Supplementary online information

Detailed Materials and Methods, extension to Manuscript Part 2

2.1. Cell growth

Cells (Zea mays Black Mexican Sweet (BMS)) were grown in suspension in 25 mL aseptic

solution in 250 mL beakers, shaken at 100 rpm in dark, and subcultured every two weeks. The

growing medium composed of 4.4 g/L MS+vitamins (sigma M-6899, Murashige and Skoog

Basal Salts), 3% sucrose, 40 µL/L 2,4-D, 0.2 g/L asparagine, at pH 5.7. The medium for cells

grown with silicon (+Si cells) was supplemented with 2 mM Na2SiO3 (Sigma 33844-3) and pH

titrated with 1 M HCl solution (approximately 950 µL in 800 mL solution). The cells grown

without additional silicon (-Si cells) were supplemented with 1 M NaCl added to the same

concentration of HCl.

2.5. Transmission Electron Microscopy (TEM)

Cells cultured for 14 days were pelleted, and a drop of pellet was placed in an aluminum disc

with a 100 m-deep cavity and covered with a flat disc. The sample was then high-pressure

frozen in a HPM 010 high-pressure freezing machine according to the manufacturer's

specifications (Bal-Tec, Liechtenstein). Cells were subsequently freeze-substituted in an AFS2

freeze substitution device (Leica Microsystems, Vienna, Austria) in anhydrous acetone

containing 2% glutaraldehyde and 0.1% tannic acid for 3 days at -90°C and then warmed up to

-30°C over 24 hours and washed 3 times in anhydrous acetone at room temperature. Samples

were then incubated for 1 hour with 1% osmium tetroxide in anhydrous acetone, washed 3

times in anhydrous acetone and infiltrated in a series of increasing concentration of Epon resin

(Agar Scientific, UK). After polymerization at 60°C, 70 nm sections were mounted on a

Quantifoil (Germany) R 3.5/1 grid. Imaging and elemental mapping were performed in a

Tecnai F20 transmission electron microscope (FEI, Eindhoven, The Netherlands) operating at

200 kV and equipped with a Gatan Imaging Filter (GIF, Gatan) as well as with an UltraScan

1000, 2K x 2K CCD camera. Silicon maps were obtained at the L2,3 ionization edge using the

3 windows method.

2.6. Expression level of the silicon transporters, quantified by real-time PCR

Cells cultured for 14 days were washed twice in DDW and frozen at -80°C. RNA was isolated

from 250 mg cells using ZR plant, RNA miniprep kit (Zymo research, USA). Next, cDNA was

prepared using RevertAid H Minus Reverse Transcriptas kit (Fermentas: Thermo Fisher

Scientific Inc), according to the manufacturer's instructions. Specific primers were synthesized

(Sigma Aldrich, Rehovot Israel) to amplify the cDNA of the maize silicon transporters (Table

1S). Maize Ubiquitin (gi248338) [1] was used as a reference for normalizing the cDNA

amounts. The expression level of the transporters was measured in the presence of Platinum

1

SYBR GREEN qPCR reaction mix, (Invitrogen technologies, USA), in an ABI PRISM 7300

(Applied Biosystemsinc, USA), according to the manufacturer's specifications. The reaction,

in a final vol. of 20 l was heated to 95°C for 10 min., followed by 40 cycles of 95°C for 15

sec and 60°C for 1 min. Analysis was done on three technical replicates (meaning cell samples

grown in the same vessel), and three biological replicates (meaning cells grown in different

growth cycles). Data analysis was carried out by 7300 system SDS software study

application's software.

Table 1S: Primer sequences used to amplify targets on the transcribed sequences of silicon

transporters and ubiquitin genes.

Reverse primerForward primerGeneCGAGAGAAGAGCGACACATAGACGGACCTACACCTACATCCGCTTCLsi1 [1]AGAAGCACTGTTGGCACGTTCTCGCTGCTCGTCTTCTTCTLsi2AAACCAGCAAAGCCAGACACATTGGCTGAGAGAGTGAGTGAGAGALsi6 [1]CAGGTCCATTAAACCAACGAAGACAACATCCAGAAGGAGAGCACUbiquitin [1]

Reference

1. Moshelion M, Hachez C, Ye Q, et al. (2009) Membrane water permeability and aquaporin expression increase during growth of maize suspension cultured cells. Plant Cell Environ 32:1334–1345. doi: 10.1111/j.1365-3040.2009.02001.x

2

Supplementary Figures

Figure 1S: The development of cell culture under silicon supplementation. The medium

pH (A) and osmolarity (B) and the cells' fresh weight (C) were measured during 15 days of

cells growth. Each point is an average of three biological replicates (meaning cells grown in

different vessels). Bars represent standard deviation. Every biological replicate is an average

of three technical measurements (meaning cell samples grown in the same vessel). No

differences were found between the +Si (black) and -Si (gray) cells.

3

Figure 2S: Micrographs of the cell cultures. Samples supplemented with silicon and starved

for silicon were indistinguishable. A) Cluster of cells under a light microscope. B) The same

cells in calcofluor-white staining, staining the cell wall -glucan chains. C) Light micrograph

of a section through cell cluster. D) The same cross section stained with calcofluor-white. E)

Cross section embedded in Epon resin, stained for starch (arrows) by iodine. F) Transmission

electron micrograph of section of the cells, showing vesicles in the cytoplasm. Arrows mark

the amyloplast bodies.

4

Figure 3S: Expression levels of the silicon transporters. The Y-axis represents the relative

level of expression of the transporters, calibrated to ubiquitin. In the -Si cells we detected a

statistically significant increase in the expression of ZmLsi1 (x1.8) and ZmLsi2 (x2.2), but not

of ZmLsi6. Averages of three biological replicates are reported. Bars represent standard errors.

Letters within each panel represent significantly different groups (based on t-tests).

5

ZmLSi6ZmLSi2ZmLSi1

Relative expres

Figure 4S: Relative rates of the weight loss of commercial cornstarch treated with Si or

salt solution, reflecting pyrolysis as a function of increasing temperature. Starch was

immersed overnight in 2 mM sodium silicate, where the pH was corrected by HCl, or water

supplemented with NaCl in a concentration similar to that of the HCl. The samples were

rinsed three times in deionized water, and dried at 65°C for two days. The maximal rates of

pyrolysis of the salt-treated sample (306°C) is lower than the Si-treated sample (310°C).

6

Figure 5S: Raman spectroscopy of cell walls before amylase treatment. The spectra are

identical between the samples supplemented with silicon and those starved for silicon.

Comparing to commercial cornstarch shows that most of the scattering peaks are of the starch.

The marked peaks represent aromatic rings (1607, 1630 cm -1), and amide I protein bond, (1660

cm-1), missing from the starch spectrum. The protein peak is reduced after starch degradation

(compare to Fig. 5).

7