RESEARCH POSTER PRESENTATION DESIGN © 2012

www.PosterPresentations.com

Between the years of 2010 and 2014, there wereapproximately 1 to 2 million incidences of Denguefever in the Latin Americas [1]. The transmissionand subsequent outbreak of this disease isattributable to the Aedes aegypti mosquito—amajor vector of blood-borne pathogens (BBPs)such as the Dengue virus, along with theChikungunya, yellow fever, and Zika viruses [1,2]. The Ae. aegypti mosquito is an urban vectorthat thrives near populations of people. Bloodmeals acquired from vertebrate hosts in theseurban areas provide nutrients for female Ae.aegypti to complete the gonotrophic cycle andoviposition [3]. This opportune habitation enablespopulations of Ae. aegypti to reproduceuncontrollably and encourages the infection ofnearby vertebrate populations [1, 2]. Accordingly,controlling the reproduction mechanism of thevector population could be useful in impeding thespread of pathogens associated with this vector.Our approach examines the structures andbiochemical functions of the Ae. aegypti midgutserine proteases involved in blood meal digestion.By understanding these mechanisms, we canpotentially develop small-molecule inhibitors anddisrupt vector reproduction.

The Aedes aegypti mosquito is a major vector of blood-borne pathogens, such as the Dengue,Chikungunya, yellow fever, and Zika viruses. A female mosquito will often take several blood mealsin a single night to complete the gonotrophic cycle, effectively spreading any blood-borne pathogens itmay be infected with. Potentially useful in streamlining vector control strategies, our approachexamines the structures and functions of Ae. aegypti midgut serine proteases involved in blood mealdigestion. This poster discusses the recombinant expression and purification of a late-phase trypsin-like protease, Aedes aegypti serine protease VII (AaSPVII). Previous studies were unable to purifyAaSPVII with an N-terminal His6-tag because AaSPVII was found to be autocatalytic, often cleavingthe His6-tag upon recombinant bacterial protein expression. In this study, AaSPVII was, instead,cloned with a C-terminal His6-tag allowing for successful purification of the protein. In addition, weinvestigated chemical environments that appear to minimize the auto-degradation of AaSPVII uponpurification. So far, we have been able to solubly express the C-terminally His6-tagged AaSPVIIprotease and have been able to partially purify it using a nickel column. BApNA assays of the enzymeshow some enzyme activity. From here, we will further purify AaSPVII, conduct kinetic experiments,and compare our results with previous findings.

ABSTRACT

INTRODUCTION

Primers were designed with NdeI and XhoI restriction sites so that AaSPVII can be cloned intopET29b plasmid directly adjacent to the C-terminal His6-tag (Figure 2). A poly(A) tail was included ineach primer to prevent degradation. In the reverse primer, the stop codon was omitted because it isalready present in pET29b downstream of the His6-tag (Figure 3).

RECOMBINANTCLONING

AaSPVII plasmids were transformed into Shuffle® T7 Express Competent E. coli (New EnglandBiolabs, Cat #C3029H), suitable for T7 promoter-driven plasmids such as pET29b. These E. coli Bcells are engineered to help with protein folding by forming disulfide bonds within the expressedpolypeptide in the cytoplasm. The transformed cells were grown at 30 °C in Terrific Broth(ThermoFisher Scientific, cat #BP2468-2). During the logarithmic stage of growth (estimated byOD600 = 0.5–0.8), protein expression was induced with isopropyl-β-D-1-thiogalactopyranoside(IPTG), an analog of allolactose, utilizing the lac operon present in pET29b to express the insertedgene. Protein expression was sustained for 44 hours at 12 °C, stopping before AaSPVII begins to auto-catalyze. Cell paste was flash-frozen with liquid nitrogen and stored at -80 °C.

PROTEINEXPRESSION

FUTUREWORK

Other purification conditions that could potentially inhibit auto-digestion (i.e. pH, temperature) will be explored. Ion-affinity chromatography may be used to further purify partially-purified AaSPVII / pET29b based on its isoelectric point. Upon fully purifying AaSPVII, crystallization will help us identify its structure, and substrate binding assays will allow us to further characterize its enzymatic capability.

ACKNOWLEDGEMENTSWe would like to thank Dr. Jun Isoe and Dr. Roger L. Miesfeld (University of Arizona) for providingAe. aegypti cDNA, the AaSPVII group from Chem131B (San José State University) for their initialwork on the removal of the leader sequence, and James Nguyen (San Jose State University) for hisinitial work on the recombinant cloning and expression of AaSPVII with an N-terminal His6-tag. Thiswork is funded by the NIGMS/NIH SC3 under Award Number SC3GM116681.

REFERENCES1. Fernández-Salas I, et al. Historical Inability to Control Aedes aegypti as a Main Contributor of Fast

Dispersal of Chikungunya Outbreaks in Latin America. Antiviral Research 2015; 124: 30-42.2. Calvez E, et al. Genetic Diversity and Phylogeny of Aedes aegypti, the Main Arbovirus Vector in

the Pacific. PLoS Neglected Tropical Diseases 2016; 10: e0004374.3. Isoe J, et al. Molecular Genetic Analysis of Midgut Serine Proteases in Aedes aegypti Mosquitoes.

Insect Biochemistry and Molecular Biology 2009; 39: 903-912.

SanJoséStateUniversity,1WashingtonSquare,SanJosé,CA95112KamilleA.Parungao andAlbertoA.Rascón,Jr.

RecombinantExpressionandPurificationofAedes aegyptiMidgutSerineProteaseVII(AaSPVII)

PROTEINPURIFICATIONCrude AaSPVII was purified using a HisTrapFF nickel column (GE Healthcare LifeSciences, cat #17-5255-01). Dithiothreitol(DTT), a reducing agent, was added to theimidazole buffers to partially unfold theprotein by disrupting disulfide bonds.

AaSPVII / pET29b SHuffle® T7 cell paste wasresuspended in cold, buffer containing 10 mMimidazole + 250 mM NaCl + 20 mM Tris-HClpH 7.2 + 10 mM DTT. The resuspension wassonicated and centrifuged at 8 °C. Thesupernatant (crude lysate) was loaded on to theAKTA FPLC and purified starting with thelow-imidazole buffer (same as resuspensionbuffer) and eluting using a linear gradient ofhigh-imidazole buffer (500 mM imidazole +250 mM NaCl, 20 mM Tris-HCl pH 7.2 + 10mM DTT). Purified fractions were collected ina 1.5 mL 96-well plate. The fractionscontaining AaSPVII-Z / pET29b were pooledand buffer-exchange via dialysis in 50 mMsodium acetate pH 5.2 + 1 mM DTT at 4C.

From CDC: Surveillance and Control of Aedesaegypti and Aedes albopictus in the United States

From Shanghai Jiao Tong University School of Medicine: Pathogen Biology

FIGURE 1: Oocyte maturation in female Aedes aegypti that were fed with various concentrations of blood [3]. Blood meals are necessary in the completion of the gonotrophic cycle and the development of healthy oocytes.

Sequence(5’– 3’)Melting

Temperature(Tm)[°C]

Forward Primer AAAAACATATGCTATCAACCGGATTCCATCCGC 65.4

Reverse Primer AAAAACTCGAGAACTCCACTGACTTCGGCCACC 65.04

FIGURE 2: Primers used in AaSPVII PCR amplification into the pET29b vector. The resulting AaSPVII insert is 760 bp long. Melting temperature was obtained using NetPrimer.

FIGURE 3: pET29b plasmid cloning region (Novagen, cat #69872) showing restriction sites NdeI and XhoI (blue) and the His6-tag (green) directly at the C-terminus of the AaSPVII insert. A C-terminal His6-tag could help with

the partial purification of AaSPVII, as autocatalysis has been observed in AaSPVII expressed with an N-terminal His6-tag, losing the tag before purification.

FIGURE 4 (left): SDS-PAGE of AaSPVII / pET29b total (purple) and soluble (teal) samples expressed at 12 °C in Luria Broth. Time in hours. Autocatalysis is observed at T = 44.

Intact AaSPVII / pET29b: 27.64 kDa

FIGURE 5 (right): SDS-PAGE of AaSPVII / pET29b total (purple) and soluble (teal) samples expressed at 12 °C in Terrific Broth. Time

in hours.

To further minimize auto-digestion, additional AaSPVII / pET29b SHuffle® T7 cell paste purified withthe same protocol, except that the imidazole buffers contained 5 mM DTT and 25 µL of 3 M sodiumacetate pH 5.2 was added to the wells of the 96-well plate prior to fractionation (see below).

FIGURE 6: (top) SDS-

PAGE of AaSPVII /

pET29b Ni2+

purified fractions.

(bottom) SDS-PAGE of post-

dialysis AaSPVII / pET29b in increasing

volumes (µL) of purified protein.

Auto-digestion occurred, but

there was still a significant

amount of intact AaSPVII /

pET29b.

FIGURE 7: (left) SDS-PAGE of AaSPVII / pET29b Ni2+purified fractions collected in 50 mM sodium acetate pH 5.2. (right) SDS-PAGE of post-dialysis AaSPVII / pET29b in increasing volumes (µL) of purified protein. The 20 µL sample

was so concentrated that it could not clearly travel through the NuPAGE Novex 4-12% Bis-Tris Protein Gel (ThermoFisher Scientific, cat #NP0321BOX). Auto-digestion still occurred.