using modified medium of PotatoDextrose Agar/PDA (Oxoid Ltd.), 3% Yeast Extract/YE(Kraft Foods) and 10 ppm amoxicillin. The yeast cell wasidentified under a microscope for size and shape and testedwith RapID Yeast Plus System. Two isolates identified

from banana wastes as Cryptococcus albidus, Trichosporonbeigelii and other two isolates from papaya wastesidentified as Candida krusei and Trichosporon beigelii. Todetermine the resistance towards high ethanol contents,isolates was grown in Nutrient Broth/NB (Oxoid Ltd.)modified with 3% Yeast Extract/YE (Kraft Foods), 10 ppmamoxicillin and added by various concentration of ethanol(10%, 15%, 20%) then incubated for 48h at roomtemperature (23-28°C). The optical density (OD) of eachtreatment was read for UV absorbance at 600 nm usingUV-Vis spectrophotometer, then recorded as evidence ofgrowth. Two isolates from banana waste shown bestethanol resistant activity with OD at 10% ethanolconcentration of 0.07315 for T. beigelii, meanwhile C.krusei at 15% and 20% ethanol concentration showed ODof 0.1383 and 0.1823 respectively.

Banana, ethanol-resistant, papaya, waste, yeasts

BP-01Isolation, antimicrobial of lactic acid bacteria andmolecular characterization using 16 S RNA fromvirgin coconut oil West Sumatra, IndonesiaHoras Rajagukguk1, Safrizayanti1, Siti Zulaiha1, SanusiIbrahim2, Sumaryati Syukur1,♥

1 Laboratory of Biotechnology, Departement of Chemistry, Faculty ofMathematics and Natural Sciences, Universitas Andalas. Limau Manis,Pauh, Kota Padang 25163, West Sumatra, Indonesia, Tel.: +62-751-71671, Fax.: +62-751-73118, ♥email:sumaryatisyukur_unand@yahoo.co.id2Laboratory of Organic Chemistry, Departement of Chemistry, Faculty ofMathematics and Natural Sciences, Universitas Andalas. Limau Manis,Pauh, Kota Padang 25163, West Sumatra, Indonesia

Virgin coconut oil (VCO) contains a diversity of lactic acidbacteria (LAB) which has been isolated and showingantimicrobial pathogen. Virgin coconut oil (VCO) hasbenefit for lowering cholesterol level in blood and hasanticancer and antimutagenic. LAB and their food productsare thought to confer a variety of important nutritional andtherapeutic benefits and have many documented for healthpromoting and function as a probiotic effect in human,animal, and environment. LAB was isolated in MRSmedium; the isolates were then characterized biochemicallyby Gram staining and catalase test. Total colony averagewas 508 x 108 cfu/mL, Gram-positive, and catalasenegative. Six isolates randomly picked and their growthwas measured by Spectrophotometry. LAB isolates werethen selected for their probiotic properties, i.e.antimicrobial activity and acid tolerance (pH 3-4). SelectedLAB isolates were R2, R3, and R5 showing goodantimicrobial activity (± 12 mm against E. coli, ± 13.5against S. aureus, and ± 12 mm against S. typhi) and havingtolerance to acid. Three selected isolates were thenidentified DNA molecular and amplified by using PCRwith primer 27F (3' AGAGTTTGATCCTGGCTAG5') and1525 R (3' AGAAAGGAGGTGATCCAGCC 5') todetermine the species of bacteria. From PCR product, only2 isolates (R2 and R3) can be continued to sequence

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 63

analysis. The phylogenetic tree showed that isolates R2 hasa better result and close relative to Lactobacillus plantarumwith 98% identification value.

16S RNA, antimicrobial, Lactic Acid Bacteria, Lactobacillusplantarum, Virgin coconut oil

BP-02Nepenthes spp. identification in a degradedpeatland forest concession of Central Kalimantan,IndonesiaDiah Setyawati1, Suaibatul Aslamiah2, Siti Maimunah3,♥

Department of Forestry Science, Faculty of Agriculture and Forestry,Universitas Muhammadiyah Palangkaraya. Jl. RTA Milono Km 1, 5,Langkai, Pahandut, Kota Palangkaraya 73111, Central Kalimantan,Indonesia. Tel.: +62-536-3222184, ♥email: sitimararil@gmail.com

Nepenthes spp. is one of pitcher plant that its grow in themarginal land with an insect trap organ for hunting theinsects to get some essential nutrition tat none in the soil.The pitcher organ of Nepenthes spp. have many formdepent from species. Degraded peatland forest is amarginal land that there is too poor for much essentialnutrition. A natural adaptation of vegetation in poorlymedia can make more activity like adapted behavior how totake up nutrition for a plant like a pitcher plant. Degradedpeatlands forest is an area with nutrition limited. Thiscondition induces the plant must survive in this area withmany form adaptation behavior like diperocarpaceae makea symbiosis mutualism with positive microorganism likemycorrhiza and many species to form the specific organ totrap insects that comply many nutrition loss for a plant likea pitcher plant. The aim of this research is to inventory thepitcher plant in degraded peatland forest of PT. HutanAmanah Lestari, Central Kalimantan, Indonesia. Themethod had been used Strip Method covered 20x20 plot,each sample was taken five pieces with the distancebetween plot 100 m at Kerangas Forest to Peat SwampForest. Experiment held on July 2016. Experimental resultshown at degraded peat swamp forest found four kinds ofNepenthes spp. as it Nepenthes hookeariana, N. gracilis, N.rafflesiana and N. ampularia as communal use on peatdeep and flooding area.

Degraded peatland forest, Nepenthes, poorly nutrition

BP-03Diversity and status conservation of parrots inTaman Wisata Alam Gunung Meja, Manokwari,Papua, IndonesiaImanius Doansiba, Hermanus Warmetan♥, HendrikBurwos, Hermanus J. SikowayFaculty of Forestry, Universitas Papua. Jl. Gunung Salju, Amban-Manokwari 98314, West Papua, Indonesia. Tel & Fax.: +62-986-211364,♥email: hermanwarmetan@gmail.com

Taman Wisata Alam Gunung Meja (TWAGM) is nearCentre of Manokwari City, West Papua, Indonesia and hasthe potential of high biodiversity including birds parrots.Currently, TWAGM degraded because of activities thefarm, take a wood House, and the enclosure of livestockand bird hunting by humans so that it becomes a seriousthreat. This research aims to know the diversity of speciesand conservation status of birds parrots (Psittacidae).Method line transect on the three points ofobservation/transect. All species of bird parrots observed inline transect noted. The diversity of the observed data is thename of species, family and the number of individuals. Theresults showed five species of parrots and genus in the fivefamilies Psittacidae. The diversity of species of categoriesare classified as (value H' = 1,601%) means the communityof birds parrots on the forest classified as unstable.Crooked parrots of bird species that are found in a numberof relative found, namely bird Parrot Kate Posio(Micropsitta pusio) amounted 33 individuals, while theRainbow Lory (Trichogloss haematodus) 9 individuals,Cockatoo (Cacatua galerita) 8 individuals, Lory Parrots(Eclectus roratus) 4 individuals and Kasturi Head black(Lorius lory) 1 individuals. Conservation status of the fifthof this species is protected by law number 5 of 1990 aboutNatural Resource Conservation Biodiversity andEcosystem, Government Regulation number 7 in 1999about the Preservation of plants and wildlife.

Conservation status, diversity, Manokwari, parrots, TamanWisata Alam Gunung Meja

BP-04Diversity of soybean lines resistance to whiteflyBemisia tabaci attackKurnia Paramita Sari♥, Apri Sulistyo, Rahma Sheila Y,PurwantoroIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8 Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: adnina0312@gmail.com

The soybean breeding resistance to whitefly is the maintarget of the breeding program. Because whitefly controlsnot been found. The aim this research is grouping soybeanline resistance to whitefly attack. The research arranged usecomplete randomized design with two replicates, 96soybean lines were observation. The result showed fivegrouping resistance soybean line to whitefly e.i one linewas high resistance (HR), seven lines resistance (R), 51lines moderately resistance (MR), 36 lines susceptible (S)and one line high susceptible (HS). Damage intensity causewhiteflies were significantly in lines, the average ofdamage intensity between 5.115%-63.320%. In anotherhand, a number of an adult were not significantly in lines,an average of an adult number between 0.83-110.67adult/leaf trifoliate.

Resistance, soybean line, whitefly

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9064

BP-05Characterization of the plant morphology tarolocal Papua, IndonesiaJoko Restuono♥, Abner BasnaIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8 Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: jrestu71@gmail.com

Taro is one of functional food in Papua Province,Indonesia. The diversity of taro local Papua is resourcegermplasm Indonesia. We must safeguard local Papua taroexistence. The aim this research to characterize plantmorphology of taro. The research was conducted by taroexploration on Papua. Exploration result was collected 21taro cultivars. Plant morphology was observed plant typeand leaf. Plant type was dominated score 1, it means havenarrow header ranges as much as 17 cultivars. From 21 tarocultivars, leaf type was dominated by score 1 (peltate) asmuch as 16 cultivars.

Taro, plant morphology

BP-06Diversity of bacterial gut of common carp as abiological control agent for AeromonasYuniar Mulyani1,2,♥, I Nyoman P. Aryantha1, SonySuhandono1, Adi Pancoro1

1School of Life Sciences and Technology, Institut Teknologi Bandung.Labtek XI SITH-ITB, Jl. Ganesa 10, Lebak Siliwangi, Coblong, BandungCity 40132, West Java, Indonesia. Tel.: +62-22-25115752 Faculty of Fisheries and Marine Science, Universitas Padjadjaran. Jl.Raya Bandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang45363, West Java, Indonesia. Tel.: +62-22-87701519, Fax.: +62-22-87701518, ♥email: yuniarmulyani@gmail.com

The microbiota of the gut is the most complex of all organsthat interact closely with the mucosal immune system. Theaim of the study was to isolate the bacterial gut flora, tostudy the morphological characterization of isolatedbacteria, to analyze the diversity of bacteria based onmorphological characteristics, and to explore its potentialas a biological control agent for Aeromonas. Thirty isolatesfurther identified by 16s rRNA gene sequencing.Moreover, the intestinal bacteria were infected to fish andchallenged with Aeromonas sp. as important fishpathogens. Exploration of gut bacteria of Carp (Cyprinuscarpio L.) revealed 30 bacterial isolates showing a widediversity of morphological characteristics. Based on thisresult indicate that Proteobacteria and Firmicutes thecommon phyla. The most promising gut bacteria isolated inthe present study were Bacillus subtilis and Enterococcusfaecalis as a Lactic Acid Bacteria which potential as abiological control agent.

Aeromonas, bacterial diversity, Cyprinus carpio

Diversity of Ecosystem

CO-01Diversity of soil fauna at three level diversity oftree species in Pinang-Pinang Plot, TropicalRainforest Padang, IndonesiaF. Marsandi♥, Hermansah, Agustian, SyafrimenDoctoral Program of Agricultural Sciences, Faculty of Agriculture,Universitas Andalas. Kampus Unand Limau Manih, Padang 25163, WestSumatra, Indonesia. Tel. +62-751-72773, Fax.: +62-751-72702, email:f.marsandi@yahoo.com

Tropical rainforest as mega biodiversity in the world playsan important role in maintaining the balance of theecosystem. Bukit Pinang-Pinang located at foot of MountGadut region is one example of tropical rainforest in WestSumatra which have high rainfall ± 6500 mm/year with noreal dry season, so it is classified as a super wet tropicalrainforest. The related research aims to assess the diversityof soil fauna at the three levels of diversity of tropical rainforest tree plot Pinang-Pinang. The study was conductedfor three months (January to March 2017). The method ofresearch is purposive random sampling, where to get asample of soil fauna used the method of hand sorting andpitfall trap. Identification of soil fauna is done by using akey determinant in insect identification book and soil faunaDJ Borror (United States) and JF Lawrance (Australia).Research results obtained indicate areas with high levels ofdiversity of trees that have a low faunal diversity index are2.172 and vice versa regions with low levels of diversity oftrees that have a high faunal diversity index are 3.510. Asfor areas with medium tree diversity index 2.793. It showeda negative correlation between the diversity of trees with adiversity of soil fauna super wet tropical rainforest plotBukit Pinang-Pinang, Padang, West Sumatra, Indonesia.

Fauna tree diversity, tropical,

CO-02The effect of salinity on growth and survival rateof glass eel Anguilla bicolor bicolorAde Yulita Hesti Lukas1,♥, Daniel Djoko Setiyanto2,Tatag Budiardi2, Agus Oman Sudrajat2, RidwanAffandi2

1 Department of Aquaculture, Faculty of Agriculture, Universitas NusaCendana. Jl. Adisucipto, Penfui-Kupang, Lasiana, Kelapa Lima, KotaKupang y, East Nusa Tenggara, Indonesia. Tel.: +62-380-881085, ♥email:adeyulitahesti@gmail.com2Faculty of Fisheries and Marine Science. Institut Pertanian Bogor. Jl.Agatis Kampus IPB Darmaga Bogor 16680, West Java, Indonesia

This study aimed to explore the optimum salinity forincrease the survival rate and growth of glass eel Anguillabicolor bicolor. The fish used are eel A.bicolor bicolorstadia glass eel weighing from 0.15 to 0.20 g with a lengthof 45-60 mm. Maintenance media used is aquarium

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 65

measuring 60 cm x 30 cm x 30 cm with a volume of 30liters per aquarium. Stocking density used is 2 g/L. Thisstudy was conducted over 14 days and during maintenanceof glass eel is not given food (fasted). Sampling was takenevery seven days likes loss weight, proximate, oxygenconsumption, osmotic gradient, ammonia, and alkalinity.While the measurements of temperate, dissolved oxygenand pH carried out every day. This study uses a completelyrandomized design (CRD) with four treatments and threereplications, namely (A) 0 psu salinity, (B) salinity of 10psu, (C) 20 psu salinity, and (D) salinity of 30 psu. Theresult shows that treatment B has an optimal salinity forglass eel A. bicolor bicolor more little energy loss thanothers.

Anguilla bicolor, glass eel, salinity

CO-03Edge effects on biomass, growth, and tree speciesdiversity of degraded peatland in WestKalimantan, IndonesiaDwi Astiani1,♥, Lisa M. Curran2, Mujiman3, DessyRatnasari3, Ruspita Salim3, Nelly Lisnawaty3

1 Faculty of Forestry, Universitas Tanjungpura. Jl. Prof. Hadari Nawawi,Pontianak 78121, West Kalimantan, Indonesia. Tel.: +62-561-765342,583865, 732500, Fax.: +62-561-765342, ♥email: astiani.dwi@gmail.com2Stanford Wood Institute for the Environment, Stanford University, USA3Lembaga Landscape Livelihood Indonesia, Pontianak, 78121, Indonesia

Tropical peatland forests in Indonesia are under a lot ofpressure. Logging and clearing tropical peatland forest areoften disturbing ecosystem functions and degradingenvironmental conditions. The land use change activitiesdisturbed intact forests, resulted in landscape patches andforest matrices. Scattered forest matrices will considerablyaffect on shifting of forest biotic and abiotic condition, aswell as forest tree dynamics, predominantly on the forestedge. The research was conducted on degraded peatlandforest in West Kalimantan, Indonesia. We aimed toinvestigate the effect of forest edge on the perimeter of theforest fragment on the forest biomass stock, growth, basaltree area, and species composition, richness and abundant.Twelve hectares of forest were split into a 50m x 50 m of35 plots interior parts and 13 plots of edge parts based ontheir abiotic condition such as light and ambienttemperatures. We measured LAI of both forest edge andinterior sites. The results indicate that even though thebiomass levels maintained relatively moderate to highlevels on both sites, forest edge significantly lowered forestbiomass of 32%, reduced 23-25% of tree biomass growthper unit area for both tree diameter 10-20cm and >20cm.There was a shift of tree species composition, 76 specieswere found on both sites, 24 species were not found in edgesite but present in the interior site, and 10 species were onlyfound in edge site. Forest matrix is lowering peatland forestroles on sequestering carbon per unit area and reducingspecies diversity. Peatland forest restoration should bedeveloped to lowered this effects.

Forest interior, forest matrix, species richness, speciesabundant

CO-04Abundance of plant parasitic nematodes generaassociated with BP 308 and BP 42 clone of robustacoffee in Java, IndonesiaMutala'liah1,♥, Siwi Indarti2, Nugroho Susetya Putra2

1Program of Plant Entomology, Department of Plant Pests and Diseases,Faculty of Agriculture, Universitas Gadjah Mada, Jl. Flora No. 1,Bulaksumur, Caturtunggal, Depok, Sleman 55281, Yogyakarta, Indonesia.Tel.: +62-274-563062, ♥email: mutalaliah@mail.ugm.ac.id2 Department of Plant Pests and Diseases, Faculty of Agriculture,Universitas Gadjah Mada, Jl. Flora No. 1, Bulaksumur, Caturtunggal,Depok, Sleman 55281, Yogyakarta, Indonesia

Plant parasitic nematodes play an important role as alimiting factor in a coffee plantation. Clone resistance andsoil texture influence the severity of plant that infected byplant parasitic nematodes. The aim of this research was toknow the diversity of plant parasitic nematodes in twoclone of robusta coffee (BP 308 and BP 42) with a differentsand fraction. The research was observed in Field Stationsof Malangsari (Banyuwangi, East Java), Getas (Semarang,Central Java) and Candiroto (Temanggung, Central Java).Nematode extraction for soil sample used Whitehead traymethod and roots sample with mistifier method. The resultsshowed that there were found 5 genera that associated withrobusta coffee, i.e. Pratylenchus, Helicotylenchus,Radopholus, Rotylenchulus, and Meloidogyne. InMalangsari Field (BP 308) with 31.34% of a sand fraction,Pratylenchus was highly abundance i.e. 6 nematodes/100mL soil. In Getas Field (BP 308) with 26.89% of a sandfraction, Meloidogyne was highly abundance i.e. 14.43nematodes/10 g roots. In Candiroto Field (BP 42) with25.49% of a sand fraction, Pratylenchus was highlyabundance i.e. 60 nematodes/10 g roots.

Abundance, diversity, plant parasitic nematodes, robustacoffee clone

CO-05The dynamics of mangrove forest community in itsfunction as carbon storage in Jakarta Bay,IndonesiaNilam Sari1,♥, Mufti P. Patria2, Tri Edhi Budhi Soesilo3,Iwan Gunawan Tejakusuma4

Doctoral Program in Biology, Department of Biology, Faculty ofMathematics and Natural Sciences, Universitas Indonesia. Jl. LingkarKampus Raya, Kampus UI, Gedung E Lt. 2, Depok 16424, West Java,Indonesia. Tel.: +62-21-7270163 Fax.: +62-21-78849010. ♥email:narfandy@yahoo.com2 Laboratory of Ecology, Department of Biology, Faculty of Mathematicsand Natural Sciences, Universitas Indonesia. Jl. Lingkar Kampus Raya,Kampus UI, Gedung E Lt. 2, Depok 16424, West Java, Indonesia3 Program of Environmental Science, Graduated Program, UniversitasIndonesia. Jl. Salemba Raya No.4, Jakarta Pusat, Jakarta, Indonesia

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9066

4 Agency for the Assessment and Application of Technology. Jl. Thamrinno.8, Center of Jakarta, Indonesia

The dynamics of symbiosis in the mangrove community tomaintain its ecological function, one of which is a carbonstore in mangrove forest, must be viewed in a system sothat the relationship can tell the behavior of the mangrovecommunity. This research was conducted in Jakarta Bay in2016. This study aims to build a model and analyze thedynamics of the relationship between mangrovecommunity structure and carbon stock. The method used isvegetation analysis method, by using 10x10 m transect linerepeated 3 times at 5 (five) stations spread over coastal areaof Dadap (Tangerang, Banten) called station 1 (one), beachof Jakarta Bay (North Jakarta) 3 Stations are stations 2.3,and 4, and the coast around Muara Bendera, in Bekasi(West Java) is called station 5 (five). Identification of themangrove species that make up the mangrove forest isdone, and at the same time retrieve the data for carbonaccounting purposes. Carbon calculations are intended forbiomass, roots, litter, necromasses, and sediments. Theanalysis was performed by using allometric methods forcarbon accounting on biomass, roots, and necromasses.Determination of carbon in litter and sediment using LOI(Lost of Ignition) method. Determination of therelationship between parameters using Pearson. The resultis a very strong inter-parameter relationship for stations1,2,3 and 4, but becomes less powerful at station 5. Themodeling used is system dynamics modeling, with the helpof Powersim studio 10.0 software. Simulation resultsshowed a decrease in the number of trees in the mangrovecommunity and followed by a decrease of carbon stocks inthe mangrove community in Angke Kapuk ProtectedForest, Jakarta Bay. It can be said that mangrove forest inJakarta Bay has been degraded and there has been adecrease of carbon stock.

Allometric calculation, carbon stock, community mangrovedynamics, Jakarta Bay, system dynamics modeling

CO-06The dynamics of population and occupation JavanLutung (Trachypithecus auratus, E. Geoffroy,1812) in the Natural Tourism Park PananjungPangandaran, West Java, IndonesiaRuhyat Partasasmita♥, Muhammad Reyyan PujaLaksana, Erri Noviar MegantaraDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:ruhyat.partasasmita@unpad.ac.id, rp2010rikkyo@gmail.com

The development of Javan Lutung population(Trachypithecus auratus, E. Geoffroy, 1812) was stronglyinfluenced by changes in the composition of individuals ingroups with birth, death, emigration and immigration. Inaddition, the population increases because of theavailability of resources for life insufficient habitat. If

resources in the habitat decrease will affect the size of thepopulation or shifting parts of the habitat used. This studyaims to determine changes in population composition andoccupation of habitat utilization by Javan Lutung. Themethod used is field survey (census), and secondary data in2014, and 2002. The results show that the populationdynamics of Javan Lutung fluctuate, The total number ofindividuals between 113-156, with population density is299.7-413.7 ind./ km2. The number of groups of 6-12groups, with group density between 15.9-35.5 group/km2.An average number of individuals per group between10.91-16.25 ind./goup. The average width of the range ofeach group between 2.81-8.06 Ha. Adult male and femaleratio of adult 1:4. Occupational areas experience shifts astime changes

Javan lutung, occupation, Natural Tourism Park PananjungPangandaran, population dynamic

CO-07Assessment of future fisheries biodiversity using amultidimensional scaling approachIsah Aisyah1,♥, Agus Heri Purnomo2, Asep K.Supriatna1

1Department of Mathematics, Faculty of Mathematics and NaturalSciences, Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21Jatinangor, Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email: nurhayati_atikah@yahoo.com2Agency for Marine and Fisheries Research and Development. Jakarta,Indonesia

The biodiversity level of fisheries resources over time maychange, improved or worsened, depending on theconditions of the factors surrounding the resource of thepresent. An analysis tool known as the Multi-DimensionalScaling (MDS) can be used to assess the relationshipbetween such factors and the prospect of marinebiodiversity in an area, including in coastal areasPelabuhan Ratu, Sukabumi, West Java, Indonesia. Basedon that, this research is aimed at assessing the futurecondition of the biodiversity of fishery resources inPelabuhan Ratu, a coastal location with a high biodiversitybut facing factors suspected to affect its future. Somefactors, which according to the MDS approach are referredto as dimensions were observed; these dimensions werefisheries resources, fisheries ecosystem, fisheriestechnology, social conditions, economic value, andfisheries regulation. The data used in this research primaryand secondary data collected using purposive a samplingtechnique involving 30 respondents. Based on the result,fisheries resources, fisheries ecosystem, and fisheriesregulation dimensions fall into a bad biodiversity categoryand therefore they need to be prioritized. Meanwhile,fisheries technology, social conditions, and economic valuedimensions are in a medium fisheries biodiversity categoryand therefore they might be put as the second priority. Thisresult indicates the importance of local governmentregulation to speed up programs directing to the

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 67

improvement of the above mentioned bad dimensions.

Assessment, biodiversity, fisheries,multi-dimensionalscaling, Pelabuhan Ratu

CO-08Status and threats to coral reef ecosystems in thecoastal of Balikpapan, East Kalimantan, IndonesiaAsep Agus Handaka Suryana♥, NurudinFaculty of Fisheries and Marine Science, Universitas Padjadjaran. Jl. RayaBandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363,West Java, Indonesia. Tel.: +62-22-87701519, Fax.: +62-22-87701518,♥email: asepagushs@gmail.com

This study aims to determine the condition of coral reefbiodiversity and the threat to the ecosystem in the coastalcity of Balikpapan. The study was conducted from June toSeptember 2016. The data were observed using Lineintercept transect method. The data collected were thepercent of coral cover based on the growth form (lifeform)estimated each transect and recorded coral species includedin the transect. Observations on Teritip and LamaruBeaches show bad condition/serious damage, it is seenfrom the discovery of the dives that the coral cover is foundonly in the form of rubble, and there are some soft rootcorals covered by the silt due to high sedimentation rate. InWest Balikpapan, East Kalimantan, Indonesia preciselyaround Balang island, coral reef observation results showhard coral cover condition 18.02 percent, a hard coral lifeform which is dominant is massive coral non-Acropora.The low level of brightness is caused by the highsedimentation rate so as to make environmental conditionsthat are not ideal for coral reefs, coral reef ecosystemdamage caused by sedimentation from river and fishingwith trawl.

Balikpapan, coral reefs, diversity, threats

CO-09Spatial analysis of rare and threatened raptordiversity in Telaga Warna, Bogor, IndonesialandscapeSusanti Withaningsih1,2,♥, Firman Hadi3, Parikesit1,2,Johan Iskandar1,2, Erri N. Megantara1,2

1Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:susanti.withaningsih@unpad.ac.id2 Institute of Ecology, Universitas Padjadjaran. Jl. Sekeloa Selatan IBandung 40132, West Java, Indonesia3 Asian Institute of Technology, Pathumthani, Bangkok, Thailand

Nest-site selection is an important aspect of avianreproductive ecology because is reflects the environment inwhich adults, eggs, and nestling will be exposed duringcritical periods. In relation to this, a spatial analysis has

been undertaken to assess the relationship betweenlandscape structure and the presence of raptors nests in thelandscape of Telaga Warna, Cisarua, Bogor, West Java,Indonesia. The study used four circular buffer distances of250, 500, 750 and 1000 m around each nest-tree to analyzethe relationship between raptor nest occurrence andlandscape structure. The result suggests that the landscapeof Telaga Warna is a mosaic, consist of the natural andartificial vegetation of different structure. Suchcombination has resulted in high landscape heterogeneitythat accommodates three species of raptors to co-exist inTelaga Warna landscape. In general, landscapeheterogeneity in sites where nests were built appears to besimilar. The Three species of raptors tend to select anesting site that has a low degree of landscape contrast.Besides, landscape connectivity within these sites, wherethe three species of raptors built their nests, is to someextent exhibit a difference. However, in terms of landscapecomplexity, there is no great difference among the nestingsites. The three raptor species tend to build their nests inplaces with various topographical conditions

Landscape, raptor, nesting site, spatial analysis

CO-10Introduction of study domestication of manggabaifish (Glossogobius giuris) in different environmentYuniarti Koniyo♥, JulianaProgram of Aquaculture, Faculty of Fisheries and Marine Science,Universitas Negeri Gorontalo. Jl. Jenderal Sudirman No. 6, KotaGorontalo 96128, Gorontalo, Indonesia. Tel.: +62-435-821125-821752,Fax.: +62-435-821752, ♥ email: yuniarti.koniyo@ung.ac.id

Manggabai fish (Glossogobius giuris) is one of the fishspecies that have good economic value, so its sustainabilityneeds to be maintained. Manggabai fish population innature continues to decline, this is due to environmentalchanges. Environmental changes that occur in nature isvery difficult to control so that required a method that canbe used to preserve Manggabai fish that exist in the naturalenvironment. Domestication is one of the methods used tomaintain organisms that live in a natural environment to anartificial (controlled) environment. This study aims todetermine the natural and artificial environment differencesas a basis for conducting domestication on Manggabai fish.The research method used is an experimental method thatis with the cultivation of fish in the natural and artificialenvironment. Manggabai fish cultivation in the naturalenvironment using a floating net cage system volume of 1m3, while the cultivation in the artificial environment usinga tub of the concrete volume of 1 m3. Manggabai fish usedmeasuring ± 7 cm with a density of 100 tail m3.Maintenance is done for 90 days and feeding is only givento cultivation in the artificial environment as much as 20%with a frequency twice daily. The research variables consistof growth rate and survival rate of Manggabai fish. Dataanalysis using t-test with 95% confidence level to know thedifference of growth and survival of Manggabai fish in a

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9068

different environment. The results show that there is adifference to the growth and survival of Manggabai fishkept in different environments. The highest growth andsurvival was obtained in the natural environment of 94%,while the highest growth was obtained in an artificialenvironment of 0.052 cm/day.

Environment, growth rate, manggabai fish, survival rate

CO-11Differences on pollination and flowering ofsandalwood along landscape gradients in GunungSewu, and its consequences on the reproductiveoutputsYeni W.N. Ratnaningrum1,♥, Sapto Indrioko2, EnyFaridah3, Atus Syahbudin4

1 Laboratory of Forest Seed Technology, Faculty of Forestry, UniversitasGadjah Mada. Jl. Agro No.1, Bulaksumur, Caturtunggal, Depok, Sleman55281, Yogyakarta, Indonesia. Tel.: +62-274-550541, ♥ email:yeniratnaningrum@gmail.com2 Laboratory of Forest Genetic, Faculty of Forestry, Universitas GadjahMada. Jl. Agro No.1, Bulaksumur, Caturtunggal, Depok, Sleman 55281,Yogyakarta, Indonesia 3 Laboratory of Plant Physiology, Faculty ofForestry, Universitas Gadjah Mada. Jl. Agro No.1, Bulaksumur,Caturtunggal, Depok, Sleman 55281, Yogyakarta, Indonesia 4

Laboratory of Dendrology and Ethnobotany, Faculty of Forestry,Universitas Gadjah Mada. Jl. Agro No.1, Bulaksumur, Caturtunggal,Depok, Sleman 55281, Yogyakarta, Indonesia

Sandalwood (Santalum album Linn.) was origin to theNusa Tenggara islands of Indonesia but is recentlyoccurred as new landraces in Gunung Sewu Geopark(southern-middle Java). This study compared pollinationand its effect on reproductive outputs among sandalwoodpopulations along environmental gradients in GunungSewu, during the dry and rainy season of 2016 floweringperiod. Flowering and pollination rate differed significantlybetween seasons but were similar among sites. In contrast,the reproductive outputs differed significantly among sitesbut were similar between seasons. More flowers andpollination were achieved in the rainy season. Pollination isless correlated to flowers abundance, but more affected bypopulation size. The higher, cooler population visited moreby Dipterans (31.8% to 32.6%) and Hymenopterans (28.2%to 30%), while the warmer, lower sites dominated byLepidopterans (37.2% to 43%) and Dipterans (32.9% to38.2%). Higher population received fewer visits, butvisitors diversity were higher (28 families). In contrast,more visits were achieved in lower sites, but with lowerdiversity (20 families). Most insect families wereconsidered "Rare" and "Occasional". However, pooledaltogether, the whole families of the order Lepidopteransand Dipterans considered "Frequent" and "Effective". TheHymenopterans considered "Frequent" and "Effective" atNglanggeran and Wanagama. The Cicadellidae ofColeopterans, along with arachnids and grasshoppers, wereconsidered robbers. All of the agents were diurnal.However, the time of activity was varied. All populationshave fewer flowers and visits in the dry season. However, it

resulted in more fruits. Rainy season gained more flowersand visits, but in contrast, resulted in fewer fruits. Bothflowers abundance and pollination were negativelycorrelated to the reproductive parameters. The populationsmight gain more flowers and visits, but the reproductiveoutputs were significantly lower. Particularly in theclonalized and lower heterozygosity populations, moreflowers increased the opportunity of geitonogamy, resultedin high selfing rate which may lead to inbreedingdepression.

Environmental gradients, flowering, pollination events,reproductive outputs, Santalum album

CO-12Social capital of the community in themanagement of Danau Sentarum National Park,West Kalimantan, IndonesiaEmi Roslinda1,♥, Dudung Darusman2, Didik Suharjito2,Dodik Ridho Nurrochmat2

1 Faculty of Forestry, Universitas Tanjungpura. Jl. Prof. Hadari Nawawi,Pontianak 78121, West Kalimantan, Indonesia. Tel.: +62-561-765342,583865, 732500, Fax.: +62-561-765342, ♥email: eroslinda71@gmail.com2 Faculty of Forestry, Institut Pertanian Bogor. Jl. Lingkar AkademikKampus IPB Darmaga, Bogor 16680, West Java, Indonesia

Many studies on the management of National Park havebeen conducted in various countries with diverse topics.The research will highlight the management of naturalresources by the local community from the view of theirsocial capital. The research was conducted in DanauSentarum National Park which is administratively locatedin Kapuas Hulu District, West Kalimantan Province,Indonesia. The method used was survey method withquantitative approach. The social capital of the communityin the area of Danau Sentarum National Park is stillhigh/strong. Based on this condition, management of theNational Park that has been conducted by the governmentalone can be collaborated with the management by thecommunity and collaborative management that pays a goodattention to the minimum resistance and maximumsynergy.

Collaborative, management, community, social capital

CO-13Local biodiversity vis-à-vis resource-poor people:Revealing subsidies from natureParikesit1Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:parikesit@unpad.ac.id

Local biodiversity supports various biological productionsystems in rural Indonesia that generally operate as a small-

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 69

scale economic activity. The local resource providesvillagers, often categorized as resource-poor people, andtheir production systems a greater flexibility to maintainproductivity and efficiency. Local biological resourcesextraction has long been acknowledged to play animportant role as a source of cash income and to provideinputs for agricultural production systems. The extractiveactivities, which usually carried out at small-scale andinvolve impoverished households, have to some extentaffected the conditions and maintenance of biologicalresources. Fuelwood and forages, mainly extracted fromthe nearby remnant forest and plantations, were amongmajor local bioresources that contributed considerably toagricultural and household production systems. Theimportance of local bioresources in supporting ruralhouseholds and small-scale biological production systemsis substantial, although it is frequently neglected byagencies and institutions involved in rural development.This article tries to elucidate how rural people and somebiological production system heavily depend on localbioresources. In relation to this, an integrated system aimedto lessen reliance on external inputs, but not to entirelysubstitute the use of external resources is inevitable. Thearticle also describes some principles to conserve localbiodiversity, which at the same time may guarantee thesustainability of bioresource supply as one form of naturalsubsidy

Fuelwood, local bioresource, natural subsidy, resource-poor

CO-14Mapping of the bundle of forest ecosystem servicesin West Java, IndonesiaHikmat RamdanSchool of Life Sciences and Technology, Institut Teknologi Bandung.Labtek XI SITH-ITB, Jl. Ganesa 10, Lebak Siliwangi, Coblong, BandungCity 40132, West Java, Indonesia. Tel.: +62-22-2511575, ♥ email:hikmat@sith.itb.ac.id

A good and healthy forest ecosystem provides a variety ofecosystem services, such as water, biodiversity, carbonstorage, and natural beauty. Forest ecosystem services arenot only provided by protection forests or conservationforests, but also by production forests. The spatialdistribution of forest ecosystem services benefits fromforest management with Geographic Information Systems(GIS) is a new breakthrough in ecosystem servicesmanagement. This study aims to identify the potentialdistribution of some important forest ecosystem services(water, biodiversity, carbon storage) in protected forests,conservation forests and production forests in West JavaProvince. The GIS-based BEST (Bundling EcosystemServices Technology) method is applied to identify thespatial distribution of some ecosystem services provided byeach forest area. The results show that protected forestshave the highest bundle of three ecosystem servicescompared to other forest functions. Production forest notonly produces timber but has great ecosystem services

potential after protected forest in West Java Province. Theecosystem services of biodiversity and carbon storage areinfluenced by existing land cover conditions, while thewater ecosystem services are influenced by thehydrological characteristics of the region.

Ecosystem services, forests, GIS

CO-15Tenuipalpus mites (Acari: Tenuipalpidae) onorchid variants in Malang Raya, East Java,IndonesiaUlya Wildaniyah♥, Nugroho Susetya Putra, SuputaDepartment of Plant Pests and Diseases, Faculty of Agriculture,Universitas Gadjah Mada, Jl. Flora No. 1, Bulaksumur, Caturtunggal,Depok, Sleman 55281, Yogyakarta, Indonesia. Tel.: +62-274-563062,♥email: ulya.wildaniyah88@gmail.com

Malang Raya (Ex Residency/Karesidenan Malang, EastJava, Indonesia) is the center of orchid cultivation(Orchidaceae) in Indonesia. One of the most significantpests on orchid is mites. Mites can cause damage andeconomic losses. The aims of this study are to determinethe species in the genus Tenuipalpus, active time on orchidplants, accumulated amount of population on four types oforchid, and also the intensity of Tenuipalpus attack.Snowball technique was used in this study. Therefore eightlocations were observed. The morphology identificationwas observed based on Krantz and Walter, Mesa et al. Theresult based on morphological characters, species in genusTenuipalpus in the orchid plant is Tenuipalpus pacificus.The population Tenuipalpus increased at 10.00 a.m. Theintensity of Tenuipalpus attack on four orchid variantsshows insignificant values, varied from 20.02-30.10%which determined as low attack intensity. The cumulativepopulation of Tenuipalpus in Cattleya orchid was lowestand the Coelogyne orchid was highest, with a mean of 9.8and 72 mites/plant respectively.

Malang Raya, orchid, Tenuipalpus

CO-16Biodiversity of Arbuscular Mycorrhizal Fungi andits potential use for agriculture: Experience fromsome sites in West Java, IndonesiaAnne Nurbaity1,♥, Titun Supriatun2

1 Department of Soil Science, Faculty of Agriculture, Universitas,Padjadjaran. Jl. Raya Bandung Sumedang Km. 21 Jatinangor, Sumedang45363, West Java, Indonesia. Tel./Fax. +62-022-7796316, ♥email:a.nurbaity@unpad.ac.id2Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia

The existence of soil biota is vital for sustaining thebiosphere and functioning the ecosystems. In the natural

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9070

environment, nearly all plants live in symbiosis withmycorrhizal fungi, which assists them in nutrient uptakesand protect the plant from adverse conditions. Field studiesto identify the biodiversity of AMF and select indigenousAMF that can use for agriculture practices such asbiofertilizer or biocontrol agents have been done. Thestudies raised some questions such as: were the AMF existsunder all plant species in selected area? What were thespecies of AMF and how was the frequency of theirdistribution?. Field sampling of rhizosphere soils fromseveral sites in West Java, Indonesia showed that AMF hadbeen found in all field explored and AMF associated withmost of the plants assessed. A number of spores and thedegree of infection varied between plants. Dominantspecies were Glomus sp. whereas Gigaspora sp. andAcaulospora sp. only found from the rhizosphere of someplants. Some fungi explored, have been developed intomycorrhizal inoculant that used as biofertilizer andbiocontrol agents. However, further steps andmultidisciplinary researches are needed to maximize thepotential benefits of AMF biodiversity for agricultural usethat can support sustainable farming system.

Arbuscular mycorrhizal fungi, biocontrol, biodiversity,biofertilizer

CO-17Potato Cyst Nematode in East Java, Indonesia:Newly infected areas and identificationHappy Cahya Nugrahana1,♥, Siwi Indarti2, EdhiMartono2

1 Agricultural Quarantine Major Service of Surabaya. Jl. Raya Juanda,Semambung, Gedangan, Sidoarjo 61253, East Java, Indonesia. Tel.: +62-31-8673997. ♥email: happy_cahya@rocketmail.com2 Department of Crop Protection, Faculty of Agriculture, UniversitasGadjah Mada, Jl. Flora No. 1, Bulaksumur, Caturtunggal, Depok, Sleman55281, Yogyakarta, Indonesia

Potato Cyst Nematodes (PCN), Globodera rostochiensishas noted to be a devastated pest on potato in Indonesia. Itis listed as the A2 pest by Plant Quarantine of RepublikIndonesia, and it was also a highly concerned plantparasitic nematode species worldwide. Therefore, bothintensive and extensive surveys should be done to monitorthe spread of PCN, especially in East Java as a center ofpotato plantation. The aim of this study was to study thedistribution of PCN in four potato plantations in East Java,i.e. Batu, Magetan, Probolinggo, and Pasuruan which werelocated between 1205 to 2063 m above the sea level.Extraction and isolation of cysts and second-stage ofjuveniles from soil samples were done using Baunackemethod, and it was followed by identification of thenematodes using morphological and molecular approachesaccording to Baldwin and Mundoocampo. The resultsshowed that PCN was found on all sampling sites, i.e. Batu(Sumber Brantas, Jurang Kuali, Tunggangan, Junggo,Brakseng); Magetan (Dadi, Sarangan, Singolangu);Probolinggo (Tukul, Pandansari, Ledokombo,

Sumberanom, Wonokerto, Ngadas), Pasuruan (Wonokerto,Tosari, Ledoksari, Ngadiwono). Both morphology andmolecular methods showed that the species found on allsites was G. rostochiensis. Magetan and Pasuruan werenoted as newly infested areas in East Java.

East Java, Globodera rostochiensis, identification, newlyinfected area, potato

CO-18The presence of Functional of Group Species(FGS) on secondary succession processes inManglayang Mountain forests, Sumedang, WestJava, IndonesiaIchsan Suwandhi♥, Ihak Sumardi, M. Fakhri W. SadeliProgram of Forestry Engineering, School of Life Sciences andTechnology, Institut Teknologi Bandung. Jl. Kol. (Purn) Mashudi No. 1Jatinangor, Sumedang 45363, West Java, Indonesia. Tel.:. +62-22-2511575, ♥ email: ichsan@sith.itb.ac.id

Succession is a series of changes in the plant community inconjunction with changing places of growth. These changesoccur gradually and through several stages from simpleplant communities to climax. Manglayang MountainForest, West Java, Indonesia area is one example ofsecondary succession process become an old secondaryforest. In this area has reached the climax phase but thereare various disorders that routinely occur, which resulted inthe opening of areas within the natural forest area.Vegetation analysis was conducted to determine thecomposition of species and the level of plant dominance inthe forest. Furthermore, the classification of plant speciesbased on the same response to the stages in the successionprocess, which is based on Functional Group. The resultsof the study show that the former disturbance areas inManglayang mountain forest are found as many as 55species of plants with dominant species such as Ficus ribes,Ficus sp., Schima wallichii, Villebruena rubescens, Meliaazedarach, Castanopsis argentea, Castanopsis javanica,and Syzygium lineatum. All species are then classified intothree groups according to the characteristics of the speciesthat have been determined using literature studies. Thisplant community is also known as Functional GroupSpecies (FGs). The three classification groups include: (i)early successional species with 23 species, (ii) mid-successional species with 25 species and (iii) latesuccessional species, With 7 species. The classificationresults show that the sub-climax species have a highabundance of 1655 stems/ha and the highest speciescomposition among other groups, so it is known that theManglayang Mountain forest area is experiencing asecondary succession in the middle succession phase.

Climax, natural regeneration, functional group species,secondary succession

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 71

CO-19The invasion of alien plant species seed in the seedbank: Its implications for abundance andgermination of native seeds in Mount Manglayangnatural forest, West Java, IndonesiaIchsan Suwandhi♥, Ihak Sumardi, Destriana AnelasariProgram of Forestry Engineering, School of Life Sciences andTechnology, Institut Teknologi Bandung. Jalan Kol. (Purn) Mashudi No. 1Jatinangor, Sumedang 45363, West Java, Indonesia. Tel.:. +62-22-2511575, ♥ email: ichsan@sith.itb.ac.id

Mount Manglayang, West Java, Indonesia forest is an areathat has been fragmented due to encroachment andagricultural activities in the vicinity. The condition ispotentially against the ingress of invasive alien species intonatural forest ecosystems. The evidence showed thatinvasive species were significantly affected seed reservesin the soil (seed bank). This study aims to identify the seedsof invasive alien species and native species and comparingthe seed germination ability of both. The data collection isdone by using stratified random sampling in 12 plotsmeasuring 20 x 20 m below the natural forest stands onthree layers of soil depths (0-5, 5-10 and 10-15 cm). Allseeds are identified and then analyzed to determine thegermination ability. The results found as many as 21species of plants with a number of individuals as much as293 seeds is divided into three layers of soil, covering 124seeds on a layer of 0-5 cm, 99 seeds at 5-10 cm and 20seeds in 10-15 cm. There are two alien plant species wereidentified, namely Drymaria cordata and Commelinabanghalensis, such as herbaceous plants. From the seedscontained in the seed bank, 23% of them have germinatedand are from 13 species. The final results showed that theseeds that can last only up to 17% after eight weeks. Basedon the depth of the soil layer is known that the seeds thatgerminate only found in a layer of 0-5 cm. Drymariacordata and Commelina banghalensis have the ability togerminate higher than native species such as Ficus ribes,Melia azedarach, Hibiscus similis and Macarangatanarius. The conclusion of this study indicate that thepresence of two invasive alien species has changed thepattern of seed germination of native species

Alien invasive species, Commelina benghalensis, Drymariacordata, Mount Manglayang forest, seed bank, seedgermination

CO-20Diversity of Tripsin activity of sengon inhibitorfrom Uromycladium tepperianum fungus attack onthree locations of different growth placeAlfi Rumidatul♥, I Nyoman P. Aryantha, EndahSulistyawatiSchool of Life Sciences and Technology, Institut Teknologi Bandung.Labtek XI SITH-ITB, Jl. Ganesa 10, Lebak Siliwangi, Coblong, BandungCity 40132, West Java, Indonesia. Tel.: +62-22-2511575, ♥ email:alfi@sith.itb.ac.id

Sengon (Falcataria moluccana (Miq.) Barneby &J.W.Grimes; syn. Paraserianthes falcataria (L.)I.C.Nielsen) has chemicals such as trypsin inhibitors thatcan inhibit the activity of the enzyme fungusUromycladium tepperianum causes tumor rust disease. Thepurpose of this study was to study the diversity of theactivity of trypsin inhibitor Sengon and its association withU. tepperianum fungus attack. This research conducted invillages of Cileles, Sukarapih, and Cisempur of Sumedang,West Java, Indonesia. Materials of research in the form ofwood powder and bark of Sengon tree with the healthycondition and attacked at three location of the differentplace of growth. The results showed that the activity oftrypsin inhibitor on sengon which was sick (183,86 mg/g)was higher than healthy Sengon (146,01 mg/g). Theactivity of trypsin inhibitor in the skin (178.38 mg/g) ishigher than that of wood (151.50 mg/g). Viewed from thelocation where it was grown, the highest activity of trypsininhibitor was found in Cileles Village of 188.60 mg/g, thenSukarapih Village of 163.43 mg/g and the lowest was inCisempur Village 142.79 mg/g.

Place to grow, sengon, trypsin inhibitor, Uromycladiumtepperianum

CO-21Study of provisioning services on agroforestrysystem in Citatah Karst, District of West Bandung,West Java, IndonesiaIndri Wulandari♥, Teguh Husodo, Nurullia Fitriani,Erri N. MegantaraDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:mauraku.wulandari6212gmail.com, indri.wulandari@unpad.ac.id

This research was a study of the ecosystem services,especially provisioning services on agroforestry system.Agroforestry was related to land used that combined plantsfrom various strata and habits in the management andutilized of land by local people. The purpose of thisresearch was to know the types of provisioning services inthe agroforestry system in Citatah Karst area, District ofWest Bandung, West Java, Indonesia and to know theknowledge of the community in its utilized andmaintenance. This research was used combined methodwith the quantitative and qualitative method. Quantitativemethod is used in collecting data of community knowledgein utilization and maintenance through a survey withquestionnaires. Qualitative methods are used in exploringthe types of provision services in the agroforestry systemthrough informant's approach. The results show that thetypes of provisioning services available to the agroforestrysystem in the Citatah karst area are food sources, animalfeed sources, ingredients source of building materials,energy sources, and water sources. The community haslocal knowledge in the utilization of land, water, as well as

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9072

flora and fauna fund which is still done by some people inCitatah karst area.

Agroforestry, karst, provisioning services

CP-01Vegetation structure and composition of coastalforest in Leuweung Sancang Nature Reserve,IndonesiaTina Safaria Nilawati♥, Yusuf Hilmi Adisendjaja, AfriIrawanDepartment of Biological Education, Faculty Education of Mathematicsand Natural Sciences, Universitas Pendidikan Indonesia. Jl. Dr. SetiabudhiNo. 229 Bandung 40154 Jawa Barat. Tel./Fax.: +62-22-2001108, ♥ email:nilawati.ts@gmail.com

Leuweung Sancang Nature Reserve, Garut, West Java,Indonesia coastal forest is a conservation area that had beenthreatened by a human in 1997. In that time most of thetrees were damaged and cleared. Today, the forest hasrecovery toward climax ecosystem. Therefore, we measurevegetation structure and composition to provide indicatorsfor ecosystem management. This research was conductedin the Leuwueng Sancang coastal forest bounded by theCikolomberan and Cipalawah rivers, by using the belttransect method. Belt transects mounted perpendicular tothe shoreline, 11 units, each belt contained 20 x 20 m2

quadrats for 3 units. The research found 361 individualsconsisting of 44 plant species belonging to the 29 families.Species with the highest number of individuals is Mallotustiliifolius (34 individual) of Euphorbiaceae. Species withthe highest Importance Value Index (IVI) is Terminaliacatappa (33.53). Therefore T. catappa is shown to affectthe stability and control the flow of energy in theecosystem. In the nearby coastal forest to the shoreline(zone 1) is dominated by T. catappa (IVI = 57.76), in themiddle of the coastal forest (zone 2) is dominated byShorea sp. (IVI = 43.18), and the farthest coastal forestsfrom the shoreline dominated by Elaeocarpus serratus (IVI= 34.74524). Shannon-Wiener diversity index (H') of theLeuweung Sancang coastal forests is 3.34. The H 'value iscategorized as a high category, it indicates the coastalforest ecosystems have a good stability of the ecosystem.

Coastal forest, diversity, Leuweung Sancang, vegetationstructure, vegetation composition

CP-02Status of population, occupation and seasonalhabitat displacement of alien bird species in WestJava tropical forest, IndonesiaRuhyat PartasasmitaDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:ruhyat.partasasmita@unpad.ac.id

“Invasive Species”, an alien species is defined as one “thatis not native (non-indigenous, foreign, or exotic)” to aparticular ecosystem. One cause of a species alien speciesis introduced intentionally or unintentionally. Trade ofanimals including birds, indicating the cause of alienspecies in several regions in Indonesia. it is suspected asthe discovery of a population of Finch-billed Myna,Scissirostrum dubium Latham 1802, in the forests ofWestern Java as a result of the indirect influence of the birdtrade. Finch-billed Myna is one of many birds endemic inIndonesia. In 2006, this bird categorized as threatenedspecies by IUCN. As far as we know, finch-billed Myna isa resident bird in Sulawesi island and surrounding. CITESentered it as least concern species because of fewinformation about population and distribution. The otherhand, We found them in Tangkuban Perahu Mount area.The population of Finch-billed Myna In Tangkuban PerahuMount is 17-24 individual of three group colonies. Theoccupation areas are Abria, Awi leuga and Manggu. Thevegetation density higher at Myna's former habitat (0.055ind./m2) and Myna’s recent habitat (0.028 ind./m2).Vegetation of Myna's recent habitat has good resources as aresting site, feeding site, and perching site of dead trees thatMyna's former habitat.

Alien species, Finch-billed Myna, population, habitat,resources

CP-03The birds diversity in the vegetation landscape atthe montane zone of Mount Tangkuban Perahu,West Java, IndonesiaRuhyat Partasasmita♥, Tedi SetiadiDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:ruhyat.partasasmita@unpad.ac.id

Tangkuban Perahu mountain landscape, West Java,Indonesia has the different types of vegetation, in the formof tea plantation, eucalyptus forest, and old secondaryforest. The diversity of vegetation will cause the diversityof the animals that inhabit it. Therefore, the objective of thestudy was to know the diversity of birds in differentvegetation landscapes. The types of vegetation in thelandscape of Tangkuban Perahu vegetation are five yearsabandoned tea plantation, ten years abandoned teaplantation, Eucalyptus forest, and secondary forest. Thebirds diversity of species inventory was undertaken byopportunistic observation and Point count techniqueapplied to collect the bird relative population data. Theresults showed that in the four vegetation types found 122species of 32 families, with 26.2% of endemic speciesstatus, 21.3% of the species protected status by theGovernment regulation no 7, 1999; 7.4% of the speciesstatus of migrants. The highest bird diversity is insecondary forest (4.01) and the lowest in five yearsabandoned tea plantation (2.50). The tendency of the two

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 73

types of vegetation adjacent and have similar types ofvegetation have had a great similarity index.

Bird diversity, natural forest, Tangkuban Perahu, teaplantation, vegetation utilization

CP-04Analysis of lower plant in Nature Reserve ofDungus Iwul, Bogor, West Java, IndonesiaInge Larashati SubroDivision of Botany, Research Center for Biology, Indonesian Institute ofSciences. Cibinong Science Center, Jl. Raya Jakarta Bogor Km 46Cibinong, Bogor 16911, West Java, Indonesia. Tel .: +62-21-876156. Fax.+62-21-8765062, ♥ email: ingels@ymail.com

Dungus Iwul Nature Reserve, Jasinga, Bogor, West Java,Indonesia is the remaining tropical forest on the island ofJava. The existence of this Nature Reserve has a veryimportant role because the habitat Iwul (Orania sylvicola)belong to the Arecaceae. This research is done because ofits lack of scientific publications related to Dungus IwulNature Reserve about plant ecology. The research used theexploratory method and squares plots. Total number ofseedlings were 4.574 individuals which dominated byOrania sylvicola has an important value (IV = 194.28%)followed by Knema laurina (IV = 14.9%), Nauclea (IV =7.07%), Gomphandra javanica (IV = 6.87%) and Ixorajavanica (IV = 6.3%) The index of species diversity is low(H '= <1). The families dominated by Rubiaceae,Euphorbiaceae, Melastomataceae, Anacardiaceae, andAnnonaceae.

Dungus Iwul Nature Reserve, lower plants

CP-05Ecological species of lower plant in the peat forestHampangen, Central Kalimantan, IndonesiaInge Larashati SubroDivision of Botany, Research Center for Biology, Indonesian Institute ofSciences. Cibinong Science Center, Jl. Raya Jakarta Bogor Km 46Cibinong, Bogor 16911, West Java, Indonesia. Tel .: +62-21-876156. Fax.+62-21-8765062, ♥ email: ingels@ymail.com

Indonesia is estimated to have 27 million hectares ofpeatland scattered in Sumatra, Kalimantan and Irian Jaya(Papua and West Papua provinces), this area is 60% of thetotal tropical peatlands. Central Kalimantan is the largestprovince in Indonesia with an area of approximately 15.4million hectares. Based on the type of ecosystem, a forestarea with an area of 6.2 million ha (71%) is the mineralsoil, forest area of 2.5 million hectares (29%) located onpeat swamp and mangrove land. Peat swamp forest is anecosystem that is a habitat of flora and fauna. Ecologicalresearch of plants is important to know the types of lowerplants as a means of regeneration. The research wasconducted by inventory method on a square plot of 1

hectare in Hampangen peat swamp forest, CentralKalimantan, Indonesia. The results of which can be knownto other types Compretocarpus rotundatus, Syzygium sp.,Nepenthes gracilis, Glaucum cratoxylon, Campnospermacoriaceum, Lasianthus sp., Stenochlaena palustris,Ardenanthera sp., Hospeldia glabra, and Calophyllumbiflorum are thought to have potential as foodstuffs,medicines, and others.

Central Kalimantan, Hampangen, peat swamp forest,vegetation ecology

Ethnobiology & Socioeconomics

DO-01The relationship between community andbiodiversity in corridor of Betung Kerihun andDanau Sentarum National Park, WestKalimantan, IndonesiaMohamad Arif Rifqi♥, Heriyadi, Muhammad SyukurWahyu PutraForum Orangutan Indonesia. Jl. Cemara Boulevard No. 58 Taman YasminSektor VII, Curukmekar, Bogor Barat, Bogor 16113, West Java,Indonesia, ♥ email: arifqbio@gmail.com; Jl. Untung Sridadi, KedaminHulu, Putussibau Selatan, Kabupaten Kapuas Hulu

Biodiversity is playing an important role as an activecomponent in an ecosystem that provides both direct andindirect benefits to humans and other living beings. As wellas in the buffer zone of Betung Kerihun and DanauSentarum National Park in Kapuas Hulu District, WestKalimantan, Indonesia. There are interactions andinterdependencies between the communities, itsbiodiversity and its ecosystem in the kind of utilizingenvironmental services and close socio-culturalrelationships. This research reveals the value ofbiodiversity and its relationship with the community inMensiau Village, Labian Ira'ang, Labian, Sungai Ajung andMelemba, Batang Lupar Subdistrict that included in thedelineation of Strategic Area of Corridors between BetungKerihun and Danau Sentarum National Park. The researchwas conducted in December 2014-April 2015 in the fivevillages. There were identified 28 species of mammals, 201species of avifauna, 40 species of herpetofauna and 353species of woody plants. The existence of relationshipsbetween biodiversity with local communities hasimplementing bio-socio-cultural relationship of Dayak Ibancommunity, Dayak Tamambaloh-Banuaka Labian and localMalay community. There are five species of mammals, 13species of avifauna and one species of herpetofauna areincluded in the list of protection by customary law, whilewoody plants are preserved and used sustainably afterillegal logging in the period of 1998-2005. In addition, Theexistence of the Bornean orangutan (Pongo pygmaues

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9074

pygmaeus), the potential of natural beauty, culture andlocal wisdom become the attraction of ecotourism thatmakes the local people realize and have a link betweennature and human. Moreover, the area is very strategic asupstream of Sentarum Lake and Kapuas River as well asbeing a transboundary region of Indonesia and Malaysia.

Biodiversity, Betung-Kerihun, corridor, Danau-Sentarum,social, ecosystem

DO-02Socio-ecological preferences of determinationorangutan release site; Study case MendalamWatershed in Kapuas Hulu, West Kalimantan,IndonesiaMohamad Arif Rifqi♥, Heriyadi, Muhammad SyukurWahyu PutraForum Orangutan Indonesia. Jl. Cemara Boulevard No. 58 Taman YasminSektor VII, Curukmekar, Bogor Barat, Bogor 16113, West Java,Indonesia, ♥email: arifqbio@gmail.com; Jl. Untung Sridadi, KedaminHulu, Putussibau Selatan, Kabupaten Kapuas Hulu, West Kalimantan,Indonesia

As one of the main targets of the Indonesian OrangutanConservation Strategy and Action Plan 2007-2017, therelease program of orangutans from a rehabilitation centerto the wild habitat is still a target that has not been achievedto date. One of the main obstacles faced is the lack ofproper location as a natural habitat for more than 1000orangutans in rehabilitation centers. This research revealsthe formulation of orangutan release location that coveringsocial, economic, cultural and ecological aspects asconsideration to determine feasibility by a case study inMendalam Watershed in Kapuas Hulu. This research wasconducted on October 2014-September 2015 in MendalamWatershed that focused in Datah Diaan Village, TanjungKarang Village, and Padua Mendalam Village, NorthPutussibau Sub-district, Kapuas Hulu District, WestKalimantan, Indonesia. There is two area study for theecological sampling, that is Seluwa River and MentibatRiver. There were identified 157,859 hectares effectivestudy areas inhabited by 2,336 people and consisting of twomajority tribes, namely Dayak Kayan-Mendalam andDayak Bukat. In addition, there are 19-29 species ofmammals, 71-97 species of avifauna, 242-253 species ofwoody plants 43-52% of which are Bornean orangutanfeed. The scoring process is then carried out withparameters of area condition, biodiversity, social condition,economy and culture, and also a potential conflict betweenanimal and human. The process resulted in the conclusionthat the location around the Mentibat River was morefeasible with a score of 10.75 compared to the locationaround the Seluwa River with a score of 10.1.

Mendalam-Watershed, orangutan, release-site, socio-ecology

DO-03Promoting cultural keystone species developmentfor community benefits: Case study on areca nututilization in East Nusa Tenggara, IndonesiaGerson N. Njurumana1,♥, Mariany M. Da Silva1, OskarK. Oematan1, S. Agung Sri Raharjo2, M.Hidayatullah3,♥♥

1Environment & Forestry Research and Development Institute of Kupang.Jl. Alfons Nisnoni No. 7 Airnona, Kupang 85115, Nusa Tenggara Timur.Tel. +62-380-823357, Fax. +62-380-831068, ♥email:njurumana@gmail.com2Watershed Management Technology Center. Jl. Ahmad Yani, Pabelan,Kartasura, Sukoharjo, Central Java. PO. Box 295 Surakarta 57102. Tel.+62-271-716709, Fax. +62-271-716959.3Research Development Institute of Non-Timber Forest ProductsTechnology Mataram. Jl. Dharma Bhakti No. 7. PO. Box 1054, DsLangko, Lingsar, Lombok Barat, West Nusa Tenggara, Indonesia. Tel.+62-370-6175552, Fax. +62-370-6175482, ♥♥email:dayat_kpg@yahoo.com

Areca nut (seed of Areca catechu L.) is a cultural keystonespecies, widely used by the international community, i.e. inchewing habits that reaches 10% of the world population.The chewing habits have long been developed in Indonesiancommunity, included 40% of East Nusa Tenggarapopulation. It has strategic value as an ecology asset thatinfluenced social-culture and economy of the community.The aim of the research is to understand the areca nutproduction and consumption per-capita in the community.The research was conducted on Sumba and Timor islandthrough a qualitative approach. Survey and interview methodto 200 households as the user is used. Data analyzed bydescriptive and qualitative. This research show the variesof Areca nut production in communities. In Timor island,Areca nut production per-capita is 15.48-235.5/kg/year,overcome of the consumption per-capita is 28.57-52.22/kg/year. In Sumba island, Areca nut production per-capita is 16.9-27.83/kg/year, less than consumption per-capita is 20.03-29.38 /kg/year. Generally, Areca nutproduction has not fulfilled the needs the community, thusimport of raw material from other regions. To establishself-reliance in the supply of raw material, need wide-scalecultivation of Areca nut through community empowerment.The activity will have an impact on increasing landcoverage, strengthening self-reliance, providing jobs andincomes diversification. It was concluded that the averageproduction capacity of Areca nut had not fulfilled theconsumption needs, and there was a deficit of raw materials.Thus, the interventions in its development are needed.

Areca nut, consumption, community and development,production

DO-04Eusideroxylon zwageri conservation base on localwisdom: A case study on Hutan Ulin MungkuBaru, Palangka Raya District, CentralKalimantan, Indonesia

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 75

Siti Maimunah1,♥, Faridh Almuhayat Uhib Hamdani2,Indartik2, Mega Lugina21Department of Forestry Science, Faculty of Agriculture and Forestry,Universitas Muhammadiyah Palangkaraya. Jl. RTA Milono Km 1, 5,Langkai, Pahandut, Kota Palangkaraya 73111, Central Kalimantan,Indonesia. Tel.: +62-536-3222184, ♥email: sitimararil@gmail.com2Pusat Penelitian dan Pengembangan Sosial, Ekonomi, Kebijakan, danPerubahan Iklim, Forest Research and Development Agency, Ministry ofEnvironment and Forestry. Jl. Gunung Batu No. 5, Bogor. P.O. Box 165Bogor 16610, West Java, Indonesia

Eusideroxylon zwageri Teijsm. & Binn. is one of the rarespecies in the traditional forest of Mungku baru and acommercial wood species with very slowly growth.Traditional forest at Mungku Baru Village in PalangkaRaya district, Central Kalimantan, Indonesia is the last ofNatural Forest that conservated with traditional law base onlocal wisdom. The aims of this research are to analysis howto manage our traditional forest and protect our forest baseon local wisdom. The considerable method in this researchis with in-depth interview method and direct observation tothe field from Juli 2016 until March 2017. The result of thisresearch is the hereditary of communities are believes thatthe traditional forest is a sacred and must be respectfulbecause they have the true histories about the damnation ofthis forest and they still believe it. The damnation is who iscut the E. zwageri trees in this traditional forest; someonegets bad luck in his live. Traditional Forest of Mungku baruis a culture pledge to identify the community around thisforest. Local Wisdom is one of caused E. zwageri of thetraditional forest of Mungku Baru can survive, and it willsurvive during the partnership efforts from multi-stakeholder keep on and initiated the legality andorganization of Traditional Forest.

Local wisdom, identity, organization, traditional forest

DO-05Biodiversity forest garden system undermanagement local wisdom in West Kutai District,IndonesiaMarten Apuy♥, Abubakar M. Lahjie, B.D.A.S.Simarangkir, Yosep Ruslim, R. KristiningrumFaculty of Forestry, Mulawarman University. Jl. Ki Hajar Dewantara, POBox 1013, Gunung Kelua, Samarinda Ulu, Samarinda 75119, EastKalimantan. Indonesia, Tel./fax. +62-541-748683, email:citra_lestari2008@yahoo.co.id

Our research on the first generation forest gardens(munaan) in West Kutai District, Indonesia, aimed (i)investigating the cultivation and the financial profit ofvarious plants grown by the residents in the first generationforest gardens (munaan); (ii) finding out the financialfeasibility level of the first generation forest gardens(munaan) cultivation by the residents. The subject of thisresearch included farmers or people who cultivated the old/first generation forest gardens as well as several plantcommodities namely durian (Durio zibetinus), rambutan(Nephelium lappaceum), cempedak (Artocarpus

champeden), langsat (Lansium domesticum), Ihau(Dimocarpus c.f. longan) (i.e. native Borneo Longan),meranti (Shorea sp.) and Kapur (Dryobalanops aromatica)trees. Five villages/kampongs were sampled, with each plotsized 20 m x 20 m. The analysis employed formulas ofvolume, increment, and basal areas to calculate the merantiand kapur trees. The fruit production was calculated byweighing the weight of the fruit. In order to find out therelationships among variables, a polynomial regressionequation was employed to obtain the regression coefficientof determination (R2). The financial analysis feasibilitywas done by using Pay Back Period (PP), Net PresentValue (NPV), Net B/C ratio and IRR. The amount ofrevenue level for each variant of fruit (i.e. durian,rambutan, langsat, ihau, and chempedak was differentdepending on the volume of fruit production and the sellingprice. The total amount of revenue from the cultivation ofkapur and meranti trees depended on the total volume oftimber, which was based on their diameter and basal areamultiplied by the price of the timber itself. These findingsimply that the cultivation of first generation forest gardens(munaan) was feasible for the community. The calculatedvalues of Pay Back Period, Net Present Value (NPV), NetB/C and IRR at the discount level factor of 5% were 19.3years; IDR 30,004,000, 1.58 and 8.8% respectively.

Cultivation forest gardens, finance

DO-06Economic valuations of mangrove forest ecosystemin Gampong Kuala Langsa, Langsa City, Aceh,IndonesiaSuri Nurul Alida♥, Mufti Petala PatriaProgram of Conservation Biology, Department of Biology, Faculty ofMathematics and Natural Sciences, Universitas Indonesia. Jl. LingkarKampus Raya, Kampus UI, Gedung E Lt. 2, Depok 16424, West Java,Indonesia. Tel.: +62-21-7270163 Fax.: +62-21-78849010. ♥email:rie.alida@ymail.com

The purpose of this study is to estimate the economicsvalue of mangrove forest ecosystem and to identify itscontribution to the society in the region of mangrove sitesin Gampong Kuala Langsa, Langsa City, Aceh, Indonesia.The method of economic valuation was applied to estimatethe economic value based on the benefits of mangrovesforest ecosystem. The variables measured were direct-usevalue, indirect-use, option value, existence value andbequest value. The calculation result of the economic valueof mangrove forest ecosystems was about Rp2,316,950,360 per year. This mangrove forest ecosystemalso has a major contribution to the society in the region asone of their income sources. They were already aware theimportance to protect mangrove forests because of itsecosystem function as land protection and their dependencyon the natural resources potential of mangrove ecosystems,such as oysters, clams, crabs, and shrimps for marketpurpose or private consumption.

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9076

Economic valuation, mangrove, Kuala Langsa

DO-07Farmers and tumpang sari: Case study inPalintang Hamlet, Cipanjalu Village, Bandung,West Java, IndonesiaBudiawati S. Iskandar1,♥, Johan Iskandar2,3, Hikmat A.Wibawa2

1Department of Anthropology, Faculty of Social and Political Science,Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21, Jatinangor,Sumedang 45363, West Java, Indonesia2Department of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21, Jatinangor,Sumedang 45363, West Java, Indonesia3Graduate Program of Environmental Study (PSMIL & DIL), UniversitasPadjadjaran. Jl. Sekeloa Selatan I, Bandung 40132, West Java, Indonesia

People of Palintang hamlet are recognized as one of thelocal communities residing in the upland of surroundingforest of Manglayang of West Java, Indonesia. Based onecological or environmental history, they initially theypracticed the swidden farming in the natural forest ofManglayang. Moreover, some of them involved as alaborer in various activities of the culture systems duringthe Dutch colonial. After Indonesian independent, theyhave participated as a laborer in the tumpang sari programof the Forest Service (Dinas Kehutanan) and the StateForestry Corporation (Perhutani). Today, farmers ofPalintang have intensively cultivated the pine forest forplanting cash crops, including cabbage and potatoes. As aresult, the farming practice in the forest has causeddilemma between providing cash income for local peopleand endangering the stability of the environment. Thispaper presents the findings of research on relationshipsbetween farmers of Palintang and the Forest Ecosystem,particularly in cultivating crops in the forest. The methodused in the study was a combination of qualitative andquantitative or mixed-methods. To collect field data, sometechniques, including observation, deep interview withinformants, and survey of plants in the garden (tumpangsari) and home garden system were carried out. The resultof the study shows that the farmers of Palintang havecontinuously cultivated the forest for tumpang sari sincethe Dutch colonial period until now. Based on theinventory of crops in the garden (tumpang sari) and homegarden, it was recorded 47 species and 42 species,respectively. The vegetables and fruits were predominantlyfound in both the garden and home garden. The practice oftumpang sari in the forests has provided some benefits,including fulfilling cash income for farmer households, butsome negative impacts on the environment, such as forestdestruction have also occurred.

Environment destruction, farmers, forest, tumpang sari,vegetable crops

DO-08Strategy of development marine culture throughSWOT analysis approach in Gorontalo UtaraDistrict, IndonesiaCitra Panigoro1,♥, Juliana2

1Program of Resources Management of Fishery, Faculty of Fisheries andMarine Science, Universitas Negeri Gorontalo Jl. Jenderal Sudirman No.6, Kota Gorontalo 96128, Gorontalo, Indonesia. Tel.: +62-435-821125-821752, Fax.: +62-435-821752, ♥email: citrapanigoro@ung.ac.id2Program of Aquaculture, Faculty of Fisheries and Marine Science,Universitas Negeri Gorontalo Jl. Jenderal Sudirman No. 6, KotaGorontalo 96128, Gorontalo, Indonesia

The fishery potential in District of Gorontalo Utara,Indonesia consists of capture fisheries and aquaculturefishery. The utilization of capture fishery potential inGorontalo district has reached 72.55%, while the utilizationof sea cultivation potential is only 15% of the potential.Based on these data, the cultivation of the sea is verypotential to be developed in the Gorontalo Utara because ithas a high potential but the utilization is still low. Thedevelopment of marine aquaculture can be successfullysupported by various factors. Factors influencing thedevelopment of marine aquaculture include environmental,economic, socio-cultural, infrastructure, legal andinstitutional factors. This study aims to establish a strategyof aquaculture development that can be used to determinethe utilization of a region through the approach of carryingcapacity of environmental quality by integratingenvironmental, economic, socio-cultural, infrastructure,legal and institutional factors. The method used in theresearch is SWOT analysis that is by identifying internalfactors and external factors that influence the developmentof marine aquaculture. The result of the research isobtained on the strategy of S-T: 0.84, W-O strategy: 0.75,S-O strategy: 0.69 and W-T: 0.64. Based on these results,the S-T strategy has the highest value, indicating that thestrength and challenge factors are the most important factorin the development of marine aquaculture in GorontaloUtara District.

Economy, environmental quality, infrastructure, seacultivation, social

DO-09Technology hunting of Deer Timor (Cervustimorensis) by ethnic Wandamen in KabupatenTeluk Wondama, West Papua, IndonesiaStalin Zedrik Kubiari Wosiri, Hermanus Warmetan♥,Mariana Hermina Peday, And Hermanus J. SikowayFaculty of Forestry, Universitas Papua. Jl. Gunung Salju, Amban-Manokwari 98314, West Papua, Indonesia. Tel & Fax.: +62-986-211364,♥email: hermanwarmetan@gmail.com

This research aims to know the technology hunting deer(Cervus timorensis) by Ethnic Wondamen in the District ofTeluk Wondama, West Papua, Indonesia. Descriptive

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 77

methods with observation techniques and semi-structuralinterview. Data collected includes: (i) technology includingdeer hunting; The purpose of hunting equipment andHunting of animals used, location, Techniques, Number ofpersons, the season and the time of hunting, tools, (ii)Utilization (iii), economic value (iv) transfer of localknowledge and (v) traditional conservation. The results ofthe research there was 2 deer hunting system i.e., passiveand active. passive use of trap in the afternoon. Whileactively hunting during the day with dog hunting day andnight using a flashlight tool. The purpose of hunting that isconsumed on its own, sale, and for home as well as theutilization of other jewelry. There are five techniques tohunt traps namely jerat para-para, jerat tali pusat, jeratranjau, and jerat panah. Hunting equipments are golok,spear, knife and flashlight. Utilization of reindeer includesmeat, horns and skin. It strengthens the social value offamily relationships. Traditional conservation in the formof a ban on the use of modern hunting tool. The huntingtechnique of using trap most hunting gets results comparedto a hunting dog.

Deer hunts, ethnic Wondamen, technology

DO-10Preliminary study on utilization and managementof sustainable use of bamboo in West Java,IndonesiaBudi Irawan1,♥, Johan Iskandar1,2

1Doctor Program of Environmental Study, Universitas Padjadjaran. Jl.Sekeloa Selatan I Bandung 40132, West Java, Indonesia. Tel.: +62-22-2508871; Fax.: +62-22-2504982, ♥email: budi.irawan.unpad@gmail.com2Department of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia.

Bamboo is recognized as a plant resource that can beutilized for various purposes in daily needs of villagepeople, particularly in West Java, Indonesia. Today,however, the bamboo gardens have been disturbed, namelyconversion of bamboo gardens for other land uses. As aresult, the potential use of bamboo uses has been lost. Thepurpose of this research is to understand the traditionalpractices of bamboo utilization and managementundertaken by the village people community in to makecriteria to sustainable use of the bamboo for the future. Themethod used in this study is a qualitative and sometechniques, particularly observation, deep interview, andsecondary data analysis were applied. The results of thestudy showed that the people of West Java used bamboofor various purposes, such as building materials, traditionalmusical instruments, woven crafts, foodstuffs, cookingware, agricultural necessities, livestock necessities,traditional medicinal materials, maternal needs, pikulan,fish catchers, ornamental plants and ritual ceremonies. Thecriteria for sustainable use and management of harvestingof bamboos has traditionally undertaken by localcommunity based on harvesting in the rotation in every 4-5

years. In addition, the harvesting has usually carried byselective cutting instead of total cutting. This method,however, has changed due to various internal and externalchanges, such as population increase and intensivepenetration of market economy. Therefore, the concept ofmanagement of bamboo utilization in the village area isurgently needed.

Bamboo utilization, bamboo garden conversion, sustainablyused of bamboo

DO-11Valuation of economic losses and conflictsmitigation of long-tailed monkey-Karangwangipeople’s in South Cianjur, West Java, IndonesiaEga Oktavianus Putra♥, Ruhyat Partasasmita, JohanIskandarGraduate Program of Biology, Department of Biology, Faculty ofMathematics and Natural Sciences, Universitas Padjajaran. Jl. RayaBandung-Sumedang Km 21 Jatinangor, Sumedang 45363, West Java,Indonesia. Tel.: +62-22-7797712, ♥ email:egaoktavianusputra@yahoo.com; ruhyat.partasasmita@unpad.ac.id

Long-tailed monkey (Macaca fascicularis Raffles, 1821) isa highly adaptive animal, can adapt to a variety of habitats.This high adaptability often causes conflict with humans.Conflict often occurs when long-tailed monkey habitat isclose to the garden or residential area such as inBojonglarang Jayanti Nature Reserve with a residentialcommunity of Karangwangi village, Cianjur, West Java,Indonesia. Long-tailed monkeys often damage plantationsand steal farmers' crops. This resulted in the publicperception that long-tailed monkeys are considered pests.As a result, it causes the economic losses of the people, dueto the decrease in income of the farmers. The purpose ofthis study is to determine the factors causing the conflict,the economic losses of society and handling techniquesconducted by villagers Karangwangi. This research wasconducted by using a combination of qualitative-quantitative methods (mixed methods research). Qualitativemethod is used to describe how the knowledge and attitudeof the people of Karangwangi Village to the conflict thatoccurred with long-tailed monkeys while the quantitativemethod applied to the calculation of the impact ofeconomic losses of the community on agricultural landcaused by a conflict with long-tailed monkeys. The resultsshowed that the cause conflict of Human-long-tailedmonkeys that damage the nature reserves BojonglarangJayanti and preferences of farming cultivation species.Valuation of economic losses of Karangwangi Villageevery month caused by human-Long tail monkey conflict isIDR 187,300/head of the household. Handling techniquesundertaken by the villagers of Karangwangi Village areguarding on farmland and installing trap

Conflict mitigation, economic valuation, Karangwangi, long-tailed monkey

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9078

DO-12Mathematical methods in conservation biologyA.K. Supriatna1,♥, M. Z. Ndii2, N. Anggriani1, E.Carnia1

1Department of Mathematics, Faculty of Mathematics and NaturalSciences, Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21Jatinangor, Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email: aksupriatna@gmail.com2Department of Mathematics, Faculty of Sciences and Engineering,Universitas Nusa Cendana. Jl. Adisucipto, Penfui-Kupang, Lasiana,Kelapa Lima, Kota Kupang y, East Nusa Tenggara, Indonesia

It has been a common believe that mathematics has beenapplied to other knowledge, including in life sciences.There are several examples of the applications ofmathematics in biology, population dynamics, ecology,epidemiology, genetic, and conservation biology. In thispaper, we delineate some mathematical methods that areoften utilized in these areas of life sciences. Methods suchas differential equations and linear programming arediscussed in the context of their applications to biologicalproblems. The concepts like eigen value and the largesteigen value are also discussed since they have special rolesin many life science applications, including in theapplication to population and conservation biology.Specifically, we will discuss the application in modelingthe growth of biological population and in its role indetermining the future of the population based onmathematical analysis. Some examples in managing thepopulation are also discussed. Some future directions onthe exploration of the relationship between these conceptsand other bio-inspired models are also presented.

Bionomic equilibrium conservation biology, populationdynamic model

DO-13The analysis of Cirata Dam’s fisheries resourcedepletion, West Java, IndonesiaZuzy AnnaDepartment of Fisheries and Marine Socio-Economics, Faculty ofFisheries and Marine Science, Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363, West Java,Indonesia. Tel.: +62-22-87701519, Fax.: +62-22-87701518, ♥email:suzyanna18@gmail.com

Fisheries in public waters such as Cirata dam, West Java,Indonesia is one of the potential economic, that should notbe ignored, because it has an important role, especially forfood security of the surrounding community.Unfortunately, capture fisheries in Cirata dam, has lessattention compared to aquaculture, which dominateseconomic activity in the waters. Recently, the condition ofthe dam is deteriorated, as a result of the massive activitiesof aquaculture with the use of extensive feed, an increasedof industrial and domestic waste that goes into thesewaters, coupled with its open access fisheries management,causing the fish resources in these waters allegedly

depleted. It is characterized by declining capture fisheriesproduction, from time to time. This paper calculates thevalue of depletion and depreciation of fish resources in theCirata dam. Bio-economic methods were used to calculatethe value of sustainable utilization. The analytical modelparameter estimation hire is a common biological model ofGordon Schaefer and Fox models. The depletion iscalculated by comparing the value of sustainable utilizationand value of the actual utilization of a quarterly data of theyear 2011 up to 2015, while depreciation is calculated byusing a value of unit rent multiplied to depletion. Theanalysis showed that the depletion of fish resources,occurred in some quarters observations. The value of totaldepletion from 2011 to 2015 amounted to 740.32 tons witha value of depreciation of IDR 5,256 billion. This value isthe economic loss of fisheries resources in Cirata dam. Thepolicy implication of this fish depletion, is the need forbetter management of aquatic habitats, by reducing waterpollution load, and management of capture fisheries,through input or output restrictions, using managementinstruments of Maximum Sustainable Yield (MSY) orMaximum Economic Yield (MEY).

Bio-economy, Cirata Dam, depletion, depreciation, fisheries,Fox, Gordon-Schaefer, MEY, MSY

Bioscience (Life Science & Technology)

EO-01The effects of bacterial endophytes from potatoroots and tubers on potato growth and CystNematode (Globodera rostochiensis)Noor Istifadah1,♥, Nurhayati Pratama2, SyahrizalTaqwim2, Toto Sunarto1

Department of Plant Pests and Diseases, Faculty of Agriculture,Universitas Padjadjaran. Jl. Raya Bandung Sumedang Km. 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel./Fax. +62-022-7796316,♥email: n.istifadah@unpad.ac.id

Bacterial endophytes are bacteria that inhabit plant tissueswithout causing any diseases. The endophytes existencemay have negative, neutral or positive effects on the hostplants. The paper discusses the effects of bacterialendophytes isolated from potato roots and tubers on potatogrowth and their abilities to suppress potato cyst nematode,Globodera rostochiensis. The bacterial endophytes wereisolated from potato roots and tubers, obtained from sixareas of potato plantation in West Java. The endophyteisolates were examined for their effects on potato growth.The nonpathogenic isolates were tested for their abilities tosuppress G. rostochiensis in vitro and potato plants. Theresults showed that from 88 bacterial endophyte isolatesobtained, 13 isolates caused rot in potato seed pieces, 22isolates inhibited the potato growth, 51 isolates did not

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 79

influence the growth, and two isolates increased the potatogrowth. The in vitro test showed that there were sevenisolates in which their culture filtrate caused juvenile-2 ofG. rostochiensis damaged, 67.5-97.7%. These isolates,however, were not effective in damaging the nematodeeggs. In the greenhouse experiment, the bacterialendophyte isolates suppressed the number of cysts by 51.7-65.4% and juvenile-2 of G. rostochiensis by 48.6-76.4%.

Juvenile-2, in vitro, culture filtrate, non-pathogenic isolates

EO-02Supplementation of VCO rich in medium chainfatty acids, vitamins.omega-3, results increaseHDL, lower triglyceride, in blood serum of MusmusculusSumaryati Syukur♥, Syafrizayanti, Siti Zulaiha,Mutiara Ismet, Teguh Wicaksono, Horas Raja GugukLaboratory of Biochemistry and Biotechnology, Department ofChemistry, Faculty of Mathematics and Natural Sciences, UniversitasAndalas. Kampus Unand Limau Manis Padang 25163, West Sumatra,Indonesia. Tel.: +62-751-71671, Fax.: +62-751-73118, email:sumaryatisyukur_unand@yahoo.co.id

The present study was carried out to evaluate the enricheddiet Virgin Coconut Oil (VCO) to increase High DensityLipoprotein (HDL); lower Triglyceride dietarysupplemented in blood serum of mice, Mus musculus. Thisresearch used VCO from Padang Pariaman, West Sumatra,Indonesia, rich in Lauric acids, vitamins, and omega-3.Virgin Coconut Oil made by using coconut milkfermentation at room temperature, extracted by wetprocessing without adding a chemical, and heat. Severalactive nutrients in VCO product have been determined byHPLC and GC. amount of lauric acid (C12) up to 58%,caprilic acid (C8) 8.9%, capric acid (C10) 7.8% included,vitamins A (1500 IU/100 mL), D (500 IU/mL), E (100IU/100 mL), Omega-3 (1.96%). This research aims toinvestigate some debate of using VCO in related to theimage that using Coconut Oil is bad for lipid profile is nottrue. This experiment using dietary VCO as a foodsupplement to determined lipid profile using 40 mice,which divided into 4 groups. Feeding on egg yolk to GroupI (negative control), Group II (positive control). The otherswere Group III fed with (egg yolk and VCO 2%) and groupIV (egg yolk and VCO 4%). It was determined in plasmalipid profile, the total of cholesterol, HDL. The durationtime was 10, 20 and 30 days after treated analyzed by usingthe enzymatic methods. The dietary of VCO 2 to 4%resulted in significant increases in HDL levels from 32% to69%. The dietary of VCO 4% for four weeks did not toxicto mice metabolism. Triglycerides level decreased from177 mg/dL to 85 mg/dL, and similar resulted in cholesterolratio. Feeding on VCO for 4 weeks, the (C10) SCFA and(C12) MCT not detected in plasma serum of mice. TheLCFA (C16) palmitate is decreased from 0.96 mg/mL to0.1 mg/mL.

HDL, Omega-3, triglyceride, virgin coconut oil, vitaminADE

EO-03Potency of compounds active extract leaf clove(Syzygium aromaticum) as aphrodisiacSyahran Wael1,♥, Tri Rini Nuringtyas1, NastitiWijayanti1, Pudji Astuti2

Faculty of Biology, Universitas Gadjah Mada. Jl. Teknika Selatan, SekipUtara, Sinduadi, Mlati, Sleman 55281, Yogyakarta, Indonesia. Tel.: +62-274-580839, email: sharan_wael@yahoo.com

Clove (Syzygium aromaticum) is a herbal plant fromMaluku, Indonesia which is believed to be able to treatvarious diseases, one of which is improving reproductiveperformance in men. This study aims to determine thecontent of clove leaf extract potency as a potentialaphrodisiac source. The leaves of cloves were maceratedusing methanol pro-analysis solvent for 3 days. Provisionof clove leaf extracts for 5 days with doses of 15, 75, 150,and 200 mg/weight in mice balb/c. The first day until the5th day conducted observations of sexual behavior such asmounting frequency, post mounting, and coitus.Observation data of rat sexual behavior, analyzed usingSPSS 20 software with Anova test. Treatment of clove leafextract increased sexual behavior at dose 75 mg/weightcaused by terpenoid compounds that act as hormoneattractant and flavonoid compound from clove leafextract.

Clove, extract, herbal, Maluku

EO-04Kidney histological in streptozotocin-induced maleWistar rats after administration of temulawakrhizome (Curcuma xanthorrhiza) and belimbingwuluh fruit (Averrhoa bilimbi) combined extractEma Purnama Sari♥, Madihah, Tia Setiawati, NiningRatningsihDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:kartiawati@unpad.ac.id

Complications that occur in patients with diabetes mellitusmay include kidney damage. Temulawak (Curcumaxanthorrhiza Roxb.) and belimbing wuluh (Averrhoabilimbi L.) were traditionally used to decrease bloodglucose levels so that it potential to be used as anti-diabeticdrugs. This study aimed to obtain the optimum dosage ofthe combination of temulawak rhizome and belimbingwuluh fruit extracts in repairing kidney damage in maleWistar rats induced by Streptozotocin (STZ). Anexperimental method using completely randomized designconsisting of seven treatments with three replications. Six

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9080

treatment groups were induced by STZ at dose 60 mg/kgBW intraperitoneally and one control group (without STZ-induced). The animals that have blood glucose level (BGL)≥200 mg/dl were states as diabetic. Furthermore, theanimals were treated orally with single or combined extractof temulawak rhizome and belimbing wuluh fruit for 21days. The treatment groups consists of PC (CMC 0.5%), G(glibenclamide 0.45 mg/kg BW), T (temulawak 17.5 mg/kgBW), BW (belimbing wuluh 750 mg/kg BW), TBW1(combined extract 767.5 mg/kg BW), TBW2 (combinedextract 383.75 mg/kg BW). The results showed that theextract affects the kidney histological structure. TBW2treatment improved kidney histological in glomerulardiameter and Bowman space width, as well as significantlydecreased the necrosis percentage of proximal tubularcompared with PC group (p<0.05). In conclusion, optimumdoses of combined extract of temulawak rhizome andbelimbing welch fruit were of 393.75 mg/kg BW inimproving histological kidney damage in rats induced bystreptozotocin.

Histological, kidney, temulawak, belimbing wuluh, diabeticrats

EO-05Preliminary phytochemical screening andanalgesic effects of the fruit of the sugar palm(Arenga pinnata) ethanol extractEvi Sovia1,♥, Dian Anggraeni2

1 Laboratory of Pharmacology, Faculty of Medicine, Universitas JenderalAchmad Yani. Jl Terusan Jenderal Sudirman, Cimahi 40285, West Java,Indonesia. Tel.: +62-22-6652069, ♥ email: soviaevi@yahoo.com2Laboratory of Histology, Faculty of Medicine, Universitas JenderalAchmad Yani. Jl Terusan Jenderal Sudirman, Cimahi 40285, West Java,Indonesia

The fruit of the sugar palm (Arenga pinnata Merr.) hasbeen widely used as analgesic agent empirically. Although,the study about the chemical compound and the effects wasstill limited. The aim of this study was to investigateanalgesic effects of the fruit of the sugar palm ethanolextract. Phytochemical screening also performed to knowchemical compound of the extract. Twenty male SwissWebster mice were used for this study. They were dividedinto four groups: control group was induced by acetic acidand 2 treatment groups were induced by acetic acid andgiven 50 and 100mg/kg bw the fruit of the sugar palmethanol extract; and compared group given 5 mg/kg bw Nadiclofenac. The writhing response was recorded fiveminutes after the i.p. injection of acetic acid. The results ofphytochemical screening revealed that alkaloids,flavonoids, and quinones were present in the extract.Treatment of male Swiss Webster mice with the fruit of thesugar palm extract (50 and 100mg/kg) significantlyinhibited the numbers of acetic acid-induced writhingresponse The result of this study showed that the fruit ofthe sugar palm extract has analgesic effects.

Arenga pinnata, analgesic, phytochemical

EO-06Carbon sequestration and growth ofAnthocephalus cadamba plantation in EastKalimantan, IndonesiaAgus Sarjono, Abubakar M. Lahjie, B.D.A.S.Simarangkir, Yosep Ruslim♥, R. KristiningrumFaculty of Forestry, Mulawarman University. Jl. Ki Hajar Dewantara, POBox 1013, Gunung Kelua, Samarinda Ulu, Samarinda 75119, EastKalimantan. Indonesia, Tel./fax. +62-541-748683, email:yruslim@gmail.com

Forest plantation of jabon (Anthocephalus cadamba) playsother important roles in addition to its role in producingwood such as wood for carpentry, plywood, etc. Otherfunctions of forest plantation of A. cadamba includeproducing biomass and absorbing carbon. The growth of A.cadamba trees was measured by using the formulas of MAI(Mean Annual Increment) and PAI (Periodic AnnualIncrement) as the basis to measure the increment in theworld of forestry, while in analyzing the value of biomassand carbon, simple linear regression was used, namely y-ax+ b, with the coefficient of R2 = 90%, which means thatthe correlation was very significant. The result showed thatthe annual increment of A. cadamba trees reached itsmaximum point or the intersection between MAI and PAIat the age of 8 years so that at this point the maximumproduction of A. cadamba trees was achieved. Forestplantation of A. cadamba also plays a role in environmentalchanges, including the production of biomass and carbonsequestration in A. cadamba tree in plot 1 at the age of 8years with the amount of 81.90 ton/ha and 39.31 ton/harespectively. The amount of biomass and carbon identifiedin A. cadamba trees in plot two was 96.85 ton/ha and 46.49ton/ha respectively, while the amount of biomass andcarbon in A. cadamba tree in plot three was 116.84 ton ha-1 and 56.08 ton ha-1 respectively. The results of theresearch also showed that every plot under this researchhad a very good value viewed from the correlation betweencarbon and biomass, litter and basal area in all A. cadambaplots with the coefficient determination (R2), which washigher than 90% or in other words, there was a strongcorrelation between them. The correlation between thediameter and biomass production and the correlationbetween the ages of stands and carbon production werealso strong with R2 value, which was higher than 90%.This indicated that A. cadamba plantation had importantroles in carbon sequestration and biomass production.

Anthocephalus cadamba, biomass, carbon, increment

EO-07Performance of probiotic character of Bacillus andSaccharomyces encapsulated in skim milk

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 81

Ratu Safitri1,2,♥, Yuli Andriani3, Sarah DewiFakhrudin1,4, Roostita Balia5

1Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:ratusafitrie@yahoo.com2Central Laboratory, Universitas Padjadjaran. Jl. Raya BandungSumedang Km. 21, Jatinangor, Sumedang 45363, West Java, Indonesia3Department of Aquaculture, Faculty of Fisheries and Marine Science,Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21,Hegarmanah, Jatinangor, Sumedang 45363, West Java, Indonesia4Program of Biotechnology, Graduate School, Universitas Padjadjaran, Jl.Dipati Ukur No. 35, Bandung, West Java, Indonesia.5 Faculty of Animal Husbandry, Universitas Padjadjaran. Jl. RayaBandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363,West Java, Indonesia

The encapsulation study of Bacillus and Saccharomyces inskim milk aims to find out the probiotic performance afterencapsulation in skim milk. The research method used wasexperimental descriptive using Completely RandomizedDesign (CRD) of three factors and three repetitions, whichinclude the characterization test of Bacillus andSaccharomyces, consisted of viability test, acidenvironment tolerance test, high-temperature tolerance test,tolerance test to concentration Bile salts, antimicrobialassays, autoaggregation, and coaggregation. Data wereanalyzed using Varian Analysis with 95% confidence leveland then continued with Duncan Multiple Range Test. Theresults of probiotic characterization test in this study provethat the encapsulation in the skim milk can maintain evenincrease the number of probiotics in the viability test,tolerance to the acidic environment, tolerance to the hightemperature, tolerance to bile salt concentration with thevalue equal to 1010-1014 CFU/g. In the antimicrobialassay, the encapsulated probiotic produces a largerdiameter of the transparent zone, as well as encapsulatedprobiotics, do not alter the ability of autoaggregation andcoaggregation of probiotics itself. Based on the results ofthe probiotic characterization test, skim milk is a goodcarrier to encapsulate probiotics of Bacillus andSaccharomyces because it can sustain and even enhance thecharacter of probiotics.

Antimicrobial assays, autoaggregation, coaggregation,encapsulation, probiotics

EO-08Steeping potential of Usnea baileyi as antioxidantson rats spermatogenesis (Rattus norvegicus)exposed by lead acetateDwi Nur Laksono♥, Iin Supartinah NoerDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:dwinlkun@gmail.com

The research on Usnea baileyi (Stirt. ) Zahlbr. as atraditional medicinal ingredient such as steeping herbs isbelieved to increase the stamina of men has been done.

This study aimed to determine the potency and obtain theoptimal dose of U. baileyi steeping to improve testicularweight, sperm quality, the number of spermatogenic cellsand density of spermatogenic cells in rats tubulusseminiferous exposed to lead acetate. The research wasdone experimentally using a completely randomized design(CRD) with 5 repetitions. There were 5 treatment that is P0(control(+) Pb acetate dose 100 mg/kg bw rats) P1 (control(-) CMC 5%), P2 (combination of Pb acetate dose 100mg/kg bw rats and U. baileyi steeping 10.500 mg/kg bwrats), P3 (combination of Pb acetal dose 100 mg/kg bw ratsand U. baileyi steeping 6.000 mg/kg bw rats), P4(combination of Pb acetate dose 100 mg/kg bw rats and U.baileyi steeping 3.500 mg/kg bw rats). The experimentalanimal used were 25 male rats (Rattus norvegicus) age 2-4months with body weight +180-220. Parameters measuredwere testis weight, sperm quality (concentration,morphology, motility) the number of spermatogenic cells(spermatogonium and primary spermatocytes) and densityof spermatogenic cells in rats tubulus seminiferous.Obtained data were analyzed using ANAVA(α = 0.05) andDuncan (α = 0.05). The results showed that dose of 10,500mg/kg bw in mice was the best dose in improving testisweight, sperm quality the number of spermatogenic cellsand density of spermatogenic cells in rats tubulusseminiferous (P> 0.95). U. baileyi functions as anantioxidant that can counteract the free radical activity of agiven lead acetate on spermatogenesis.

Antioxidants, lead acetate, steeping, spermatogenesis, Usneabaileyi

EO-09A flooded rice, a solution for degradation forest ina concession forest area of Central Kalimantan,IndonesiaFujiasi Asih♥, Nurul Hidayati, Pienyani RoshawantiDepartment of Agrotechnology, Faculty of Agriculture and Forestry,Universitas Muhammadiyah Palangkaraya. Jl. RTA Milono Km 1, 5,Langkai, Pahandut, Kota Palangkaraya 73111, Central Kalimantan,Indonesia. Tel.: +62-536-3222184, ♥email: sitimararil@gmail.com

Indonesia is the largest tropical peatland in Southeast Asiamostly spread on the islands of Sumatra, Kalimantan, andPapua. To take advantage of degraded peatlands is noteasy, but we need a technology to solve and protect theenvironment.Restoration of peatlands using simple floating rafttechnology prevents the destruction caused by land clearingbut is not managed so that the existing habitat in theenvironment becomes extinct and damaged. Based onwhere we conducted the research at the location of PT.Hutan Amanah Lestari, Central Kalimantan, Indonesia. Thelocation is quite dominant as a container in conductingresearch and peat conditions are good. The results of thisstudy explain that peat swamp land can be managedintensively for agriculture with rice crops proportional toplanting paddy fields.

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9082

Floating raft method, peat swamp land, rice

EO-10The contribution of mathematics to the field ofconservation biologyMeksianis Z. Ndii1,♥, Nursanti Anggriani1, Asep K.Supriatna2

1Department of Mathematics, Faculty of Sciences and Engineering,Universitas Nusa Cendana. Jl. Adisucipto, Penfui-Kupang, Lasiana,Kelapa Lima, Kota Kupang y, East Nusa Tenggara, Indonesia. Tel.: +62-380-881085, ♥email: meksianis.ndii@staf.undana.ac.id2 Department of Mathematics, Faculty of Mathematics and NaturalSciences, Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21Jatinangor, Sumedang 45363, West Java, Indonesia.

Biodiversity conservation is a complex problem and acentral issue in sustainable science. The problems ofbiodiversity conservation are exacerbated by theenvironmental changes such as climate change. Owing toits complexity, it requires interdisciplinary approaches toaddress the problems. One of the fundamental approachesis the use of mathematical methods such as matrix, linearprogramming, and others. These methods are notnecessarily applicable to all problems in biodiversityconservation. As in science, the methods are applicablewhen the philosophy underlying the problems is similar tothat of the mathematical methods. In this paper, asystematic review of the use of mathematical methods inbiodiversity conservation is presented. We providemathematical methods and their related problems as to givea clear picture regarding mathematical methods and theirappropriate problems in biodiversity. This paper providesnew insights for scientists and hence they can chooseappropriate mathematical methods to address the problemsin biodiversity.

Biodiversity, conservation, mathematical methods

EO-11Effect of various encapsulant material on viabilityof probiotic Leuconostoc mesenteroides as antiHelicobacter pylori agentSri Rejeki Rahayuningsih♥, Ratu Safitri, Nia Rossiana,Poniah AndayaningsihDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥email:sri.rejeki@unpad.ac.id

Probiotic bacteria Leuconostoc mesenteroides able to act asan anti-Helicobacter pylori when viability is high (107-109CFU/g) in the acidic digestive tract being shielded by theencapsulant. The purpose of this study was to determine theeffect of various encapsulation material on the viability ofthe bacteria L. mesenteroides before and after treatmentwith the method of encapsulation extrusion and dried with

spray drying. The study was conducted with descriptiveexplorative experimental methods, variables are L.mesenteroides and encapsulant materials composed ofcalcium alginate 3%, skimmed milk 10% and 15% as wellas a mixture of calcium alginate 3%-skimmed milk (10%and 15%), the observed parameters L. mesenteroides ispositive cells encapsulated, viability before and afterencapsulation at storage temperatures of 4ºC and 37ºC fortwo weeks. The result of observations after treatmentencapsulation and storage for two weeks at 4ºC and 37ºC,respectively viability of L. mesenteroides is lowest withcalcium alginate 3% encapsulant is (3.8 x 10 7), (3.3 x 10 7)and (12,3 x 10 7), while the highest viability withcombination of calcium alginate 3%-15% skim milkencapsulant is (7.4 x 10 7), (6.5 x 10 7) and (14.3 x 10 7) onthis basis can be concluded that the level L. mesenteroidesencapsulant survival with calcium alginate 3% is 58.5%,while the combination of calcium alginate 3%-15% skimmilk encapsulant is 77.9%.

Encapsulant, Helicobacter pylori, Leuconostocmesenteroides, probiotics, viability

EO-12Captive breeding and restocking in a conservationmodelMeksianis Z. Ndii1,♥, Asep K Supriatna2

1 Department of Mathematics, Faculty of Sciences and Engineering,Universitas Nusa Cendana. Jl. Adisucipto, Penfui-Kupang, Lasiana,Kelapa Lima, Kota Kupang y, East Nusa Tenggara, Indonesia. Tel.: +62-380-881085, ♥email: meksianis.ndii@staf.undana.ac.id2 Department of Mathematics, Faculty of Mathematics and NaturalSciences, Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21Jatinangor, Sumedang 45363, West Java, Indonesia.

This paper develops a mathematical model of theinteraction among industrialization, forest biomass, andprotected animals. We assume that the underlying systemconsists of three populations (the biomass) which have twoage classes: the immature and the mature classes. Anindustry utilizes the mature tree as a source (raw material)of its industrial process. Meanwhile, the mature tree is alsoneeded by the protected animal to live. We model thisprocess as a system of differential equation with fourcompartments (immature tree, mature tree, protectedanimal, and industry). In general, for certain conditions,there is a coexistence equilibrium of the industry, biomass,and protected animal. The stability requirements of theequilibrium point are given and the bionomic equilibriumcan also occur in several respects. However, in some casesthe density of the animals is decreasing due to a highexploitation of mature tree by industry. A model to increasethe number of protected animal population is developed, byassuming captive breeding and restocking the animal to thewild. The study shows that captive breeding and restockingplays an important role in sustaining the protected animalin the system without ignoring any industries that utilizethe forest biomass.

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 83

Animal protection, bionomic equilibrium, mathematicalmodel

EO-13Changing of polyaromatic hydrocarbon (PAH)compound by Pseudomonas aeruginosa on oilsludge biodegradationNia Rossiana1,♥, Mia Miranti1, Fauziah Nurhusnayain1,Yayat Dhahiyat2

1Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:niarossiana@yahoo.com2 Faculty of Fisheries and Marine Science, Universitas Padjadjaran. Jl.Raya Bandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang45363, West Java, Indonesia

Oil sludge as we know is one of hazardous petroleum wastethat makes a particular concern in the environment. Besideof Polyaromatic Hydrocarbon (PAH), oil sludge consists ofseveral heavy metals, Total Petroleum Hydrocarbon thatcan inhibit growth and development of plants and anotherorganism. Pseudomonas aeruginosa is one of the bacteriagenera isolated from Balongan oil sludge and known canproduce biosurfactants, degraded PAH and tolerant inheavy metal stress. This research was done to get profiletowards change in the level of TPH and PAH compound inoily sludge biodegradation which is conducted by P.aeruginosa. Biodegradation process had been carried outby using solid state fermentation method for 15 days byadding 10% bacterial starter from 100 g total weight offermentation medium. Parameters observed involve TPHlevel which measured by using the Gravimetric method,PAH compound which analyzed by using GC/MS method,and fungal growth profile which counted by using TPCmethod. The results of this study showed that TPH levelwas decreased Biodegradation process had been carried outby using solid state fermentation method for 15 days byadding 10% fungal starter from 100 g total weight offermentation medium. Parameters observed involve TPHlevel which measured by using the Gravimetric method,PAH compound which analyzed by using GC/MS method,and bacterial growth profile which counted by using TPCmethod. The results of this study showed that TPH levelwas decreased 4,36%, from 25,24% to 17,89%.The PAHcompound changes from 5 compounds on 0th day thatconsist of pyrene, chrysene, benz[A]azulene, phenanthrene,and anthracene into 4 compounds on 15th day, that were:naphthalene. benz[A]azulene, phenanthrene, andanthracene.

Biodegradation, oily sludge, PAH, Pseudomonas aeruginosa

EO-14The role of gelatin hydrolysate from pygostyle ofbroiler by through enzymatic hydrolysis processAspergillus niger to prophylaxis of osteoporosiswhite rat (Rattus norvegicus)Yasmi Purnamasari Kuntana1,♥, Roostita Balia1, SayutiMurad1, Yuli Astuti Hidayat2

1Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:y.purnamasari@unpad.ac.id2Department of Animal Products Technology, Faculty of AnimalHusbandry, Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21,Hegarmanah, Jatinangor, Sumedang 45363, West Java, Indonesia

The pygostyle of the broiler is a cartilage tissue containingcollagen, a mucoprotein being a plasma expander. Thehydrolysis process of collagen by enzymatic is producedgelatin hydrolysate with different from commercial gelatinbecause it has an amino acid composition with low averagemolecular weight. It becomes an advantage because it canbe directly absorbed by the digestive tract. In addition, theenzymatic process does not take long and the high cost andenvironmentally friendly. This process can be assisted byAspergillus niger, i.e., microorganisms are safe (GRASS).A. niger has a protease enzyme that can digest collagen intogelatin hydrolysate. The enzyme is extracellularly removedso that its utilization does not require high input valueexpenditure. Gelatin hydrolysate can reduce the disease ofosteoporosis. This study is to obtain a new finding ofchicken bones which it has never been used by researchersto become a functional product namely gelatin hydrolysatewith processed enzymatically by A. niger in a very simpleway but produce benefit product for the Ummah. Thespecific targets are found the amount of gelatin hydrolysateprecisely eliminate osteoporosis of rat (Rattus norvegicus).The experimental research was conducted in the laboratorywith descriptive experimental using complete randomizeddesign with 5 treatment and 5 replication. PDB dose 0,5mL/g rat BW (P1 as a negative control), CCl4 dose 0,14mL/g rat BW (P2 positive control), gelatin hydrolysatedose 0,25; 0,5; 0,75 mL/g rat BW (P3-P5). The parametersare body weight and histologic observation ofmusculoskeletal tissue including measurement of muscle,cartilage and collagen bundle diameter. The test animalused was male white rat Wistar strain aged 2-3 months withbody weight 185-200 g. Data were analyzed usingANAVA and Duncan test. The result showed that theproper dosage of gelatin hydrolysate to prevent damage ofmusculoskeletal tissue and eliminates osteoporosis in therat is a dose of 0.5 mL/g BB rat. The conclusion is gelatinhydrolysate as an environmentally friendly product servesas a prevention of immunodeficiency and degenerativediseases such as osteoporosis.

Aspergillus niger, broiler, gelatin hydrolysate, osteoporosis,pygostyle, rat

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9084

EO-15Antimicrobial potency from endophytic bacteria ofbignay plant (Antidesma bunius) againstpathogenic bacteriaIda Indrawati♥, Nia Rossiana, Anditafitrimutiara Rizki,Poniah AdyaningsihDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥email:ida.indrawati81@gmail.com

The purpose of this research is to know the antibacterialpotency of Bignay's plant (Antidesma bunius L.)endophytic bacteria against pathogenic bacteria, that isGram-negative bacteria i.e Salmonella typhimurium ATCC14028, Escherichia coli ATCC 35218 and Gram-positivebacteria i.e. Staphylococcus aureus ATCC 6538. Thisresearch used the descriptive method, that consist ofendophytic bacterial isolation, identification, andantimicrobial test. Endophytic bacterial isolation from fruitand stem of Bignay plant is performed by using pour platemethod. Identification of endophytic bacteria is performedby a biochemical test method which is using Vitek. Theantimicrobial test is performed by using paper discdiffusion method. The result is endophytic bacteria isolatedfrom fruit and stem of Bignay plant is Bacillus pumilus,Bacillus amyloliquefaciens, Bacillus cereus, Bacillus sp.1,danBacillus sp.2. The most potential endophytic bacteria asan antimicrobial against pathogenic bacteria is Bacilluspumilus, Bacillus sp.1, and Bacillus sp.2.

Antibacteria, Antidesma bunius, endophytic, Gram stain

EO-16Potential use of kangkong seed (Ipomoea aquatica)as alternative feed to increase quail egg production(Coturnix-coturnix japonica)Astuti Kusumorini1,♥, Miftah Nurfarid1, Ana Rochana2,Rachmat Wiradimadja2, Ramadhani Eka Putra3

1Department of Biology, Faculty of Science and Technology, UIN SunanGunung Djati of Bandung. Jl. A.H. Nasution No.105 Cigending, UjungBerung, Bandung City 40611, West Java, Indonesia. Tel.: +62-22-7800525, ♥ email: astutikusumorini@gmail.com2 Faculty of Animal Husbandry, Universitas Padjadjaran. Jl. RayaBandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363,West Java, Indonesia3School of Life Sciences and Technology, Institut Teknologi Bandung.Labtek XI SITH-ITB, Jl. Ganesa 10, Lebak Siliwangi, Coblong, BandungCity 40132, West Java, Indonesia. Tel.: +62-22-2511575

Indonesia as a mega-biodiversity country is a greatopportunity for the availability of poultry feed ingredients.One of the new feed ingredients that are interesting to bestudied is the utilization of agricultural waste as animalfeed. Kangkong or water spinach seed (Ipomoea aquaticaForssk.) is a waste factory seed that is cheap and does notclash with human interest, potentially as alternative feedwith protein content 13.46%, metabolic energy content

2826 kcal/g is good enough to be used as substitution ofbran or coconut cake in feed poultry. This research wasaimed to study the addition of kangkong seed meal in thediet on egg production of quail (Coturnix-coturnixjaponica), and was conducted in Department of Biology,Faculty of Science and Technology, UIN Sunan GunungDjati of Bandung, West Java, Indonesia. Two-hundredlayer quails of 7 weeks old were divided into 4 treatmentgroups with 5 replications and 12 quails of each. The quailswere raised during one month. The treatment were R1 (dietwithout kangkong seed meal), R2 (diet contained 5%kangkong seed meal), R3 (diet contained 10% kangkongseed meal), and R4 (diet contained 15% kangkong seedmeal). The research used Completely Randomized Design.The data were analyzed using ANOVA and any significantdifference was further tested using Duncan's multiple rangetest. The results showed that the addition of kangkong floursignificantly influenced the consumption of feed andenergy. The highest egg production was achieved attreatment R3 61.90% and lowest was R4 treatment 39.95%.The results concluded that the addition of kangkong seedmeal could be used up to the level of 10%.

Egg production, feed consumption, kangkong seed meal,quail

EO-17Effectiveness of subculture Helicoverpa armigerapolyhedrosis virus (HaNPV1) formulation indry powder and carrier by water, talcum, andcornstarchMia Miranti♥, Melanie, Rizka Kusuma PutriDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:mia.miranti.rustama@unpad.ac.id

Subculture Helicoverpa armigera Nuclear PolyhedrosisVirus (HaNPV1) isolated from the cadaver of Helicoverpaarmigera larva which production in Spodoptera lituraFabricius as an alternate host. It is potential as a microbialagent to control a population of insect pest in horticultureplant. Part of HaNPV1 dried within 25oC, and some othermixed in water, talcum (an organic carrier) and cornstarch(organic carrier) carrier to make a virus formulation. Thevirus formulation infected to third instars S. litura larvae.The research method was Randomized Block Design withone factor (Dried powder of HaNPV1, HaNPV1 in water,talcum and cornstarch carrier) and six replications. Theconcentration of virus in the formulation was 4 x 107polyhedral/mL suspension or gram powder. Larval infectedwith the orally method. The results showed that all of theHaNPV1 formulations caused mortality against larvae of S.litura up to 100%. The food consumption of S. litura larvaethat infected by all formulations HaNPV showed anincrease of between 0.313 g/larvae/day (in talcumformulation) to 0.383 g/larvae/day (in water formulation).The food consumption of infected larvae tends to increase

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 85

compared to the food consumption of healthy larvae. Theweight of infected larvae showed a mechanism ofdefending against viral infection. The lethal time ofinfected larvae with all of HaNPV1 formulations ranged onaverage from 6.35-8.75 days

Insect pest, HaNPV1, Helicoverpa armigera, virus

EO-18Chitosan application effect on plant growth andthe existence of stunting disease in pepper seedlingEmerensiana Uge1,♥, Sri Sulandari2, Sedyo Hartono2,Susamto Somowiyarjo2

1Program of Phytopathology, Department of Plant Pests and Diseases,Faculty of Agriculture, Universitas Gadjah Mada, Jl. Flora No. 1,Bulaksumur, Caturtunggal, Depok, Sleman 55281, Yogyakarta, Indonesia.Tel.: +62-274-563062, ♥email: rensi.uge23@gmail.com2Department of Plant Pests and Diseases, Faculty of Agriculture,Universitas Gadjah Mada, Jl. Flora No. 1, Bulaksumur, Caturtunggal,Depok, Sleman 55281, Yogyakarta, Indonesia.

Pepper (Piper nigrum L.) is an important plantation crop inIndonesia. Some pathogens have known infected thepepper plants including fungi, nematodes, and viruses. Thestunting disease of pepper plants has known caused byCucumber Mosaic Virus (CMV). This virus can be carriedby vegetative propagation material of plants. Many ways tocontrol the virus either is by inducing plant resistance.Chitosan is a natural biopolymer that beneficial reduce theseverity and incidence of disease and stimulate plantgrowth. The aim of this study is to determine the inhibitoryability stunting mosaic virus infection on pepper seedlingsfrom cutting using chitosan solution by sprayingapplications. Chitosan treatments were done inconcentration of 0.5%, 0.75% and 1%. The result showedthat application of chitosan at all concentrations affect thepercentage decrease disease incidence and intensity andimprove plant growth. In each concentrations treatment ofchitosan was not significantly different on all parameters ofobservation, but significantly different to controls. Thehighest percentage decrease in incidence was atconcentration 0.75% chitosan by difference 58.794%,while the highest percentage decline in intensity at 1%chitosan by difference 64.802%. Application of chitosanalso significantly affected to all parameters of plant growtheither plant height or number and diameter leaf.Application of chitosan 1% increase plant growth betterthan other treatments, with the increase of plant height11.87%, number of leaves 9.2% and leaves diameter2.5%.

Chitosan, pepper, stunting mosaic disease

EO-19Microalgae Haematococcus pluvialis protectagainst naphthalene-induced cataract formation inmice lensAgus SalimDepartment of Biology, Faculty of Science and Technology, UIN SunanGunung Djati of Bandung. Jl. A.H. Nasution No.105 Cigending, UjungBerung, Bandung City 40611, West Java, Indonesia. Tel.: +62-22-7800525, ♥ email: agus.salim@uinsgd.ac.id

Cataract is one of the most important leading causes ofblindness in the world. Extensive research showed thatoxidative stress might play an important role in theinitiation and progression of a cataract. Still today exceptfor surgery no other effective treatment have beensuccessfully developed so far, risk factors along withpossible pharmacological prevention and animal modelswhich are widely used for screening anticataract activity.The present microalgae Haematococcus pluvialis whichhave been evaluated pharmacologically for the treatment ofcataract. Cataract preventive action of H. pluvialis wasevaluated against naphthalene-induced cataractexperimental models in mice at dose 0.5 mg/kg weightbody/day p.o and vitamin E was used as a referencestandard. Biomass H. pluvialis treated animals showed noopacification in the lens and they also showed significantlyincreased level soluble proteins and water content ascompared to positive control group in the lens of animalmodels. Cataract preventive action of H. pluvialis may bedue to be antioxidant and free radical scavenging activity.

Anticataract, Haematococcus pluvialis, mice lens,naphthalene

EO-20Viability of Lactobacillus bulgaricus, Lactobacillusacidophilus and Saccharomyces cerevisiae beforeand after spray-drying in maltodextrinYuli Andriani1,♥, Ratu Safitri2, Sri RejekiRahayuningsih2

1 Faculty of Fisheries and Marine Science, Universitas Padjadjaran. Jl.Raya Bandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang45363, West Java, Indonesia. Tel.: +62-22-87701519, Fax.: +62-22-87701518, ♥ email: yuliyusep@yahoo.com2Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia.

The viability of the microbes in the carrier material is oneof the testing phase conducted on probiotic candidates forshrimp feed of Vanamei (Litopenaeus vannamei (Boone,1931). The purpose of this study was to determine theviability of Lactobacillus bulgaricus, Lactobacillusacidophilus and Saccharomyces cerevisiae in maltodextrinto be used in vannamei shrimp feed. The research usesdescriptive method experimentally in laboratory scale

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9086

consists of two stages. The first stage is the viability of L.bulgaricus, L. acidophilus and S. cerevisiae before thespray drying process. The second stage includes theviability of L. bulgaricus, L. acidophilus and S. cerevisiaein the storage period of 0, 2 and 4 weeks after the spraydrying process. The measured parameter was the viabilityof probiotics on a maltodextrin. Viability or population ofbacteria that live in the medium maltodextrin using TotalPlate Count (TPC). The result showed that the microbialpopulation decreases with storage time. S. cerevisiae hasearly population 2.4 x 1013 CFU and able to survive until4th week with a population of 1.2 x 1013 CFU, L.acidophilus has an early population as 1.86x1013 CFU andpopulation of 1.14x1013 CFU in the 4th week. Meanwhile,L. bulgaricus had an early population of 1.31 x 1014 CFUand survived until 4th week 4 with a population of 2.04 x1014 CFU. Based on these, it concluded strain L.bulgaricus, L. acidophilus and S. cerevisiae survived inmaltodextrin and met the requirements to be used as aprobiotic microbe.

Maltodextrin, probiotics, spray-drying, Total Plate Count,vannamei

EP-01In vitro screening of potential probiotic lactic acidbacteria from Indonesian fermented foodGunawan Priadi♥, Fitri Setiyoningrum, Fifi Afiati,Rohmatusholihat, Puspita LisdiyantiResearch Centre for Biotechnology, Indonesian Institute of Sciences.Cibinong Science Center, Jl. Raya Bogor Km 46 Cibinong-Bogor 16911,West Java, Indonesia. Tel. +62-21-8754587, Fax. +62-21-8754588,♥email: igoen_neogi14@yahoo.com

Indonesia has a rich variety of fermented foods. Thecontent of lactic acid bacteria in the food can provide apositive effect on digestive health as a probiotic. Lack ofinformation about the characteristics of the native lacticacid bacteria caused the least use of it to become functionalfood product. The purpose of this study was in vitroselection of isolated potential probiotics lactic acidbacteria. Lactic acid bacteria isolated from pickle andcassava tape (Yogyakarta), terasi (Bali) and terasi (Solok,West Sumatra). Lactic acid bacteria were tested for itsprobiotic properties, i.e. acid and bile salt tolerance assay,coagulation test, hydrophobicity test and adhesion test.Probiotics were obtained if lactic acid bacteria passed alltests. The results showed, there were five probioticbacteria, that is Lactobacillus plantarum from pickle(Yogyakarta), L. plantarum and Leuconostocmesenteroides from cassava tape (Yogyakarta) L.plantarum from terasi (Bali), and L. plantarum from terasi(Solok)

Fermented foods, lactic acid bacteria, probiotic, probioticproperties

EP-02Different levels of the fermented yellow corn mealin diets for jelawat, Leptobarbus hoevenii BleekerHendry Yanto1,♥, Junianto2, Rita Rostika2, YuliAndriani2, Dedi Jusadi3

1Department of Aquaculture, Faculty of Fisheries and Marine Sciences,Universitas Muhammadiyah Palangkaraya. Jl. RTA Milono KM 1, 5,Langkai, Pahandut, Kota Palangkaraya 73111, Central Kalimantan,Indonesia. Tel.: +62-536-3222184, ♥email: hendry_fpikump@yahoo.co.id2 Department of Fisheries, Faculty of Fisheries and Marine Science,Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21,Hegarmanah, Jatinangor, Sumedang 45363, West Java, Indonesia. Tel.:+62-22-87701519, Fax.: +62-22-87701518, email: anto_lisc@yahoo.com,ritarostika_unpad@yahoo.com, yuliyusep@yahoo.com3 Department of Aquaculture, Faculty of Fisheries and Marine Sciences,Institut Pertanian Bogor. Jl. Lingkar Akademik, Kampus IPB Darmaga,Bogor 16680, Indonesia, email: siflounder@gmail

This research aimed to determine the optimum level offermented yellow corn meal in diets to improve thedigestive enzyme activity, material digestibility coefficient,growth and feed efficiency for jelawat, Leptobarbushoevenii Bleeker. The experimental treatments respectivelyused the fermented yellow corn meal level of A1 (10%),A2 (20%), A3 (30%), A4 (40%), and two control groups ofA5 (10% unfermented yellow corn meal) and A6(commercial diet). The experimental diets with the sameprotein (isonitrogenous) and energy (isocaloric) were givento jelawat with an average size of 32.51±0.21 g per fish.The results showed that α-amylase activity and digestibilitycarbohydrate value of the fermented yellow corn flourincreases along with the increasing feed levels. Protein andlipid of the body, retention of protein and lipid, dailygrowth rate and feeding efficiency were significantlydifferent from each treatment (P<0.05). The fermentedyellow corn meal containing a level of 30% in the diet wasthe best for jelawat with an optimum level of 28.21-32.28%for the growth performance and feed efficiency of jelawat.

Digestibility coefficient, enzyme activity, fermentation,Leptobarbus hoevenii, yellow corn meal

EP-03The palatability of cajuput leaves waste as thesubstitution feed of sheepAna Widiana1,♥, Deydra Fitria Nur1, Iman Hernaman2

1Department of Biology, Faculty of Science and Technology, UIN SunanGunung Djati of Bandung. Jl. A.H. Nasution No.105 Cigending, UjungBerung, Bandung City 40611, West Java, Indonesia. Tel.: +62-22-7800525, ♥ email: anawidiana@hotmail.com2 Faculty of Animal Husbandry, Universitas Padjadjaran. Jl. RayaBandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363,West Java, Indonesia

Currently, distillery waste of cajuput leaves (Melaleucacajuputi Powell) at BKPH Jatimunggul, Indramayu, WestJava, Indonesia has not been handled properly and becomepollution. The waste of cajuput leaves is known potential asa cattle feed. One of the technologies use organic waste as

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 87

feed is made in the form of pellets. The purpose of thisresearch is to know the potential of waste cajuput leavesand grass field with the addition of concentrates in the formof pellets through physical testing and its palatability onsheep. This study conducted on October 2015-January2016 at the Laboratory of Animal Nutrition, Faculty ofAnimal Husbandry, Universitas Padjadjaran, West Java,Indonesia and at community animal husbandry inPangalengan, Bandung, West Java, Indonesia. Theexperimental design used completely randomized designwith 3 treatments and 3 repetitions. The ration of treatmentconsist R1 (50% field grass + 50% concentrate), R2 (25%field grass + 25% waste of cajuput leaves + 50%concentrate), and R3 (50% of waste of cajuput leaves +50% concentrate). The data were analyzed by ANOVAfollowed by Duncan Multiple Range Test. The resultsshowed that R2 has the best level of palatability andpotential as livestock feed because nutrients content in itswaste is qualified to SNI 3148.1: 2009 standard for animalfeed and best impact resistance is the pellets R3 that isequal to 96%.

Cajuput leaves, organic waste, pellets, palatability

EP-04Effects of organic fertilizer and plant spacing onearly-medium maturity soybeanHenny Kuntyastuti♥, Sri Ayu Dwi Lestari, SutrisnoIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8 Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: estawinasa@gmail.com

Efforts to increase soybean productivity must be synergywith the improvement of soil fertility through fertilizer,especially organic fertilizer. The population density of acrop determines to a greater extent its performance in termsof growth and yield soybean. The objective of this researchwas to obtain organic fertilizer management techniques thatcan support the development of early-medium maturitysoybean (Local Central Java soybean lines/Sinabung-1036)to achieve 3 tons dry seed per hectare. The research wasconducted in Alfisol soil Muneng Station Research,Probolinggo, East Java, Indonesia and in Entisol soilGenteng Station Research, Banyuwangi, East Java on thedry season (DS) 2012. The experiment used split-plotdesign with three replications. As the main plot was plantspacing, namely: 1) 40 cm x 10 cm, 2 plants/hole, 2) 40 cmx 15 cm, 2 plants/hole, 3) 40 cm x 20 cm, 1 plant/hole, and4) 40 cm x 20 cm, 2 plants/hole. As the sub-plots were fourdoses and types of organic fertilizer, namely: 1) withoutorganic fertilizer, 2) 2.5 t manure/ha, 3) 5 t manure/ha, and4) 2 t nutrient rich organic fertilizer/ha. The results showedthat there was no effect of organic fertilizer and interactionbetween two factors. This result suggested that plantspacing played a significant role in increasing soybeanyield.

Local Central Java soybean lines, organic fertilizer, plantdensity, Sinabung-1036

EP-05Topical treatment for streptozotocin-induceddiabetic mice with ointment based on djenkol(Archidendron pauciflorum) fruit peel extractDesak Made Malini♥, Fitri Kamilawati, Madihah,Johan IskandarDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:desak.made@unpad.ac.id

Diabetic wounds lead to severe tissue damage and difficultto cure. One alternative medicine that was used by localIndonesian communities to treat diabetic wounds was thefruit peel of djenkol (Archidendron pauciflorum (Benth.)I.C. Nielsen). This study aimed to observe the ability ofointment based on ethanol extract of djenkol’s fruit peel onskin histological appearance of streptozotocin-induceddiabetic mice (Mus musculus L., 1758). Diabetes mellituswas induced by intraperitoneal injection of streptozotocin(180 mg/kg BW). Twenty of diabetic mice were woundedat the dorsolateral region along ±1.5 cm using sterilescissors and then divided into five groups of four animalseach. The ointment was applied topically at 5, 10 and 15%as well as Betadine® twice a day for 14 days. For negativecontrol, ointment basis was applied to the wounded mice.The results showed that topical application of ointmentbased on ethanol extract of djenkol’s fruit peel atconcentration 10% was significantly recovered thewounded skin by accelerated re-epithelization, narrowedgranulation tissue, increased the capillary number andcollagen density than other treatments (p<0.05), whichwere comparable to negative control group. It wasconcluded that the topical application of ointment based onethanol extract of djenkol’s fruit peel can support thehealing of diabetic wounds.

Capillary number, collagen density, re-epithelization,djenkol fruit peel, granulation tissue, skin histologicalappearance

EP-06Host preference of Bemisia tabaciBedjoIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8 Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: bj_yulismen@yahoo.co.id

Bemisia tabaci (Gennadius) is one of the most importantpests of soybean crops in Indonesia. B. tabaci attack a widerange of crops and as a vector of the virus. The study aimedto obtain potential hosts that could be used as trap crops tocontrol B. tabaci in soybean. This research was conducted

ABS MASY BIODIV INDON, Bandung, 20-21 May 2017, hal. 49-9088

at Entomology Laboratory and a Green House of ILETRI,Malang, East Java, Indonesia during the dry season in2016. The potential host plants were planted in pots, thenplaced in screen cages. After the plant high had reached 30cm as many as, 500 imagoes of B. tabaci were infested forfive days, then they were removed. This study wasarranged in a Randomized Block Design with threereplications. The eight potential host plants were testednamely: pumpkin, cucumber, sweet potatoes, green beans,cassava, peanuts, soybeans, and eggplant. As parameterswere the number of imagoes, eggs, and nymphs in eachtreatment. The results showed that B. tabaci had varioushost preferences. Of eight of potential hosts observed, theleaves of red pumpkin, eggplant, and cucumber were thepreference of B. tabaci of oviposition. Therefore, thesethree host plants can be used as trap crops.

Bemisia tabaci, host plant, population, soybean

EP-07Avocado paste as fat substitute in ice creamErvina1, Eliyano Abdillah1,2♥, Iwan Surjawan1

1Indonesia International Institute for Life Sciences (i3L). Jl. PulomasBarat Kav. 88, Jakarta Timur 13210, Jakarta, Indonesia. Tel.: +62-21-29567888, 29567899, ♥email: e.abdillah@has.student.nl2 HAS University of Applied Sciences. Onderwijsboulevard 221, 5223 DE's-Hertogenbosch, The Nederland. Tel.: +31-88-890 3600

The preference towards plant-based diet has increased andbecome more inclusive of personalized nutrition plans forthe consumers. They also prefer to adopt a plant-based dietfor healthy and sustainability reason. Dairy productsconsist of high saturated fatty acids and if over-consumedcan lead to increased risk of cardiovascular diseases.Avocado fruits contain high fat dominated by MonoUnsaturated Fatty Acids (MUFA) and phytosterol whichmight be a good source in substituting saturated dairy fat inice cream. The objective of this study was to analyzephysicochemical, rheological, and sensorial properties ofice cream that has been substituted with differentconcentrations of avocado paste of 0%, 25%, 50%, 75%and 100% respectively against dairy fat to achieve a highquality of non-dairy fat ice cream. Overrun, viscosity, totalsoluble solids, brix value and total fat were determined.Sensorial characteristics of the substituted ice cream wereinvestigated by trained panelist and continue by using 60consumers to rate sensory quality of ice cream (appearance,hardness, melting properties, creaminess, airiness,sweetness, bitterness, flavor and overall liking). Based onANOVA there were significant differences (p<0.05) foroverrun, viscosity and total soluble solids of ice creamsubstituted with different avocado paste concentrations.The addition of avocado paste leads to an increasedviscosity and hardness significantly (p<0.05) wherecreaminess and airiness were perceived the same (p>0.05).The sensory evaluation showed there were significantdifferences (p<0.05) for the intensity of color, hardness andtaste and flavor of ice cream. Textural characteristics such

as melting properties, creaminess and airiness did not showsignificant differences (p>0.05) while the substitution of50% avocado paste was the most preferred among thepanelist. Total fat between the formulations showed nosignificant difference (11.5 g/100g), which makes avocadoa good plant-based fat alternative to substitute dairy fat inice cream.

Avocado, ice cream, MUFA, plant-based diet, sensorial andrheological

EP-08Hematological effect of sappan wood (Caesalpiniasappan) extract tablet on iron overload conditionof ratsKenti Prahmanti1,♥, Desak Made Malini2, LelaniReniarti3, Ratu Safitri2

1Program of Biotechnology, Graduate School, Universitas Padjadjaran. Jl.Dipati Ukur No.35, Bandung City 40132, West Java, Indonesia. Tel./Fax.:+62-22-2504970, ♥ email: kenti88@gmail.com2Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia3Faculty of Medicine, Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363, West Java,Indonesia

Research of iron chelation ability on sappan wood(Caesalpinia sappan L.) extract tablet of rats (Rattusnorvegicus L.) on iron overload condition aims to obtainoptimum dose sappan wood extract (CSE) tablet effectiveas iron chelator herbal. The research was performed using acompletely randomized design (CRD) to 27 rats femaleWistar 8 weeks old with an average weight of 200 g.Research is divided into 9 treatments with 3repetitions.Negative control (KN1), the control formula(KN2), Tablet of sappan wood extract (CSE) dose of 100mg/kg bw/d (P1), dose of 200 mg/kg bw/d (P2), dose of300 mg/kg bw/d (P3), dose of 400 mg/kg bw/d (P4), asatellite group (P5), deferiprone dose of 75 mg/kg bw/d(P6). Data were statistically analyzed using completelyrandomized design (CRD)) level of 95% (α = 0.05), if thereis a significant difference, then followed with the Duncanmultiple comparison tests. The results showed that thesappan wood extract tablet is in the normal values range ateach measurement of the blood parameter. It indicates thatadministered of sappan wood extract tablet only binds theexcess of the iron body and does not destabilize of theerythrocyte.

Caesalpinia sappan, iron chelation, thalassemia

EP-09Iron chelating activity of Caesalpinia sappanextract in tablets dosage form on iron overloadcondition of the rats

ABS SOC INDON BIODIV, Bandung, 20-21 May 2017, pp. 49-90 89

Ahmad Sazali1,♥, Ani Melani Maskoen2, NiningRatningsih3, Ratu Safitri3

1Program of Biotechnology, Graduate School, Universitas Padjadjaran. Jl.Dipati Ukur No.35, Bandung City 40132, West Java, Indonesia. Tel/Fax.+62-22-2504970, ♥ email: sazali.ahmad22@gmail.com2 Faculty of Dentistry, Universitas Padjadjaran. Jl. Raya Bandung-Sumedang Km 21, Hegarmanah, Jatinangor, Sumedang 45363, West Java,Indonesia3Departemen of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia

Research of iron chelating activity of Caesalpinia sappanL. extract in tablets dosage form on iron overload conditionof the rats aims to obtain an optimum dose of CSE tabletsthat effective as an herbal iron chelator. The research wasperformed using a completely randomized design (CRD) to27 rats female Wistar 8 weeks old with an average weightof 200 g. Research is divided into 9 treatments with 3repetitions. Negative control (KN1), the tablets controlformula (KN2), iron dextran dose of 60 mg/kg bw aspositive control (KP), CSE Tablets dose of 100 mg/kg bw(P1), dose of 200 mg/kg bw (P2), dose of 300 mg/kg bw(P3), dose of 400 mg/kg bw (P4), a satellite group (P5),deferiprone dose of 75 mg/kg bw (P6). Data werestatistically analyzed using analysis of variance (ANOVA)level of 95% (α = 0.05), if there is a difference thencontinued with the Duncan test. The results showed that theCSE tablets effective as iron chelator through decreasedferritin levels by 26.37%, Fe Serum level 29.16% and canincrease levels of transferrin by 102.27%. No significantlydifferences with deferiprone. CSE Tablets dose of 200mg/kg bw is the optimum dose effective as an iron chelatorof the rats (Rattus norvegicus L.) on iron overloadconditions. This is the lowest dose that has the samecapability as the largest dose.

Caesalpinia sappan, iron chelation, tablets, thalassemia

EP-10The use of Verticillium sp. and Lactobacillus sp. forfermentation of ramie (Boehmeria nivea) biomassto changes nutrients and parameters silageAsri Peni Wulandari♥, Cesilia Tiur Mariana Saragi, M.NurzamanDepartment of Biology, Faculty of Mathematics and Natural Sciences,Universitas Padjajaran. Jl. Raya Bandung-Sumedang Km 21 Jatinangor,Sumedang 45363, West Java, Indonesia. Tel.: +62-22-7797712, ♥ email:asri.peni@unpad.ac.id

High-quality forage feed for ruminants can be obtained byensilasing green wastes from decortication process of fiberindustry. This study aims to determine the optimummethod of processing green wastes with using inoculumVerticillium sp. in degrading ramie (Boehmeria nivea (L.)Gaud) wood chips and Lactobacillus sp. in silagefermentation process. The study is conducted byexperimental on a mixture of ramie leaves biomass (A)with ramie wood chips non-degraded (B) or ramie wood

chips degraded (C). There are 4 treatments in this study;(A+B) Lac-(mixture of biomass A + B), (A+B) Lac+(mixture of biomass A + B + Lactobacillus sp.), (A+C)Lac-(mixture of biomass A + C), (A+C) Lac+ (mixture ofbiomass A + C + Lactobacillus sp.). Descriptiveobservation shows that there are difference changes ofcolor, odor and texture of ramie biomass and also theemergence of fungal contaminants on any differenttreatments. By adding Lactobacillus sp. in ensiling canprevent contamination of spoilage fungi, maintain physicalcharacter of ramie biomass, and increases protein, organicmatter, digestibility and lactic acid levels. The best resultwas shown by experiment (A+C) Lac+ that has goodphysical quality, protein 23.01%, 22.71% organic matter0.15%, lactic acid, pH 6.4, VFA 117 m /M, 30.45% NDFand ash 13.16%.

Decortication wastes, ensiling, Verticillium, Lactobacillus

EP-11Effects of organic and inorganic fertilizers on theyield of early-medium maturity soybeanSri Ayu Dwi Lestari♥, Henny KuntyastutiIndonesian Legumes and Tuber Crops Research Institutes, Jl. RayaKendalpayak Km 8 Malang 65101, East Java, Indonesia. Tel.: +62-341-801468, Fax.: +62-341-801496, ♥email: estawinasa@gmail.com

Efforts to increase soybean productivity can be done withapplication of organic and inorganic fertilizers, thedevelopment of new varieties of early-medium maturitysoybean, large seeds, and high yield potential. Theapplication of organic fertilizer requires high doses to get apositive impact on soybean yield but is consideredinefficient regarding procurement and transportation,making farmers less interested. The addition of inorganicfertilizer or the use of nutrient rich organic fertilizer isexpected to be one way out. The objective of this researchwas to obtain organic and inorganic fertilizer managementtechniques that can support the development of early-medium maturity soybean (Lokal Jateng soybeanlines/Sinabung-1036) to achieve 3 tons dry seed perhectare. The research was conducted in Alfisol soilMuneng Station Research, Probolinggo, East Java,Indonesia and in Vertisol soil Ngale Station Research,Ngawi, East Java on the dry season (DS) 2012. Theexperiment used factorial randomized complete blockdesign with three replications. The first factor was fourdoses of organic fertilizer and the second factor was fourdoses combination of ZA, SP-36, and KCl. The resultsshowed that, on Alfisol soil Probolinggo, Lokal Jatengsoybean lines/Sinabung-1036 does not require additionalinorganic fertilizer to achieve 2.71 t/ha. On Vertisol soilNgawi, Lokal Jateng soybean lines/Sinabung-1036 need 2 tnutrient rich organic fertilizer/ha to increase yield from2.60 t/ha to 2.81 t/ha.

Local Central Java soybean lines, nutrient rich organicfertilizer, Sinabung-1036

THIS PAGE INTENTIONALLY LEFT BLANK