www.sciencemag.org/content/355/6325/634/suppl/DC1

Supplementary Materials for

Activity-dependent spatially localized miRNA maturation in neuronal dendrites

Sivakumar Sambandan, Güney Akbalik,* Lisa Kochen,* Jennifer Rinne, Josefine Kahlstatt, Caspar Glock, Georgi Tushev, Beatriz Alvarez-Castelao, Alexander Heckel,†

Erin M. Schuman†

*These authors contributed equally to this work. †Corresponding author. Email: heckel@uni-frankfurt.de (A.H.); erin.schuman@brain.mpg.de (E.M.S.)

Published 10 February 2017, Science 355, 634 (2017)

DOI: 10.1126/science.aaf8995

This PDF file includes:

Materials and Methods Figs. S1 to S9 Caption for Table S1 Captions for Movies S1 and S2 References

Other Supplementary Material for this manuscript includes the following: (available at www.sciencemag.org/content/355/6325/634/suppl/DC1)

Table S1 Movies S1 and S2

2

Materials and Methods

miRNA expression profiling and estimation of mRNA abundance and binding sites

Hippocampal slices (500 µm) were prepared as previously described (17) from four-

week-old Sprague Dawley (male) rats, housed in standard cages and fed standard lab

chow and water ad libitum. The somatic and the neuropil layer of the CA1 region were

microdissected by hand from each slice and collected in RNAlater (Ambion). Total

RNA was extracted using the Trizol reagent (Invitrogen) and purified using the

miRNeasy Mini Kit (Qiagen) following the manufacturer’s instructions including

the DNaseI digestion. All animal experiments were compliant with the regulations

of German animal care law and the Max Planck Society.

The NanoString nCounter Rat miRNA Expression Assay was used to analyze the expression of 423 rat miRNAs (miRBase 17) in the CA1 neuropil layer. One hundred nanograms of total RNA was used as starting material. Unique oligonucleotides were ligated onto mature miRNAs functioning as miRNA tagging sequences (miRtags).

Capture and reporter probes were hybridized to miRtags for at least 12 hours at 65°C.

Post-hybridization processing was performed using an automated fluidic handling system

(nCounter Prep Station) and data was collected with the nCounter Digital Analyzer by

acquiring images of the immobilized fluorescent reporters with a CCD camera using a 60x

objective. Each reaction contained probes designed against fourteen External RNA

Control Consortium (ERCC) sequences including six positive hybridization controls and

eight negative controls. To account for minor differences in hybridization and

purification efficiencies, raw data was normalized based on the NanoString technical

report, in which the top 25 expressed candidate probes were used to form a normalization

factor between biological replicates. A detection threshold was set at the mean of the

negative spike-in expression plus three times the standard deviation. For the prediction of

the number of mRNA targets, 3’UTR isoforms per gene were identified using the data

provided in rat EST, RNA, Ensembl, RefSeq and XenoRef tables from the UCSC

genome browser (32). Unique 3’UTR isoforms per gene were used for the prediction of

miRNA binding sites using TargetScan5. For estimation of mRNA copy numbers we

considered the fibroblast data of Schwanhausser et al.9

and the increased volume of a

neuron relative to a fibroblast (e.g. average pyramidal neuron volume 14 x 103µm

3,

www.neuromorpho.org). Neuron culture

Sprague-Dawley (Charles River Laboratories) male and female rat pups of postnatal day

0 or 1 were used to prepare dissociated primary hippocampal neurons as previously described (33). Neurons were plated onto poly-D-lysine-coated glass-bottom Petri dishes

(MatTek) at a density of 30 x 103

cells/cm2

for high resolution in situ hybridization, immunostaining, and patch-clamp experiments. The cultures were maintained in Neurobasal-A medium supplemented with B27 and Glutamax-I in a humidified incubator at 37 °C and 5% CO2 for > 2 weeks.

3

High-resolution in situ hybridization and immunostaining

In situ hybridization was performed using the QuantiGene ViewRNA miRNA ISH Cell Assay for Fluorescence miRNA with custom-made probes targeting the loop region of

the pre-miR-181a or pre-miRNA-124-1, a pre-miRNA undetected in synaptosomes (34),

or with a scrambled control probe (GTGTAACACGTCTATACGCCCA (35)), which

does not target any miRNA sequence. The target probes were designed based on the rat

microRNA sequence information from miRBase 21.

Sequence of pre-miR-181a-1 targeted by the probe:

5’ GUUUGGAAUUCAAAUAAAAA 3’

Sequence of pre-miR-124-1 targeted by the probe:

5’ AUUUAAAUGUCCAUACAAUU 3’

Cultured neurons (DIV14-15) were fixed for 1 h at room temperature using a freshly prepared solution containing 4% paraformaldehyde, 5.4% glucose (vol/vol) and 0.01 M

sodium metaperiodate in lysine-phosphate buffer. The manufacturer’s protocol was

applied for in situ hybridization, skipping the dehydration/rehydration and proteinase QS

treatment steps. The target and scrambled probes were diluted to 1:50. For

immunostaining, the neurons were first blocked with 4% goat serum in 1x PBS (blocking

buffer) for 1 h at room temperature. Afterwards, the cells were incubated with MAP2

antibody as a dendritic marker (Sigma, M9942, goat anti-mouse, 1:1000) for 1 h, washed

three times with 1x PBS and treated with secondary antibody (Invitrogen, A21236, Alexa

647-goat anti-mouse) for 1 h at room temperature. Blocking buffer was always treated

with RNase inhibitor (Promega, RNasin® Plus RNase inhibitor, 1:1000) to prevent the

degradation of RNAs. Cells were imaged in 1x PBS without mounting. For in situ

hybridization in hippocampal slices, 4-week-old male rats were perfused with 1x PBS

and 4% (v/v) paraformaldehyde solution in PBS. The hippocampi were dissected, sliced

to 2 mm and fixed for 3 h at room temperature. Slices were cryoprotected in 20% (w/v)

sucrose in PBS (DEPC-treated) overnight at 4 C and cryosectioned at 12 µm thickness. In

situ hybridization was performed as described above with a few modifications. Probes

were diluted to 1:100. After completion of the in situ hybridization, the slices were

blocked for 1 h in blocking buffer. Dendrites were stained overnight at 4 °C using an

anti-MAP2 antibody (gp, SySy 188004, 1:1000 dilution), washed three times with 1x

PBS and incubated with the secondary antibody (Invitrogen, A11008, Alexa 488-goat

anti-gp; 1:1,000 dilution) for 2 h at room temperature. DAPI (1:100 dilution) was added

to one of the following three washing steps with 1x PBS to visualize nuclei. Slices were

mounted in AquaPolymount (Polysciences).

Image acquisition, processing and analysis

Images of neurons and hippocampal slices were acquired using a Zeiss LSM880 confocal

laser fluorescence microscope system in a non-blind manner. Neurons to be imaged were

selected based on their healthy appearance evaluated by MAP2 immunostaining and the

presence of traceable dendrites, not obscured by other neurons. The sample size was

mainly determined by the above criteria. For Dicer KD experiments all transfected cells

with moderate GFP levels were imaged per dish. Z-stack images of confocal planes were

taken at 0.5 µm intervals using a pinhole setting of 30-40 µm and a laser power of 1-

4,5% for 405 nm, 1,8-2,6% for 488 nm and 0,3-0,7% for 561 nm in a 16-bit mode. In situ

images were acquired using a 40×/1.3-NA oil objective (Plan Apochromat 40×/1.3

4

oil DIC UV-IR M27) with a 2048x2048 pixel resolution. The detector gain for the different

channels was set to avoid saturated pixels.

A custom-written MATLAB script was used to determine the particle abundance (Supp

Fig 1 B) in dendrites, which were straightened using ImageJ for in situ hybridization

experiments. The number of particles was normalized to the area of straightened

dendrites. For Dicer KD analysis, Dicer in situ puncta per soma were detected using a

custom built MATLAB script. Only cells with at least one detectable puncta were imaged

and analysed. The normality of the distribution for in situ data was first pre-tested using

D’Agostino & Pearson and Shapiro-Wilk normality tests. One-way Anova corrected for

multiple comparisons (Kruskal-Wallis test) was used to test the statistical significance of

in situ data. Statistical analyses were performed using GraphPad Prism Version 6.0b.

For better visualization in Figures, images were post processed as indicated below, data

analyses were conducted without such processing. Fig 1 C and D: Maximum intensity

projections of representative neurons were median filtered and puncta signal contrast

enhanced. Images for negative ctrl were treated exactly as positive ctrls. Fig 1 E and F:

Maximum intensity projection images of hippocampal CA1 regions were median filtered.

Puncta channel was thresholded and dilated 1x for better puncta visibility. Threshold and

processing was kept constant between pre-miRNA 181a and negative ctrl images. Fig S3

B: Representative images of transfected neurons (maximum intensity projection) were median filtered and contrast enhanced.

Design and choice of the inducible pre-miRNA probe

The inducible pre-miRNA probe was designed based on the native pre-miR-181a sequence obtained from miRBase 21 database. The fluorophore and quencher were

designed to be in close proximity to the known cleavage position. TAMRA-dT and

BHQ2-dT were purchased as phosphoramidites (Link Technologies). The sequence of

two different miRNA probes are shown below. The upper sequence corresponds to the

probe that was successfully cleaved by Dicer and therefore used for this study. The

second probe sequence was not accepted by Dicer and was not used further. Notably,

while the fluorophore TAMRA-dT replaced a U of the native sequence, the quencher

BHQ2-dT was inserted as an additional base as either of the outmost bases of the loop

sequence. The presence of additional secondary structures due to these modifications was

excluded using mfold web server.

pAAC AUU CAA CGC UGU CGG UGA GFU UGG AAU UCA AAU AAQ AAA

CCA UCG ACC GUU GAU UGU ACC (5’3’)

pAAC AUU CAA CGC UGU CGG UGA GFU UQG GAA UUC AAA UAA AAA

CCA UCG ACC GUU GAU UGU ACC (5’3’)

p – terminal Phosphate

F – dTTAMRA

Q – dTBHQ2

The loop sequence is underlined.

miR-181a was chosen based on its abundance in the neuropil and the fact that one of its

targets is CamKII, a protein for which we have ample experience in detecting its

5

nascent version. To identify CamKIIas a miR-181a target, the supplementary data from the Argonaute HITS-CLIP experiment in mouse brain (27) was displayed on UCSC

genome browser (mm8). The Ago-miRNA-mRNA ternary map showed miR-181

binding site on the RefSeq annotated Camk2a 3’UTR. High conservation between mouse and rat was displayed as Vertebrate Multiz Alignment & Conservation. 3'UTR of Camk2a

is positioned on chr18 between the bases 61.110.150-61.113.523 and the miR-181 binding site between 61.113.256-61.113.262.

Solid-phase synthesis

RNA oligonucleotides were synthesized on an ABI 392 or an Expedite (PerSeptive BioSystems) synthesizer using 2’-tBDMS-protected RNA phosphoramidites (Sigma

Aldrich). Modifications such as TAMRA-dT and BHQ2-dT phosphoramidites or

chemical phosphorylation reagents for the introduction of 5’-terminal phosphate moiety

were purchased from Link Technologies Ltd. During the synthesis, all phosphoramidites

were coupled with a 15 min coupling time. The synthesis was performed on 1 µmol CPG

support (Link Technologies). The DMTr-OFF mode was chosen. After the synthesis, the

RNA oligonucleotides were cleaved from the solid support by a mixture of t-

butylamine/water (1:3) for 6 hours at 60 °C. Afterwards the 2’-TBDMS protecting groups

were removed by a mixture of N-methylpyrrolidon (NMP, 300 µL), triethylamin (TEA,

150 µL), and triethylamin-trihydrofluorid (TEA*3HF, 200 µL) for 90 min at 60 °C. To remove fluoride prior to HPLC purification, the oligonucleotide was precipitated in

1.5 mL 1-butanol at -80 °C for at least 4 h. After the synthesis, the RNA oligonucleotides were purified via anion exchange (AE) HPLC (80 °C) with increasing amounts of LiCl (1

M, 0%-100%). It should be noted that all HPLC solutions and buffers were treated with diethylpyrocarbonate (DEPC, 1:1000 dilution (v/v)) in advance to inactivate RNases. After AE-HPLC, the oligonucleotides were desalted, concentrated and further purified

via RP-HPLC. C12 or C18 reversed phase columns were used with 0.1 M TEAA and

acetonitrile. The percentage of the acetonitrile was increased from 5% to 55% within 40 min. The mass of the final product was analyzed by ESI-MS on a Bruker Corporation

micrOTOF-QII: expected mass 21445 Da, found mass 21446 Da.

In vitro Dicer cleavage assay

The tissues from the control (Dicerfl/wt

/DBHiCre+) and Dicer knock-out

(Dicerfl/fl

/DBHiCre+) mice at P1 and E16.5 were kindly provided by Jutta Stubbusch and

Melanie Hennchen from Hermann Rohrer’s lab (23). Two stellate ganglia (STGs)

per mouse were used for the Dicer cleavage assay in which the DBH+ positive cells

lacked Dicer. The tissues were homogenized using a hand-driven grinder in 50 ul 1xPBS

for 1-2 min. For the Dicer cleavage assay, 50 pmol of pre-miR-181a probe was incubated

at 37 °C for 24 h in a shaker (at 300 rpm) in the presence of RNase inhibitor. The reaction

was conducted in Dicer reaction buffer provided by Finnzymes or 1x PBS buffer. The

total reaction volume was 50 µL. The reaction was monitored regularly by

fluorescence measurements. The experiment was replicated a second time with the same

results using control (n = 3) and Dicer knock-out mice (n = 3) at E16.5 (data not shown).

The fluorescence signal was normalized to the maximal fluorescence. The maximal

fluorescence value, which was later set to 1, was measured with samples containing the

probe, cell lysate, but no RNase inhibitor. The resulting fluorescence intensity was

6

comparable to the value of a respective probe amount that was incubated with

commercially available RNase H. This enzyme was purchased from Thermo Fisher

Scientific and applied according to manufacturer’s protocol and the reaction mixture was

treated as described above.

Anti Ago-RNA Immunoprecipitation (RIP)

Hippocampal lysate was prepared from 2 four-week-old Sprague Dawley rats in PBS

containing RNase and protease inhibitors. The pre-miR-181a probe was incubated with

hippocampal lysate (20 µM) at 30 °C for 24 h and the generation of mature miRNA was

examined by fluorescence measurement of Tamra using a Tecan Plate reader (excitation

and emission wavelengths at 540 nm and 580 nm respectively). Probe + PBS and lysate

alone was used as the control. The lysate containing the probe showed enhanced

fluorescence as expected when compared to probe + PBS or lysate alone. Then, Ago IP

was performed using Imprint* RNA Immunoprecipitation kit (Sigma). A protein A bead

suspension (40 µl) was incubated with 200 µl of wash buffer for 2 RIPs (AGO2 or IgG).

After washing once with 200 µl of wash buffer, 5 µg rabbit Anti-Rat IgG antibody (whole

molecule) was added and incubated for 30 min at room temperature. After spinning

briefly the liquid was removed on a magnetic stand and washed twice with wash buffer.

The beads were then resuspended in 200 µl wash buffer and split into 2 X100 µl.

Then, 2.5 µg rat IgG (14131 Sigma) or monoclonal Anti-AGO2 rat

antibody(SAB4200085, Sigma) was added and incubated with rotation for 30 min at RT.

After spinning and washing twice, the wash buffer was completely removed on the

magnetic stand. The prepared beads were suspended in 200 µl IP buffer (wash buffer +

protease inhibitor cocktail + RNAse inhibitor). Now, the lysate containing the mature

probe was mixed with lysis buffer in the ratio of 1:2 and 100 µl of the diluted lysate was

added to resuspended beads and incubated at 4°C with rotation overnight. The beads were

then washed six times and resuspended in 50 µl wash buffer. The association of the

mature probe with the AGO complex was examined by measuring the fluorescence of

the AGO IP and control IgG IP buffers in the Tecan plate reader as described above.

The beads were settled the bottom of the plate using a magnet before measurement.

Four replicates of AGO IP and 2 replicates of IgG IP were used for the analysis (Fig 2C).

Dicer knock-down (KD)

For Dicer KD experiments cells were transfected with shRNA against Dicer or ctrl

shRNA (Qiagen cat. no. KR54104) at DIV 6-8. To assess the extent of Dicer KD neurons

were fixed for 30 min at room temperature in PLP-fix and processed 4-5 days after

transfection for in situ hybridization against rat Dicer 1 (using Affimetrix ViewRNA

Probe, Cat no. VC1- 20711, Quantigene ViewRNA ISH Cell Assay). The protease

treatment was omitted to preserve the GFP signal of the transfected cells. After

completion of the in situ hybridization, the cells were washed with 1x PBS and incubated

in blocking buffer for 1 h. Antibody staining was performed as described above and cells

were imaged in PBS.

7

Electrophysiology

Whole-cell patch clamping was performed in cultured hippocampal neurons (14-18 DIV).

Resistance of the patch pipettes was 4–7 MΩ and experiments with series resistance

lower than 20 MΩ were continued. HEPES buffered artificial cerebrospinal fluid (ACSF,

140 mM NaCl, 1.25 mM NaH2PO4, 3 mM KCl, 2 mM CaCl2, 1 mM MgSO4, 15 mM

glucose, 10 mM HEPES, pH 7.4; ~310 mOsm) solution was used as the extracellular

solution and exchanged with culture media before the experiment started. Potassium gluconate based solution was used as the internal solution (120 mM potassium gluconate,

20 mM KCl, 0.1 mM EGTA, 2 mM MgCl2, 4mM Na2ATP, 0.5 mM GTP, 10 mM

HEPES, 7 mM disodium phosphocreatine, pH 7.2, ~300 mOsm). In depolarization experiments, a cesium-based internal solution (130mM Cesium gluconate, 10 mM sodium phosphocreatine, 4 mM MgCl2, 4 mM Na2ATP, 0.4 mM Na2GTP, 10 mM

HEPES, pH 7.3) was used. 20 µM of the inducible probe and 50 µM Alexa hydrazide

488 were freshly added to the internal solution on the day of the experiment. Neurons

were voltage clamped at −70 mV and series resistance was left uncompensated. To

induce depolarization, a single ramp stimulus was used in current-clamp mode for 5

seconds, which evoked, on average, 12 spikes. To block NMDA receptors, 50 µM APV

was added to the extracellular solution. An Axopatch 200B amplifier was used to acquire

all electrophysiological data and were analyzed offline using Stimfit (36).

Two-photon glutamate uncaging

Time-lapse imaging of the patched neuron was performed at room temperature with an

inverted spinning disk confocal microscope (3i imaging systems; model CSU-X1) Image

acquisition started 2 minutes after patching and images were acquired every 5 minutes or

5 seconds (for depolarization or uncaging experiments, respectively) for a minimum of 30

minutes in each experiment. TAMRA or Alexa hydrazide 488 were excited with the

respective lasers at an exposure time of 50 ms each using LaserStack, 3i imaging systems,

(Model: 3iL33). The fluorescence was collected using a 40x objective (NA 0.09, Zeiss).

Uncaging was performed using a 720 nm laser (Chameleon, Coherent) and a Pockels cell

controlled the uncaging pulses. 4-Methoxy-7-nitroindolinyl-caged-L-glutamate, (MNI

caged glutamate) (1 mM) was added at least 10 min before starting the measurements.

First, an uncaging spot (~2 µm2) close to a spine/dendrite was selected based on its ability

to evoke reliable EPSCs when uncaged (uEPSCs) and the shape of uEPSCs matched the

waveform of the ongoing spontaneous EPSCs (Fig. 3A,B). Then, an uncaging train

protocol (1Hz, 20 pulses, 2 ms individual pulse duration) was given. Experiments were

performed in Mg2+

-free ACSF with 4 mM Ca2+

. The uncaging protocol was synchronized

with electrophysiological acquisition in voltage-clamp at a holding potential of -70 mV

and uEPSCs were automatically recorded. Images for the TAMRA or Alexa signals

were continuously acquired during uncaging every ~370 ms.

Image Analysis

Raw images were used to measure fluorescent changes using ImageJ. First, the mean fluorescence intensity was measured in a region of interest (F) in the soma/dendrite and a nearby background region (F0) and the fluorescence in the region of interest (ROI) was

calculated using the formula (F-F0/F0). This value was normalized to the baseline

8

fluorescence value (fluorescence at 2 min after membrane rupture) for each time point

and the change in fluorescence over time was calculated (Fig 2G,H). The background

fluorescence was taken from three different regions close to the ROI and averaged. The

Alexa channel was used as the structural reference for drawing ROIs. The dendritic ROIs

were chosen at a distance of ~100 µm from the cell body. In glutamate uncaging

experiments, ROIs were drawn in the spine head and/or the shaft region close to the

uncaging spot. For calculating the spread of fluorescence from the point of uncaging, a

MATLAB script was written to generate a kymograph of distance versus intensity and

the width at which the fluorescence change was 10% higher than the baseline

fluorescence was measured.

Puro-PLA Labeling

For puromycylation, neurons were incubated with (or in ‘no puro’ controls, without)

3µM puromycin during the whole cell recording for 30 - 38 min in ACSF at room temperature. Glutamate uncaging was usually performed in the middle of the puromycin

incubation period, 62-115 µm (dendritic distance) from the soma. After the incubation

period, the patch pipette was carefully removed. Incubation was stopped by two fast

washes in PBS-MC and cells were fixed for 10 min in 4 % PFA-sucrose. After fixation,

cells were stored in PBS over night at 4 °C, permeabilized (0.5% TritonX-100 in

blocking buffer for 15 min), blocked in blocking buffer (4% goat serum in PBS, 1 h) and

incubated with primary antibody pairs for PLA diluted in blocking buffer (1.5 h at room

temperature, rb anti-CamKIIMillipore 1:1100, ms anti-Puromycin Kerafast 1:3500).

The puro-PLA procedure was carried out as previously described (25). Briefly, PLA

probes were applied at a 1:10 dilution in blocking buffer for 1 h at 37 °C, washed several

times with wash buffer A (0.01 M Tris, 0.15 M NaCl, 0.05% Tween20) and incubated for

30 min with the ligation reaction containing the circularization oligos and T4 ligase

prepared according to the manufacturer’s recommendations in a pre-warmed humidified

chamber at 37 °C. Amplification and label probe binding was performed after further

washes with wash buffer A with the amplification reaction mixture containing Phi29

Polymerase and the fluorophore-labeled detection oligo prepared according to the

manufacturer’s recommendations (Duolink Detection reagents Far Red, Sigma) in a pre-

warmed humidified chamber at 37 °C for 100 min. Amplification was stopped by washes

in 0.2 M Tris, 0.1 M NaCl, pH 7.5 followed by washes in PBS pH 7.4. For better signal

stability, cells were post-fixed for 7 min at room temperature in PFA-sucrose, washed

with PBS and processed further for immunohistochemistry. Cells were blocked with 4%

goat serum in PBS for 1 h followed by incubation with the respective antibodies for

cell markers (anti-MAP2 gp 1:2000, SySY 188004), washed in PBS and fluorophore-

coupled secondary antibodies (anti gp Dylight 405, Jackson Immunological 706475148)

for 45 min. Samples were imaged soon after the experiment in PBS and stored at 4 °C.

In GFP reporter experiments cultured hippocampal neurons were transfected (using

Lipofectamin/Magnetofectamin) at DIV 11-15 with 0.25-0.5 µg per dish with the reporter

construct (CamK2promotor-acGFP-CamK2long 3'UTR or short 3'UTR respectively). 15-25 h posttransfection, uncaging experiments were conducted as described in the previous section (see also Supplementary Fig. 6 C and D for experimental flow) with the following differences: Cells were incubated for 20 min total with Puromycin (6 µM)

9

(including a pretreatment of 12 min of Puromycin before uncaging). Uncaging was

performed at 32 - 108 µm distance from the soma. Puro-PLA for newly synthesized GFP

was performed using anti Puromycin mouse antibody from Kerafast (EQ0001, 1:3500)

and anti GFP rabbit antibody from Life Technologies (A11122, 1:1500).

For Dicer KD current injection experiments (Fig 2, S5) cells were transfected 0.8 ug of

Dicer shRNA or ctrl shRNA respectively tagged with GFP at DIV 6-8 and patch

experiments were performed in transfected GFP positive neurons at DIV 12-14. For

Dicer KD uncaging experiments (Fig 3, 4 and S8) cells were co-transfected with 0.25 ug

of CamKIIpromoter-acGFP-CamK2 long 3'UTR construct and 0.8 ug of Dicer

shRNA or ctrl shRNA respectively (where GFP was removed via cloning to only label

newly synthesized GFP arising from the 3'UTR construct, see also Supp Fig 6 C and D

for experimental flow). 1 outlier was removed in the experiments with the long 3'UTR

because it was more than 5 SEM away from the mean.

Puro-PLA Imaging and Analysis

Images were acquired with a LSM780 and 880 confocal microscope (Zeiss) using a 40x 1.4 NA oil objective (Plan Apochromat 40x/1.4 oil DIC M27) and a pinhole setting of 32

µm. Images were acquired in 12 bit mode as Z-stacks with 2048 x 2048 resolution through the entire thickness of the neuron with optical slice thickness of 0.45 µm, pixel

dwell times of 0.64 µs and the detector gain in each channel was adjusted to cover the

full dynamic range but to avoid saturated pixels. Imaging conditions were constant within

an experiment. Maximum intensity projections were analysed in ImageJ. Only healthy

neurons with PLA density higher than no Puromycin background controls were subjected

to analysis. The PLA signal intensity along the dendrites was plotted using the

segmented line tool.

To display the change in signal intensity around the uncaging spot, segmental analysis was performed to capture the local reduction near the uncaging spot. The uncaging

segment was defined as the region around the uncaging spot (10 and 20 µm for GFP and

endogenous CamKIIexperiments, respectively) with the central spot in the middle. The

proximal segment was of the same length and located upstream of the uncaging segment.

Average PLA intensities in uncaging segment were normalized to the values of proximal

segment. As control, a segment of dendrite from the same cell with the same distance

from the soma, which did not undergo uncaging, was analyzed (Fig 4). The normality of

the distribution was first pre-tested using D’Agostino & Pearson and Shapiro-Wilk

normality tests. AMann-Whitney U test was used to test the statistical significance.

Statistical analyses were performed using GraphPad Prism.

Statistical analysis

Data are presented as mean ± standard error of measurement (s.e.m.) unless otherwise indicated. Statistical significance was assessed using repeated measures one-way

ANOVA or two–way ANOVA with multiple comparisons in the imaging experiments, or

t-test in other experiments. Graphpad Prism was used for all statistical analyses.

10

Fig. S1. High resolution in situ hybridization analysis in cultured hippocampal

neurons. (A) Representative in situ hybridization image using a probe directed against

the loop region of pre-miR-181a (upper left) shows the localization of pre-miR-181a

(green) in the soma and dendrites of a cultured hippocampal neuron. Anti-MAP2

immunostaining (magenta) identifies the dendrites. Using a probe targeting pre-miR-124-

1 (upper right), a pre-miRNA not detected in synaptosomes (34), a scrambled control

probe (lower right) or no probe (lower left) shows low background signal in the dendrites.

Scale bar, 20 µm. (B) Analysis of pre-miRNA-181a in dendrites relative to pre-miRNA-

124-1, scrambled probe control and (-) probe control. Each dot represents the particle

11

abundance of a pre-miRNA in one dendrite (mean+/- sem n = 31, 17, 28, and 32, for pre-

miR-181a, pre-miR-124-1, no probe control and scrambled control respectively

****p<0.0001).

11

Fig. S2. In situ hybridization of pre-miR-181a and mature miRNA-181a.

(A) Representative in situ hybridization image of pre-miR-181a in the CA1 region of a

hippocampal slice (right panel: magnification of the boxed dendritic region). In situ

signal is abundant in soma and neuropil layer and shows very low signal in the scrambled

control (B). (C) Representative in situ hybridization image of miR-181a in the CA1

region of a hippocampal slice (right panel: magnification of the boxed dendritic region).

In situ signal is abundant in soma and neuropil layer and shows very low signal in the

leave-out (no probe added) control (D). Scale bars all 50 µm.

12

Fig. S3. Efficient Dicer knockdown after shRNA transfection.

(A) Representative images of neurons transfected with shRNA for Dicer (upper panel) or

control shRNA (lower panel) respectively and in situ hybridization for Dicer mRNA

(white). shRNA-transfected neurons show GFP signal (blue), untransfected cells are

labeled only with an anti-MAP2 antibody (magenta). Note the reduction of Dicer mRNA

only in shRNA transfected cells. Scale bar, 20 µm. (B) Group analysis of Dicer mRNA

per neuronal somata (n = 83 and 76 for shRNA transfected and ctrl transfected neurons

respectively from 1-2 independent experiments, Kruskal-Wallis-test, ***p<0.0001,

median and quartiles are shown).

13

Fig. S4. Glutamate uncaging experiments and electrophysiological properties.

(A) Scheme of the whole-cell recording showing the delivery of the pre-miR-181a probe

into the neuron along with the tracer dye, Alexa 488. (B) Image of an Alexa dye-filled

neuron. Scale bar, 20 µm. (C) Representative responses of a recorded neuron to a train of

20 uncaging events (1 Hz, pulse duration = 2 ms). (D) Intrinsic and synaptic properties

of the transfected and non-transfected neurons included in the analysis for Fig. 4, mean

+/- sem.

14

Fig. S5. Activity-dependent pre-miR-181a probe fluorescence increase is blocked by

Dicer knock-down. (A) The GFP images (green) of shRNA against Dicer and control

transfected recorded neurons are shown on the left. Time-lapse images of pre-miR-181a

probe fluorescence are shown on the right. In control transfected neurons (lower panel)

an increase in pre-miR-181a probe fluorescence in the soma (white dotted line) and

dendrites was detectable over the time-course of 30 min after depolarization at t = 7 min

(arrow). This stimulation- induced increase was significantly reduced in Dicer knock-

down neurons. Scale bar, 20 µm. (B) Group analysis of neuronal somata (left) and

dendrites (right) showing the significant (**p<0.01; one-way ANOVA, n = 8 for control

and ***p<0.001, n = 8 for Dicer KD respectively) increase in pre-miR-181a probe

fluorescence in control neurons when compared with Dicer KD neurons following

stimulation. There was a tendency for Dicer KD neurons to exhibit reduced

fluorescence prior to the onset of stimulation as well. Error bars represent s.e.m.

15

Fig. S6. Detection of newly synthesized CamKIIor GFP.

(A) Scheme depicting the method used to detect newly synthesized CamKII or GFP.

Puromycin treatment labels nascent polypeptide chains that can be detected with an anti-

puromycin antibody (pink). Together with treatment with an anti-CamKII or anti-GFP

antibody (blue) newly synthesized CamKII or GFP molecules are labeled that can be

detected using the proximity-ligation assay (PLA) (see 25). (B) Experimental scheme

used to label newly synthesized CamKIIduring which local glutamate uncaging was

performed, leading to maturation and local generation of miR-181a and subsequent puro-

PLA detection. (C) Experimental scheme used to label newly synthesized GFP during local

glutamate uncaging in reporter experiments shown in Fig 4 F-H. (D) Protocol used for

Dicer knock-down experiments shown in Fig 4 G.

16

Fig. S7. Controls for experiments in which the synthesis of miR-181a mRNA targets

is examined. (A) No increase in pre-miR-181a probe fluorescence is detected following

light stimulation alone (no caged glutamate present). Left, Alexa image of a patched

neuron indicating the photostimulated spot inside the box. Right, time-lapse images of

the zoomed-in dendritic segment during the uncaging train scale bar, 20 and 2 µm. (B)

Summary of fluorescence change by light alone (normalized mean +/- sem of 8 cells).

(C) Absence of local reduction in Puro-PLA signal by photostimulation alone (no caged

glutamate present). Images of a representative transfected neuron (left) and nascent GFP

after Puro-PLA staining in the same neuron with the uncaged spot indicated. No

reduction in newly synthesized GFP particles was observed at the uncaged and adjacent

region by photostimulation alone (compare analysis in Fig. 4F-H) scale bar, 20 µm. (D)

Summary line graph and scatter plot showing the lack of change in nascent GFP

fluorescence following photostimulation in the absence of caged glutamate (mean +/-

sem, n = 8).

17

Fig. S8. Absence of local reduction in target protein synthesis after glutamate

uncaging on protein synthesis in Dicer knock-down neurons. (A) Image of a

recorded neuron transfected with the GFP- CamKII3’UTR construct showing the

glutamate uncaging spot (red arrow), scale bar, 20 µm. (B) Time lapse images of the

pre-miR-181a fluorescence in the straightened dendritic segment shown as insert in A.

Arrowhead indicates the uncaging spot, note the absence of local probe fluorescence

increase at the uncaging spot. (C) Image showing the newly synthesized GFP particles in

the Dicer KD neuron following labeling with puromycin. Note that there is no local

reduction in GFP synthesis due to glutamate uncaging (group analysis in Fig 4 H, n = 6).

18

Fig. S9. No effect of glutamate uncaging on target local protein synthesis in the

absence of the miR-181a seed region in the reporter construct. (Left) Image of a

recorded neuron transfected with the GFP-CamKII3’UTR containing the miR-181a

seed (top) or with a construct lacking the miR-181a seed region in the 3’UTR (bottom).

Yellow arrow shows the glutamate uncaging spot. (Right) Image of the nascent GFP

synthesized in the neurons on the left. A paucity of newly synthesized GFP is observed in

the region of uncaging in the top neuron whereas no local effect is observed in the bottom

neuron (n= 9 and 6 for the top and bottom experiments, group analysis in Fig 4 F and H,

scale bar, 20 µm).

19

Table S1

List of all miRNA counts measured in three hippocampal CA1 Neuropil replicates using

NanoString. Movie S1

Video of a neuron filled with the pre-miRNA-181a probe. Uncaging spot adjacent to

the dendritic shaft is shown as a small white box. The total duration of the video is 25

seconds, the uncaging of MNI-glutamate is stimulated (1 Hz) from seconds 2-21. Movie S2

Video of a neuron filled with the pre-miRNA-181a probe. Uncaging spot adjacent to

the dendritic spine is shown as a small white box. The total duration of the video is 30

seconds, the uncaging of MNI-glutamate is stimulated (1 Hz) from seconds 6-25.

References and Notes 1. D. P. Bartel, MicroRNAs: Target recognition and regulatory functions. Cell 136, 215–233

(2009). doi:10.1016/j.cell.2009.01.002 Medline

2. Y. Lee, C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O. Rådmark, S. Kim, V. N. Kim, The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415–419 (2003). doi:10.1038/nature01957 Medline

3. E. Bernstein, A. A. Caudy, S. M. Hammond, G. J. Hannon, Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363–366 (2001). doi:10.1038/35053110 Medline

4. S. Griffiths-Jones, H. K. Saini, S. van Dongen, A. J. Enright, miRBase: Tools for microRNA genomics. Nucleic Acids Res. 36, D154–D158 (2007). doi:10.1093/nar/gkm952 Medline

5. V. Agarwal, G. W. Bell, J. W. Nam, D. P. Bartel, Predicting effective microRNA target sites in mammalian mRNAs. eLife 4, e05005 (2015). doi:10.7554/eLife.05005 Medline

6. L. P. Lim, N. C. Lau, P. Garrett-Engele, A. Grimson, J. M. Schelter, J. Castle, D. P. Bartel, P. S. Linsley, J. M. Johnson, Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433, 769–773 (2005). doi:10.1038/nature03315 Medline

7. M. J. Kye, T. Liu, S. F. Levy, N. L. Xu, B. B. Groves, R. Bonneau, K. Lao, K. S. Kosik, Somatodendritic microRNAs identified by laser capture and multiplex RT-PCR. RNA 13, 1224–1234 (2007). doi:10.1261/rna.480407 Medline

8. U. Bissels, S. Wild, S. Tomiuk, A. Holste, M. Hafner, T. Tuschl, A. Bosio, Absolute quantification of microRNAs by using a universal reference. RNA 15, 2375–2384 (2009). doi:10.1261/rna.1754109 Medline

9. B. Schwanhäusser, D. Busse, N. Li, G. Dittmar, J. Schuchhardt, J. Wolf, W. Chen, M. Selbach, Global quantification of mammalian gene expression control. Nature 473, 337–342 (2011). doi:10.1038/nature10098 Medline

10. C. E. Holt, E. M. Schuman, The central dogma decentralized: New perspectives on RNA function and local translation in neurons. Neuron 80, 648–657 (2013). doi:10.1016/j.neuron.2013.10.036 Medline

11. G. M. Schratt, F. Tuebing, E. A. Nigh, C. G. Kane, M. E. Sabatini, M. Kiebler, M. E. Greenberg, A brain-specific microRNA regulates dendritic spine development. Nature 439, 283–289 (2006). doi:10.1038/nature04367 Medline

12. M. L. Baudet, K. H. Zivraj, C. Abreu-Goodger, A. Muldal, J. Armisen, C. Blenkiron, L. D. Goldstein, E. A. Miska, C. E. Holt, miR-124 acts through CoREST to control onset of Sema3A sensitivity in navigating retinal growth cones. Nat. Neurosci. 15, 29–38 (2012). doi:10.1038/nn.2979 Medline

13. M. van Spronsen, E. Y. van Battum, M. Kuijpers, V. R. Vangoor, M. L. Rietman, J. Pothof, L. F. Gumy, W. F. J. van Ijcken, A. Akhmanova, R. J. Pasterkamp, C. C. Hoogenraad, Developmental and activity-dependent miRNA expression profiling in primary

hippocampal neuron cultures. PLOS ONE 8, e74907 (2013). doi:10.1371/journal.pone.0074907 Medline

14. Y. Sasaki, C. Gross, L. Xing, Y. Goshima, G. J. Bassell, Identification of axon-enriched microRNAs localized to growth cones of cortical neurons. Dev. Neurobiol. 74, 397–406 (2014). doi:10.1002/dneu.22113 Medline

15. V. M. Ho, L. O. Dallalzadeh, N. Karathanasis, M. F. Keles, S. Vangala, T. Grogan, P. Poirazi, K. C. Martin, GluA2 mRNA distribution and regulation by miR-124 in hippocampal neurons. Mol. Cell. Neurosci. 61, 1–12 (2014). doi:10.1016/j.mcn.2014.04.006 Medline

16. G. K. Geiss, R. E. Bumgarner, B. Birditt, T. Dahl, N. Dowidar, D. L. Dunaway, H. P. Fell, S. Ferree, R. D. George, T. Grogan, J. J. James, M. Maysuria, J. D. Mitton, P. Oliveri, J. L. Osborn, T. Peng, A. L. Ratcliffe, P. J. Webster, E. H. Davidson, L. Hood, K. Dimitrov, Direct multiplexed measurement of gene expression with color-coded probe pairs. Nat. Biotechnol. 26, 317–325 (2008). doi:10.1038/nbt1385 Medline

17. I. J. Cajigas, G. Tushev, T. J. Will, S. tom Dieck, N. Fuerst, E. M. Schuman, The local transcriptome in the synaptic neuropil revealed by deep sequencing and high-resolution imaging. Neuron 74, 453–466 (2012). doi:10.1016/j.neuron.2012.02.036 Medline

18. G. Lugli, J. Larson, M. E. Martone, Y. Jones, N. R. Smalheiser, Dicer and eIF2c are enriched at postsynaptic densities in adult mouse brain and are modified by neuronal activity in a calpain-dependent manner. J. Neurochem. 94, 896–905 (2005). doi:10.1111/j.1471-4159.2005.03224.x Medline

19. S. Bicker, S. Khudayberdiev, K. Weiß, K. Zocher, S. Baumeister, G. Schratt, The DEAH-box helicase DHX36 mediates dendritic localization of the neuronal precursor-microRNA-134. Genes Dev. 27, 991–996 (2013). doi:10.1101/gad.211243.112 Medline

20. R. Saba, P. H. Störchel, A. Aksoy-Aksel, F. Kepura, G. Lippi, T. D. Plant, G. M. Schratt, Dopamine-regulated microRNA MiR-181a controls GluA2 surface expression in hippocampal neurons. Mol. Cell. Biol. 32, 619–632 (2012). doi:10.1128/MCB.05896-11 Medline

21. G. Lugli, V. I. Torvik, J. Larson, N. R. Smalheiser, Expression of microRNAs and their precursors in synaptic fractions of adult mouse forebrain. J. Neurochem. 106, 650–661 (2008). doi:10.1111/j.1471-4159.2008.05413.x Medline

22. B. P. Davies, C. Arenz, A fluorescence probe for assaying micro RNA maturation. Bioorg. Med. Chem. 16, 49–55 (2008). doi:10.1016/j.bmc.2007.04.055 Medline

23. J. Stubbusch, P. Narasimhan, M. Hennchen, K. Huber, K. Unsicker, U. Ernsberger, H. Rohrer, Lineage and stage specific requirement for Dicer1 in sympathetic ganglia and adrenal medulla formation and maintenance. Dev. Biol. 400, 210–223 (2015). doi:10.1016/j.ydbio.2015.01.026 Medline

24. M. J. Kye, P. Neveu, Y.-S. Lee, M. Zhou, J. A. Steen, M. Sahin, K. S. Kosik, A. J. Silva, NMDA mediated contextual conditioning changes miRNA expression. PLOS ONE 6, e24682 (2011). doi:10.1371/journal.pone.0024682 Medline

25. S. tom Dieck, L. Kochen, C. Hanus, M. Heumüller, I. Bartnik, B. Nassim-Assir, K. Merk, T. Mosler, S. Garg, S. Bunse, D. A. Tirrell, E. M. Schuman, Direct visualization of newly synthesized target proteins in situ. Nat. Methods 12, 411–414 (2015). doi:10.1038/nmeth.3319 Medline

26. M. K. Bennett, N. E. Erondu, M. B. Kennedy, Purification and characterization of a calmodulin-dependent protein kinase that is highly concentrated in brain. J. Biol. Chem. 258, 12735–12744 (1983). Medline

27. S. W. Chi, J. B. Zang, A. Mele, R. B. Darnell, Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature 460, 479–486 (2009). Medline

28. M. A. Sutton, N. R. Wall, G. N. Aakalu, E. M. Schuman, Regulation of dendritic protein synthesis by miniature synaptic events. Science 304, 1979–1983 (2004). doi:10.1126/science.1096202 Medline

29. G. Schratt, microRNAs at the synapse. Nat. Rev. Neurosci. 10, 842–849 (2009). doi:10.1038/nrn2763 Medline

30. K. Wibrand, D. Panja, A. Tiron, M. L. Ofte, K.-O. Skaftnesmo, C. S. Lee, J. T. G. Pena, T. Tuschl, C. R. Bramham, Differential regulation of mature and precursor microRNA expression by NMDA and metabotropic glutamate receptor activation during LTP in the adult dentate gyrus in vivo. Eur. J. Neurosci. 31, 636–645 (2010). doi:10.1111/j.1460-9568.2010.07112.x Medline

31. Y. Ouyang, A. Rosenstein, G. Kreiman, E. M. Schuman, M. B. Kennedy, Tetanic stimulation leads to increased accumulation of Ca2+/calmodulin-dependent protein kinase II via dendritic protein synthesis in hippocampal neurons. J. Neurosci. 19, 7823–7833 (1999). Medline

32. D. Karolchik, A. S. Hinrichs, T. S. Furey, K. M. Roskin, C. W. Sugnet, D. Haussler, W. J. Kent, The UCSC Table Browser data retrieval tool. Nucleic Acids Res. 32, D493–D496 (2004). doi:10.1093/nar/gkh103 Medline

33. G. Aakalu, W. B. Smith, N. Nguyen, C. Jiang, E. M. Schuman, Dynamic visualization of local protein synthesis in hippocampal neurons. Neuron 30, 489–502 (2001). doi:10.1016/S0896-6273(01)00295-1 Medline

34. G. Siegel, G. Obernosterer, R. Fiore, M. Oehmen, S. Bicker, M. Christensen, S. Khudayberdiev, P. F. Leuschner, C. J. L. Busch, C. Kane, K. Hübel, F. Dekker, C. Hedberg, B. Rengarajan, C. Drepper, H. Waldmann, S. Kauppinen, M. E. Greenberg, A. Draguhn, M. Rehmsmeier, J. Martinez, G. M. Schratt, A functional screen implicates microRNA-138-dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. Nat. Cell Biol. 11, 705–716 (2009). doi:10.1038/ncb1876 Medline

35. X. You, I. Vlatkovic, A. Babic, T. Will, I. Epstein, G. Tushev, G. Akbalik, M. Wang, C. Glock, C. Quedenau, X. Wang, J. Hou, H. Liu, W. Sun, S. Sambandan, T. Chen, E. M. Schuman, W. Chen, Neural circular RNAs are derived from synaptic genes and regulated by development and plasticity. Nat. Neurosci. 18, 603–610 (2015). doi:10.1038/nn.3975 Medline

36. S. J. Guzman, A. Schlögl, C. Schmidt-Hieber, Stimfit: Quantifying electrophysiological data with Python. Front. Neuroinform. 8, 16 (2014). doi:10.3389/fninf.2014.00016 Medline