Ria Vergara-Lluri Resident, PGY-4

David Geffen School of Medicine at UCLA

Submission to Los Angeles Society of Pathology (LASOP) Resident and Fellow Symposium 2012

A Unique Sarcoma with Dual Morphologic, Cytogenetic, and Molecular Signatures

Pertinent history and symptoms

43 year old woman presented in 2011 with recurrent soft tissue tumor in the left arm

In 2004, at age 35, she presented at another institution with a 5-year history of a left arm mass (7.5 x 5.5 x 4 cm), which was resected and diagnosed as a sarcoma**

Because she lost her medical insurance, she did not receive any further therapy after surgical resection

At re-presentation in 2011, she had a large, protuberant and firm soft tissue mass (9.6 x 7.6 x 6.5 cm ) located along the posterior arm/triceps muscle

Based on diagnosis of high-grade sarcoma,** patient received induction chemotherapy followed by surgical resection with intraoperative and subsequent external beam radiation

**Diagnoses will be revealed later

External and cut surfaces of recurrent

tumor (9.6 x 7.6 x 6.5 cm)

S-100

cytokeratin cocktail

bcl-2

Summary of Morphologic and

Immunohistochemical (IHC) Features

Variably cellular and multinodular neoplasm

Hypercellular areas with spindled cells in streaming to storiform growth pattern

Hypocellular areas with round cells embedded in fibromyxoid to hyalinized stroma

Hypercellular areas exhibit subtle transition to hypocellular areas

Round cells with eccentrically placed nuclei, irregular nuclear contours, hyperchromasia, multiple chromocenters, and moderate amount of dense eosinophilic cytoplasm

Mitotic activity up to 12 mf/10 high power fields

Post-treatment necrosis approximately 20%

Lymphovascular space invasion present

IHC positive for S-100 (patchy), cytokeratin cocktail AE1/AE3 + CAM5.2 (patchy), EMA (patchy), MUC4 (focal), and bcl-2 (diffuse)

IHC negative for CD99, synaptophysin, chromogranin, SMA, calponin, GFAP, desmin, myogenin

Differential Diagnosis

Soft tissue myoepithelioma (aka soft tissue

mixed tumor or parachordoma)

Extraskeletal Myxoid Chondrosarcoma

(EMC)

Synovial Sarcoma (SS)

Further cytogenetic and molecular testing

performed on original and recurrent

tumors

FISH

RT-PCR to elucidate the gene fusion partners

for EWSR1 and SYT rearrangements in

tumors

Fluorescence In-situ Hybridization results

EWSR1 (22q12) rearrangement in 188 of 200 cells (94%)

SYT (18q11) rearrangement in 70 of 200 cells (35%)

Courtesy of Pauline Brenholz, MD

RT-PCR fusion results

EWS:NR4A3 fusion

product from

t(9;22)(q22;q12)

characteristic of

EMC

AGAGGCCTTATGGATATGACCAG

EWS exon 12

ATCATGCCCAAG

NR4A3 exon 3

TGGTTTGATG

SS18 exon 10

ATATGCCCTGCGTCCAAG

SSX2 exon 6

SS18-SSX2 fusion

product from

t(X;18)(p11;q11)

characteristic of SS

Diagnosis

Sarcoma with dual morphologic, cytogenetic,

and molecular signatures of extraskeletal

myxoid chondrosarcoma and synovial

sarcoma

Clinical and Diagnostic Timeline

Patient diagnosed with EMC in 2004 based on histomorphology and immunohistochemical (IHC) characteristics

Underwent surgical resection, margin positive

Lost to follow-up

Re-presented in 2011 with tumor recurrence

FNA performed on recurrent tumor and FISH study showed SYT (18p11) rearrangement prompted a more thorough investigation of EMC vs SS

Pathology review of original tumor and recurrent tumor disclosed identical histologic and IHC characteristics

FISH studies on original and recurrent tumors performed for EWSR1 (22q12) and SYT (18p11) rearrangements

RT-PCR and direct automated sequencing performed on original and recurrent tumors

Primarily because of SS diagnosis, patient received induction chemotherapy with ifosfamide-epirubicin followed by surgical resection with intraoperative and subsequent external beam radiation

Comparison of Typical Clinical Features

and Clinical Behavior of EMC vs SS Clinical

Characteristics

EMC SS

Incidence Rare, accounts for <3% of all soft

tissue sarcomas

Rare, but accounts for 5-10% of all soft

tissue sarcomas

Affects Middle aged and elderly individuals;

M:F ratio 2:1

Adolescents and young adults; M:F

ratio 1.2:1

Location Deep-seated; >66% in proximal

extremities, limb girdles, thigh,

popliteal fossa

Deep-seated; 85-95% in extremities, in

vicinity of large joints, especially knee

region

Prognosis Relatively slow-growing; 5 year

survival rate 90%; late recurrence and

metastasis common

Aggressive; 5 year survival rate range

from 36-76% based on prognostic

factors

Therapy Radiation therapy responsive;

standard of care surgical resection +

adjuvant radiotherapy

Chemosensitive (ifosfamide +

doxorubicin/epirubicin); induction

chemotherapy + resection + adjuvant

radiotherapy

Comparison of Histopathologic and

Immunohistochemical Features of EMC vs SS

Features EMC Monophasic SS

Spindle cell population Sometimes Characteristic

Abundant myxoid

matrix

Characteristic Sometimes

Multinodularity Characteristic Sometimes

Epithelioid cells Characteristic Focally

S-100 + (18-50%) + (30%)

Cytokeratin cocktail - + (69%)

EMA + (30%) + (97%)

MUC4 - + (30%)

bcl-2 + (>95%) + (>95%)

Comparison of Molecular Signatures

Associated with EMC vs SS

Translocations Genes Incidence

Extraskeletal

myxoid

chondrosarcoma

t(9;22)(q22;q12)

t(9;17)(q22;q11)

t(9;15)(q22;q21)

NR4A3*;EWS

NR4A3;RBP56**

NR4A3;TCF12

70%

20%

Synovial

Sarcoma

t(X;18)(p11;q11) SS18-SSX1

SS18-SSX2

SS18-SSX4

>95%

*NR4A3, also known as CHN, NOR1, TEC

**RBP56, also known as TAF15

Significance of this finding

First sarcoma reported in the literature with two translocation-defining abnormalities

(EWS-NR4A3 & SS18-SSX2)

Tumor displays morphologic and immunophenotypic overlap between EMC & SS

Reinforces idea that specific genetic alterations can drive tumor morphology

The discovery of SS18-SSX2 fusion (in addition to EWS-NR4A3 fusion) allowed clinical team to institute a more effective chemoradiation regimen directed toward synovial sarcoma

As molecular testing for tumors becomes more widespread, perhaps more tumors with dual differentiation will be discovered lead to greater understanding of the link between specific gene rearrangements and morphology and clinical behavior

Acknowledgements

This work was accepted for publication to American

Journal of Surgical Pathology** on January 2012

UCSF

- Andrew Horvai, MD, PhD (principal investigator)

- Bradley Stohr, MD, PhD

Integrated Genetics (formerly Genzyme)

- Pauline Brenholz, MD

Kaiser Oakland

- Balaram Puligandla, MD

**All figures used in this presentation are original and were not used for publication.

References

Fletcher CDM, Unni KK, Mertens F. Pathology and Genetics of Tumours of Soft Tissue and Bone. Lyon: IARC Press, International Agency for Research on Cancer; 2002.

Weiss SW, J.R. G. Enzinger and Weiss's Soft Tissue Tumors. Philadelphia: Elsevier; 2008.

Meis-Kindblom JM, Bergh P, Gunterberg B, et al. Extraskeletal myxoid chondrosarcoma: a reappraisal of its morphologic spectrum and prognostic factors based on 117 cases. Am J Surg Pathol. 1999;23:636-650.

Iliszko M, Rys J, Wozniak A, et al. Complex tumor-specific t(X;18) in seven synovial sarcoma tumors. Cancer Genet Cytogenet. 2009;189:118-121.

Krane JF, Bertoni F, Fletcher CD. Myxoid synovial sarcoma: an underappreciated morphologic subset. Mod Pathol. 1999;12:456-462.

Cooney TP, Hwang WS, Robertson DI, et al. Monophasic synovial sarcoma, epithelioid sarcoma and chordoid sarcoma: ultrastructural evidence for a common histogenesis, despite light microscopic diversity. Histopathology. 1982;6:163-190.

Fisher C, Schofield JB. S-100 protein positive synovial sarcoma. Histopathology. 1991;19:375-377.

Sun B, Sun Y, Wang J, et al. The diagnostic value of SYT-SSX detected by reverse transcriptase-polymerase chain reaction (RT-PCR) and fluorescence in situ hybridization (FISH) for synovial sarcoma: a review and prospective study of 255 cases. Cancer Sci. 2008;99:1355-1361.

Daugaard S, Christensen LH, Hogdall E. Markers aiding the diagnosis of chondroid tumors: an immunohistochemical study including osteonectin, bcl-2, cox-2, actin, calponin, D2-40 (podoplanin), mdm-2, CD117 (c-kit), and YKL-40. APMIS 2009 Jul;117(7):518-25.

Suster S, Fisher C, Moran CA. Expression of bcl-2 oncoprotein in benign and malignant spindle cell tumors of soft tissue, skin, serosal surfaces, and gastrointestinal tract. Am J Surg Pathol 1998;22:863-72.

Doyle LA, Moller E, et al. MUC4 is a highly sensitive and specific marker for low-grade fibromyxoid sarcoma. Am J Surg Pathol 2011;35:733-41.