results and discussions - cairo...

27
Journal MOLECULAR CLONING AND EXPRESSION STUDIES OF A FULL LENGTH c-DNA CODING FOR TREHALOSE 6-PHOSPHATE FROM EGYPTIAN DURUM WHEAT Hassan Salem 1 , Faten Abou-Elella 1 , Ayman A. Diab 2 , Lamiaa Salah EL Den 2. J. Biol. Chem. Environ. Sci., 2011, Vol.6(3): 445-454 www.acepsag.org 1 Biochemistry Department, Faculty of Agriculture, Cairo University, 2 Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), Ministry of Agriculture, Egypt. ABSTRACT A series of experiments were conducted on the leaves of Durum wheat sohag variety 3 under normal and dehydration shock stress conditions (2, 4, 6 hours) in order to examine the magnitude of the TPP gene response to dehydration. The full length of TPP gene was isolated by RACE-PCR yielding a length of 1458 bP. Bioinformatics analysis was used in order to perform a profiling for the TPP gene expression after being isolated by RT-PCR. Semi- quantitative RT-PCR and real time quantitative PCR indicated that the expression of this gene is upregulated in response to drought stress. Aphylogentic analysis was performed to related the closest species to the wheat revealing the Oryza sativa which also shown similarity in the

Upload: others

Post on 19-Feb-2020

0 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

Journal

MOLECULAR CLONING AND EXPRESSION STUDIES OF A FULL

LENGTH c-DNA CODING FOR TREHALOSE 6-PHOSPHATE FROM

EGYPTIAN DURUM WHEAT

Hassan Salem1, Faten Abou-Elella 1 , Ayman A. Diab 2, Lamiaa Salah EL Den2.

J. Biol. Chem.Environ. Sci., 2011,Vol.6(3): 445-454www.acepsag.org

1Biochemistry Department, Faculty of Agriculture, Cairo University, 2Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), Ministry of Agriculture, Egypt.

ABSTRACTA series of experiments were conducted on the leaves of Durum

wheat sohag variety 3 under normal and dehydration shock stress conditions (2, 4, 6 hours) in order to examine the magnitude of the TPP gene response to dehydration.

The full length of TPP gene was isolated by RACE-PCR yielding a length of 1458 bP. Bioinformatics analysis was used in order to perform a profiling for the TPP gene expression after being isolated by RT-PCR. Semi-quantitative RT-PCR and real time quantitative PCR indicated that the expression of this gene is upregulated in response to drought stress. Aphylogentic analysis was performed to related the closest species to the wheat revealing the Oryza sativa which also shown similarity in the comparative mapping revealing that the TPP gene sequence in the Durum wheat to be found on the Oryza sativa on chromosome 8 .

The Bioinformatics analysis and the conducted experiment confers that the TPP level increased under the dehydration stress indicating an up regulation for the gene and proving to be a membrane stabilizer.

Key words: Durum wheat, dehydration shock stress, RT-PCR, RACE-PCR. Bioinformatics.

Abbreviations: TPP Trehalose-6-phosphate phosphatase

Page 2: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL

INTRODUCTIONThe explosive increase in world population, along with the

continuing deterioration of arid land, scarcity of fresh water, and increasing environmental stress pose serious threats to global agricultural production and food security.

Despite focused efforts to improve major crops for resistance to abiotic stresses (Boyer, 1982) such as drought, excessive salinity, and low temperature by traditional breeding, success has been limited. This lack of desirable progress is attributable to the fact that tolerance to abiotic stress is a complex trait that is influenced by coordinated and differential expression of a network of genes. Fortunately, it is now possible to use transgenic approaches to improve abiotic stress tolerance in agriculturally important crops with far fewer target traits than had been anticipated (Zhang et al., 2001).

Abiotic stresses can directly or indirectly affect the physiological status of an organism by altering its metabolism, growth, and development. A common response of organisms to drought, salinity, and low-temperature stresses is the accumulation of sugars and other compatible solutes (Hare et al., 1998). These compounds serve as osmoprotectants and, in some cases, stabilize bimolecular under stress conditions (Yancey et al., 1982; Hare et al., 1998).

One such compound is trehalose, a nonreducing disaccharide of glucose, which plays an important physiological role as an abiotic stress protectant in a large number of organisms, including bacteria, yeast, and invertebrates (Crowe et al., 1992). Trehalose has been shown to stabilize dehydrated enzymes, proteins, and lipid membranes efficiently, as well as protect biological structures from damage during desiccation. In the plant kingdom, most species do not seem to accumulate detectable amounts of trehalose, with the notable exception of the highly desiccation-tolerant ‘‘resurrection plants’’ (Wingler, 2002).

Attempts to accumulate trehalose in higher plants by introducing trehalose biosynthesis genes from microorganisms have produced transgenic tobacco (Holmstrom et al., 1996; Pilon-Smits et al., 1998) or rice plants (Garg et al., 2002; Jang et al., 2003) that showed significant tolerance against various abiotic stresses.

This study was undertaken to investigate the trehalose 6 phosphate (TPP) gene ability for drought tolerant in Durum wheat.

446

Page 3: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454

MATERIALS AND METHODSPlant material and dehydration shock treatment growth conditions:

Durum wheat Seeds (variety Sohag 3) were sterilized in 10% sodium hypochlorite for 30 min and then rinsed with bidistilled water for 1 min 15 times. Plants were grown in soil composed of sand and clay (1:1) for three weeks and irrigated daily under controlled conditions (25ºC day/16ºC night, 12-h photoperiod). Plants were removed from soil, washed carefully and placed on paper towels for different periods (0, 2, 4, 6h),after wards the leaves were harvested, frozen in liquid nitrogen and stored at-80°C for the RNA extraction according to Ozturk et al, (2002).

RNA Isolation and RT-PCR from Durum wheat leaves:Total RNA was extracted from the harvested leaves according to

the procedure of Chomczynski. (1993) using the TriPure isolation reagent (Cat No 1667165). RNA product (8 µl) was mixed with 1 µl RQ1 RNase-Free DNase 10X Reaction Buffer. And 1 µl of RNA RQ1 RNase-Free DNase (1u / µg) and incubated at 37°C for 30 minutes, then 1 µl of RQ1 DNase stop solution was added to terminate the reaction, and RQ1 DNase was inactivated by incubation at 65°C for 10 minutes.RT-PCR was carried out using the ImProm-II™ Reverse Transcription System of c-DNA" ImProm-II™ promega cat.N.o A3800 kit using primers. TPP gene was used to design gene-specific primers for RT-PCR The procedure for amplifying TPT was” ATGGATTTGAGCAATAGCTC” Forward primer,” ACACTGAGTGCTTCTTCCAT” Reverse primer. The reactions of PCR were carried out in a Thermo Hybrid PCR instrument, PCR amplification conditions were : 94°C for 4 minutes (1 cycle); 94°C for 1 minute, 55°C for 1 minutes, 72°C for 2 minute (for 35 cycles); 72°C for 10 minutes (1 cycle), then soacked at 4°C.Three tubes for PCR reactions assembled (experimental reaction-positive control (18s rRNA)-negative control of second strand synthesis and negative control of second strand synthesis tubes ddH2O were added.

“Rapid amplification of cDNA ends" (RACE PCR):Rapid amplification of cDNA PCR was done acording to

Frohmann, (1994) Roche cat N.o 1734792, Isolation and characterization of 5´ends from low-copy RNA messages. Gene-

447

Page 4: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL

specific primer SP1 is required to transcribe the mRNA into first-strand cDNA SP1 primer GGACGAACCTCTAAAACCATTC .A second, nested primer SP2 located upstream of SP1 is used for the first PCR amplification. For a second PCR SP2 1ST PCR primer CCTCCAGCACTTCGTTTACGAG round and use a further nested primer SP3.SP3 2nd AAACCTCATCGATCATAGGCAGAAA designed according to the gene sequences. PCR products were migrated by electrophoresis on 1% (W/V) agarose gel.

PCR confirmations of TPP clone:PGEM-T Easy vectors. Cat N.o A1360 was used. Ligation

reactions were set up. The recombinant colonies were identified by carrying the insert .Another amplification reaction was made utilizing SP6 and T7 universal primers which their sites located on pGEM-T easy vector, the same conditions was used except for the annealing temperature would be 50°C for 1 min.

Sequencing of the cDNA inserts:The automated DNA sequencing reactions were performed using

ABI PRISM Big Dye terminator cycle sequencing ready reaction kit (PE Applied Biosystem, USA), in conjunction with ABI PRISM (310 Genetic Analyzer). Cycle sequencing was performed using the gene amp 2400 thermal cycler, according to Sanger et al. (1977). Homology search was performed using BLASTX against the NCBI protein database (http://www.ncbi.nlm.nih.gov).Sequences of plant TPP genes that showed similarity to the TPP gene were obtained from the NCBI non redundant and dbEST data sets using BLASTX or BLASTP (ver. 2.0.10) (Altschul et al., 1990). The full amino acid sequences of the proteins were aligned using CLUSTAL W (ver. 1.8) (Thompson et al., 1994) and subjected to phylogenetic analysis. Phylogenic trees were constructed using the neighbor-joining (NJ) method (Saitou and Nei, 1987) with parsimony and heuristic search criteria and 1000 bootstrap replications to assess branching confidence, boxshade 3.2.2 software and office 2003 Microsoft word were used for shading alignment and highlighting conserved domains respectively.

Semi-quantitative RT-PCR analysis :

448

Page 5: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454

One µl of cDNA reaction mixture was diluted with 9 µl DEPC treated water, then, 1 µl of diluted mixture was used to perform Semi-quantitative RT-PCR reaction as followed 1.0 l dNTPS (10 mM) was mixed with 2.5 l MgCl2 (25 mM) and 5.0 l 10X buffer was added to 5.0 l Forward primer (10 pmol/l) and 5.0 l Reverse primer (10 pmol/l) mixed to 1.0 l Template cDNA (25 ng/l) andadded 0.5 l Taq (5 U/l) finally, up to 50 l dd H2O. The amplification was carried out in Hybaid PCR Express system programmed with specific primers for TPP and 18S (as a control to normalize for the amount of cDNA present in each sample) genes as follows: 5 min at 95°C, followed by 35 cycles at 95°C for 45 s, 55°C for 60 s, 72°C for 2 min, 72°C for 5 min. For each sample, 10 l of the amplification reaction was size-fractionated on a 1% (w/v) agarose gel.

Real-time PCR: Real-time PCR was performed using iQ SYBR Green Sypermix

(BIO-RAD, USA). Real-time PCR (QPCR) reaction was applied by :12.5 l of iQ SYBR Green Sypermix was mixed with 2.0 l Forward primer (10 pmol/l), and 2.0 l Reverse primer (10 pmol/l), then 1.0 l Template cDNA (25 ng/l) was mixed well , finally up to up to 25 l dd H2O. Reactions were run on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA) condition was 4 min at 94°C, 40 cycles of 30 s at 94°C, 60 s at 55°C, and 2 min at 72°C. PCR products were examined by melt curve analysis. For each cDNA sample, 18s levels were also quantified in the same run. Expression levels relative to 18s were then calculated using the StepOne™ software v2.1 package, which compares reaction take off points. (Livak and Schmittagen, 2001).

Trehalase enzyme assay:Preparation of crude extract:

100mg control and drought treated leaves (0, 2, 4, 6 h) were ground with liquid nitrogen by using mortar and pestle. The powder were then suspended in ice-cold suspension solution containing 0.1 M citrate (Na+), pH 3.7, 1 mM PMSF, 2 mM EDTA and insoluble polyvinylpyrrolidone (10 mg/g dried weight). For 1 g dry weight of suspension culture 2 ml of extraction buffer was used. The homogenate was filtered through two layers of cheesecloth and centrifuged at 31,500 rpm (48,000 g) for 30 min at 4 8 oC in Sorval Combi Plus with T-880 type rotor. The supernatant was used for the

449

Page 6: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL

enzyme assays. The protein concentration was performed according to (Bradford, 1976) using bovine serum albumin (BSA) as standard.

Assay of trehalase:Trehalase enzyme activity was measured using glucose oxidase–

peroxidase kit (Bicon) (Muller et al, 1992). The enzyme assay is based on the measurement of glucose produced by hydrolysis of trehalose. The reaction mixture was composed of 10 mM trehalose, 50 mM MES (K+), pH 6.3 and 0.2 mg crude extract in a final volume of 1 ml. It was incubated at 37 oC for 30 min. The reaction was started by the addition of trehalose to the reaction mixture, which was preincubated at 37 oC for 10 min, 100 ml of samples were taken from the reaction mixture and immediately put in thermostat at 100 oC for 3 min to stop the reaction. Precipitates were removed by centrifugation at 8700 rpm for 10 min in microcentrifuge. For the analysis, 10 ml of the supernatant was mixed with 1 ml of glucose oxidase – peroxidase kit solution, mixed by vortex and then the mixtures were incubated at 37 oC for 15 min. The absorbance of the sample was measured at 470 nm in Schimadzu UV-1201 spectrophotometer against blank solution. The increase in the absorbance against time was assumed to be equal to the amount of glucose formed. One unit of trehalase activity is defined as the amount of enzyme that catalyzes the hydrolysis of 1 mmol of trehalose/ min at 37 oC at pH 6.3.

Insilico mapping:The trehalose 6 phosphate sequence was compared to rice

BAC/PAC sequences using BLAST (with an E-value threshold of 1e-10). The rice BAC/PAC that matches the query was used to identify anchored rice markers from the rice genetic linkage map (http://www.tigr.org). The results obtained from this stage were used to construct a comparative map between durum wheat, rice, oat. To identify the tentative chromosomal location of trehalose 6 phosphate in durum wheat, rice, oat, using comparative mapping strategy.

RESULTS AND DISCUSSIONIsolation of TPP gene:

The TPP1 gene was about 945 bp as result from RT- PCR.The full length of gene TPP which obtained by RACE a PCR product of (1458 bp) band was obtained, Fig. 1.and Fig.2.

450

Page 7: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454

Fig. 1. 1% agarose gel electrophoresis of digestion of candidate colonies plasmid DNA with EcoRI enzyme, (M) 1kb marker,(1) pGEM.Tvector, (2, 3, 4) (TPP) gene (5) positive colony plasmid DNA digestion.

Fig. 2: A) Nucleotide sequence of (TPP1) gene representing 1458 bp as obtained from the ABI PRISM 310 DNA sequencer. (B): The Sequence Manipulation Suite: Protein Molecular Weight Deduced Amino Acid Sequence and Phylogenetic Relationship of TPP1gene.

451

Page 8: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL

To determine the evolutionary relatedness of TPP gene to TPP proteins isolated from other species, the neighbor joining method (NJ) was used to generate a gene tree based on amino acid sequence homology of the region of TPP isolated genes to those of TPP proteins (Fig.3,4 ). The multiple sequence alignment showed that functional protein TPP gene has a high degree of similarity 93% with Oryza sativa (OsTPP), 56% with Arabidopsis thaliana (ArTPP), 56% with Nicotiana tabacum(NtTPP), 53% with (ZmTPP)Zea mays, , 45% with A.lyrata (ArLTPP).

Fig.3.Phylogenetic tree based on sequences of the relationship of (TPP1) with other plants. The deduced sequences were aligned with CLUSTALW. The phylogenetic tree was constructed by the neighbor-joining including Arabidopsis lyrata (ArLTPP), Zea mays (ZmTPP), Arabidopsis thaliana (ArTPP), Nicotiana tabacum(NtTPP), Oryza sativa (OsTPP), TPP new.

452

Page 9: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454

Fig.4. Alignment of the predicted amino acid sequence of TPP1 and those of several other plants including Arabidopsis lyrata (ArLTPP), Zea mays (ZmTPP), Arabidopsis thaliana (ArTPP), Nicotiana tabacum(NtTPP), Oryza sativa (OsTPP), TPP new

TPP gene expression:Under dehydration shock, the expression of TPP gene in leaf

was upregulated at 4 h and decreased to normal at 2 and 6 h Fig .5. These results suggest that Durum wheat TPP participates in the response to dehydration shock stress. The re-upregulation of Durum wheat TPP appears to lead to an accumulation of trehalose and to maintain the expression of genes that produce osmoprotectants because the content of trehalose is too low to serve as a protectant (Garg et al. 2002; Schluepmann et al. 2004; Ge et al. 2008). Rice seedlings treated with 1% (w/v) NaCl accumulated trehalose at a rate of 7 μg per 100 mg of fresh weight at the third day, but were undetectable on the second day (Garcia et al. 1997). Earlier reports indicated that Arabidopsis, and many other higher plants, accumulate

453

Page 10: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL

trehalose at only trace levels (Blázquez et al. 1998; Garg et al. 2002; Chary et al. 2008). This is probably due to the low-level activity of synthesis enzymes and relatively high level of trehalase activity (hydrolytic enzyme) (Vogel et al. 1998; Van Dijck et al. 2002). The accumulation of trehalose was increased dramatically in soybean, cowpea, tobacco, and Arabidopsis after trehalase activity was inhibited by validamycin A (Müller et al. 1995; Goddijn et al. 1997; Müller et al. 2001). Over-expression of exogenous or endogenous TPS and TPP encoding genes in transgenic plants led to an increase of abiotic tolerance, but the trehalose content was still very low (Garg et al. 2002; Jang et al. 2003; Avonce et al. 2004; Karim et al. 2007; Miranda et al. 2007). Rice plants tend to sustain a static TPP activity and that the activity raises to a peak around 4 h of the chilling stress (12 Cо), which was followed by a decline to it initial level after 8 h .This immediate and transient increase in TPP activity during chilling stress follows the pattern of mRNA accumulation Pramanik and Imai (2005). We suggest that the major role of trehalose in higher plants is not osmotic protection, but signal transduction. Therefore, the mechanism of signal transduction involving trehalose in higher plants needs to be explored.

Fig.5. 1% agrose gel electrophoresis of comparison of (TPP1) expression patterns of leaves obtained by semiquantitative RT-PCR under dehydration shock treatment after 1: 0h, 2: 2h, 3:4h, 4:18S gene was used as control for relative amount of RNA.

Trehalase activity: The trehalase specific activity was found to be the highest under

control conditions in leaves of durum wheat Table (1). Trehalase activity normally keeps cellular trehalose concentrations low in order

454

Page 11: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454

to prevent detrimental effects of trehalose accumulation on the regulation of carbon metabolism. Such a role of trehalase may be of particular importance in interactions of plants with trehalose-producing microorganisms. In support of this hypothesis, expression of the Arabidopsis trehalase gene and trehalose activity were found to be strongly induced by infection of Arabidopsis plants with the trehalose-producing pathogen Plasmodiophora brassicae (Brodmann et al 2002). In this study the effect of drought stress on trehalase activity of durum wheat species was examined. The trehalase activity was found to be the lowest in leaves with drought stress treatment. Trehalase is ubiquitous in higher plants and single-copy trehalase genes have been identified and functionally characterized from soybean (Glycine max) and Arabidopsis (Muller et al., 2001, Aeschbacher et al., 1999). It is likely that trehalase is the sole route of trehalose breakdown in plants as trehalose accumulates in the presence of the specific trehalase inhibitor validamycin A (Muller et al., 2001). Trehalase activities in cell and tissue cultures of gymnosperm Picea and of a series of mono- and dicotyledonous plants including three wheat callus lines were described (Kendall et al., 1990). Therefore, it can be safely concluded that trehalose activity is present in most of higher plants across all major taxonomic groups (Muller et al., 1995).

Table 1. Trehalase activity under dehydration shock treatments.

In-silico analyses:In-silico mapping of rice was found to be matching with the

sequence of TPP on chromosome 8 the marker was (AQ074215) (http://www.gramene.org) “Comparative tetraploid wheat NDSU langdon QTL 2002” it found in chromosome 3A and Oat in “comparative oat Cornell Diploid 1995” Fig .6.

Hours Enzyme activity

0h 1.004 d

2h 0.7813 c

4h 0.4273 a

6h 0.7170 b

455

Page 12: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL

Fig .6. Comparative map showing the marker AQ074215 on Rice chromosome 8. This marker is closely linked between Oat and Tetraploid wheat.

REFERENCES Aeschbacher,R.A.; Muller,J .; Boller,T.and Wiemken, A. (1999).

Purification of the trehalase GMTRE 1 from soybean nodules and cloning of its cDNA: GMTRE 1 is expressed at a low level in multiple tissues, Plant Physiol. 119 : 489–496.

Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W. and Lipman, D.J. (1990). Basic local alignment search tool. J.Mol. Biol., 215:403-410.

456

Page 13: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454

Avonce, N.; Leyman, B.; Mascorro-Gallardo, J.O.; Van Dijck, P.; Thevelein, J.M. and Iturriaga, G .(2004) .The Arabidopsis trehalose-6-P synthase AtTPS1 gene is a regulator of glucose, abscisic acid, and stress signaling. Plant Physiol 136:3649–3659.

Blazquez ,M.A.; Santos, E.; Flores, C.L.; Martinez-Zapater, J.M.; Salinas, J.and Gancedo, C. (1998). Isolation and molecular characterization of the Arabidopsis TPS1 gene, encoding trehalose-6-phosphate synthase. Plant J 13:685–689.

Boyer, J. S. (1982). Plant Productivity and Environment, Science. 218: 443–448.

Bradford, M.M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72:248–254.

Brodmann, A.; Schuller, A.; Muller,J.; Aeschbacher,R.A.; Wiemken, A.; Boller,T.and Wingler, A. (2002). Introduction of trehalose in Arabidopsis plants infected with the trehalose-producing pathogen Plasmodiphora brassicca, Mol. Plant Microbe Interact. 15:693–700.

Chary, S.N.; Hicks, G.R.; Choi, Y.G.; Carter ,D.and Raikhel, N.V. (2008). Trehalose-6-phosphate synthase/phosphatase regulates cell shape and plant architecture in Arabidopsis. Plant Physiol 146:97–107.

Chomczynski, P. (1993).A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. BioTechniques., 15: 532-537.

Crowe, J. H.; Hoekstra, F. A. and Crowe, L. M. (1992) .Anhydrobiosis, Annu. Rev. Physiol., 54: 579–599.

Frohmann, M. (1994). On benoyd classic RACE rabid amplification of cDNA ends.PCR methods and applications .4:540–558.

Garcia, A.B.; Engler J.A.D, Iyer S.; Gerats, T.; Montagu ,M.V.and Caplan, A.B .(1997). Effects of osmoprotectants upon NaCl stress in rice. Plant Physiol .115:159–169.

Garg, A.K.; Kim, J.K.;Owens, T.G.; Ranwala, A.P.;Choi, Y.D.; Kochian, L.V.and Wu ,R.J .(2002). Trehalose accumulation in

457

Page 14: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL

rice plants confers high tolerance levels to different abiotic stresses. Proc Natl Acad Sci USA. 99:15898–15903.

Ge, L.F.;Chao, D.Y.;Shi, M.; Zhu, M.Z.; Gao, J.P. and Lin, H.X. (2008). Overexpression of the trehalose-6-phosphate phosphatase gene OsTPP1 confers stress tolerance in rice and results in the activation of stress responsive genes. Planta. 228:191–201.

Goddijn, O.J.; Verwoerd, T.C.; Voogd, E.;Krutwagen, R.W.;de Graaf, P.T.; Poels, J.; Van Dun, K.; Ponstein ,A.S.; Damm, B. and Pen, J .(1997). Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants. Plant Physiol .113:181–190.

Hare, P. D.; Cress, W. A. and van Staden, J. (1998). Dissecting the roles of osmolyte accumulation during stress; Plant Cell Environ., 21:535–554.

Holmström, K.O.; Mäntylä, E.; Welin, B.; Mandal, A.; Palva ,E.T.; Tunnela, O.E. and Londesborough, J. (1996). Drought tolerance in tobacco.Nature., 379:683–684.

Jang, I.C.; Oh ,S.J.; Seo, J.S.; Choi, W.B.; Song, S.I.; Kim, C.H.; Kim, Y.S.; Seo, H.S.;Choi, Y.D.; Nahm, B.H. and Kim, J.K (2003). Expression of a bifunctional fusion of the Escherichia coli genes for trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase in transgenic rice plants increases trehalose accumulation and abiotic stress tolerance without stunting growth. Plant Physiol., 131:516–524.

Karim, S.;Aronsson, H.; Ericson, H.; Pirhonen, M.; Leyman, B.;Welin, B.; Mäntylä, E.;Palva, E.T.; Van Dijck, P. and Holmström, K.O. (2007). Improved drought tolerance without undesired side effects in transgenic plants producing trehalose. Plant Mol Biol 64:371–386.

Kendall, E.J.; Adams, R.P. and Kartha, K.K. (1990). Trehalase activity in plant tissue cultures, Phytochemistry 29 (8): 2525–2528.

Livak, K.J.; and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T) Method. Method.s, 25: 402–408.

458

Page 15: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454

Miranda, J.A.; Avonce,N.; Suárez, R.; Thevelein,J.M.; Van Dijck, P.and Iturriaga, G. (2007) .A bifunctional TPS-TPP enzyme from yeast confers tolerance to multiple and extreme abiotic-stress conditions in transgenic Arabidopsis. Planta 226:1411–1421.

Müller ,J.; Aeschbacher, R.A.; Wingler, A.; Boller, T. and Wiemken, A .(2001). Trehalose and trehalase in Arabidopsis. Plant Physiol 125:1086–1093.

Müller, J.; Boller, T.and Wiemken, A. (1995). Effects of validamycin A, a potent trehalase inhibitor, and phyto-hormones on trehalose metabolism in roots and nodules of soybean and cowpea. Planta 197:362–368.

Müller, J.; Staehelin,C .; Mellor, R.; Boller, T. and Wiemken, A. (1992) .Partial purification and characterization of trehalose from soybean nodules, J. Plant Physiol. 140 : 8–13.

Ozturk, Z.N.; Talame, V.; Deyholos, M.; Michalowski, C.B.; Galbraith, D.W.;Gozukirmizi N.; Tuberosa R. and Bohnert H.J .(2002). Monitoringlarge-scale changes in transcript abundance in drought- and salt stressed barley. Plant Mol Biol .48:551–573.

Pilon-Smits, E.A.H.; Terry, N.; Sears, T.; Kim, H.; Zayed, A.;Hwang, S.; Dun, K.; Voogd, E.;Verwoerd, T.C.; Krutwagen,R.W.H.H. and Goddijn, O.J.M. (1998). Trehalose-producing transgenic tobacco plants show improved growth performance under drought stress. J. Plant Physiol., 152: 525–532.

Pramanik, M.H.and Imai, R. (2005). Functional identiWcation of a trehalose 6-phosphate phosphatase gene that is involved in transient induction of trehalose biosynthesis during chilling stress in rice. Plant Mol Biol 58:751–762.

Saitou, N. and Nei, M. (1987). The neighborjoining method: a new method for reconstructing phylogenetic trees.Mol. Biol. Evol., 4:406-425.

Sanger, F.; Nicklen, S.; and Coulson, A.R. (1977). Biochemistry DNA sequencing with chain-terminating inhibitors (DNA polymerase / nucleotide sequences /bacteriophage 4X174). Proc. Nati. Acad. Sci., 74, 12: 5463-5467.

459

Page 16: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL

Schluepmann, H.;Van Dijken, A.;Aghdasi, M.;Wobbes, B.;Paul, M. and Smeekens, S .(2004). Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6-phosphate accumulation. Plant Physiol 135:879–890.

Thompson, J.D.; Higgins, D.G. and Gibson, T.J. (1994).CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res.,22:4673-4680.

Van Dijck, P.; Mascorro-Gallardo, J.O.; De Bus, M.; Royackers, K.;Iturriaga ,G.and Thevelein, J.M. (2002). Truncation of Arabidopsis thaliana and Selaginella lepidophyll trehalose-6-phosphate synthase unlocks high catalytic activity and supports high trehalose levels on expression in yeast. Biochem J: 366:63–71.

Vogel ,G.; Aeschbacher, R.A.;Muller, J.; Boller, T.and Wiemken, A. (1998). Trehalose- 6-phosphate phosphatases from Arabidopsis thaliana: identification by functional complementation of the yeast tps2 mutant. Plant J 13:673–683.

Wingler, A. (2002) .The function of trehalose biosynthesis in plants. Phytochemistry., 60: 437-440.

Yancey, P. H.; Clark, M. E.; Hand, S. C.;Bowlus, R. D. and Somero, G. N. (1982). Living with water stress: evolution of osmolyte systems. Science. 217: 1214–1222.

Zhang, H. X.; Hodson, J. N.; Williams, J. P. and Blumwald, E. (2001). Engineering salt-tolerant Brassica plants: Characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation Proc. Natl.Acad. Sci., USA 98: 12832–12836.

460

Page 17: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454

للتتابع الجيني والتعبير الجزيئيه الكلونه دراسهيالنيكلوتيد

التريهالوز لجين القمح- 6الكامل فوسفاتفيالصلب

سالم. حسن د العال , 1ا ابو فاتن . 1د دياب , ايمن صالح 2د لمياء ، السيد 2الدين

القاهرة – 1 جامعة الزراعة كليةالزراعية – 2 البحوث مركز الوراثية الهندسة بحوث معهد

سوهاج الصلبصنف القمح نبات تعريض المائي 3تم االجهاد لظروف

.6,4,2بعد الكنترول بالنبات مقارنه ساعاتلجين الكامل الطول علي الحصول بطريقة فوسفات 6التريهالوز تم

المكملة المستنسخات لنهايات السريع التضاعف تقنية من معدلة

النتيجه ))RACE- PCRباستخدام .نيوكليوتيده 1458وكانت

الجين هذا عن المزيد لمعرفه االحيائيه المعلوماتيه تقنيات استخدام

. الشجره رسم وعند العكسي المتسلل البلمره تفاعل بواسطه عزله بعد

تطوريه وحده يمثل المعزول الجين أن وجد المقارنه لهذه التطوريه

مقارنه. خريطه رسم عند وكذلك االرز وبين بينه تقارب ويمثل مميزه

رقم الكرمسوم علي يوجد الجين ان وجد .8الجينات

تكنيك استخدام التعبير Semi-quantitative-PCRتم مستوي لمعرفه

بعد مرتفع انه ووجد بعد 4الجيني وانخفض .6و2ساعات ساعات استخدام Real-timeتم PCR ظروف تحت الجيني التعبير لمعرفه

بعد الجيني التعبير ارتفاع النتائج واظهرت المائي ساعات 4االجهاد

. تحت التريهاليز النزيم االنزيمي النشاط دراسه تم بالكنترول مقارنه

بعد يقل االنزيمي النشاط ان ووجد الجفاف بعد 4ظروف ويزيد ساعات

.6و2 بالكنترول مقارنه ساعات

461

Page 18: Results and discussions - Cairo Universityscholar.cu.edu.eg/?q=fatenabouelela/files/bhth_lmy_lnhy.doc  · Web viewRoche cat N.o 1734792, Isolation and characterization of 5´ends

MOLECULAR CLONING AND EXPRESSION STUDIES OF FULL 462