the effects of mir-20a on p21: two mechanisms blocking ...-j-cell... · 1molecular genetics of...

The Effects of miR-20a on p21:Two Mechanisms BlockingGrowth Arrest inTGF-b-Responsive ColonCarcinomaVIKTORIJA SOKOLOVA,1,2 ANTONIO FIORINO,3 EUGENIO ZONI,1,2 ELISABETTA CRIPPA,1,2

JAMES F. REID,1,2 MANUELA GARIBOLDI,1,2* AND MARCO A. PIEROTTI41Molecular Genetics of Cancer, Fondazione Istituto FIRC di Oncologia Molecolare, Milano, Italy2Department of Experimental Oncology and Molecular Medicine, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy3Department of Predictive and Preventive Medicine, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy4Scientific Directorate, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy

Loss of response to TGF-b is a central event in the genesis of colorectal cancer (CRC), a disease that, in the majority cases, is refractory togrowth inhibition induced by this cytokine. However, inactivating mutations at receptors and transducers from the TGF-b cascade occuronly in approximately half of CRCs, suggesting the involvement of additional mechanisms altering the response to the cytokine. We haverecently described the amplification of the 13q31 locus, where the miR-17–92 cluster maps, associated with overexpression of itsmembers. In this study, we address the potential role of miR-20a, from the miR-17–92 cluster, in the suppression of TGF-b cytostaticresponse in CRC. Using the poorly tumorigenic and TGF-b-sensitive FET cell line that expresses low miR-20a levels, we first confirmedthat miR-20a downmodulated CDKN1A expression, both at mRNA and protein level, through direct binding to its 30-UTR. Wedemonstrated that miR-20a significantly diminished cell response to TGF-b by preventing its delay of G1/S transition and promotingprogression into cell cycle. Moreover, besides modulating CDKN1A, miR-20a blocked TGF-b-induced transactivation of its promoterwithout affecting the post-receptor activation of Smad3/4 effectors directly. Finally, miR-20a abrogated the TGF-b-mediated c-Mycrepression, a direct inhibitor of the CDKN1A promoter activation, most likely by reducing the expression of specific MYC-regulating genesfrom the Smad/E2F-based core repressor complex. Our experiments indicate that miR-20a interferes with the colonic epitheliumhomeostasis by disrupting the regulation of Myc/p21 by TGF-b, which is essential for its malignant transformation.J. Cell. Physiol. 230: 3105–3114, 2015. © 2015 Wiley Periodicals, Inc.

Despite progress in the understanding of this disease,colorectal cancer (CRC) still is the third most common and thesecond deadliest cancer in theWestern Countries (Jemal et al.,2011). Detailed pathological and molecular analyses describedCRC development in terms of a sequence of genetic eventsleading to a progressive transition from early adenoma toinvasive carcinoma (Fearon and Vogelstein, 1990). Laterversions of this model have contributed to the currentknowledge of the multiple genetic and epigenetic alterations ofcritical genes and pathways promoting transformation ofcolonic epithelial cells and progression to malignancy, such asthe Wnt/b-catenin, RAS-MAPK, PI3K, p53, DNA mismatchrepair, and TGF-b pathway (Fearon, 2011). Molecularalterations of CRC are highly heterogeneous, but only a fewspecific events appear to drive its progression; among them,alterations in genesmediating the tumor suppressor function ofTGF-b in colonic epithelium are largely represented. Mutationsat TGFBR2, ACVR2, and their SMAD effectors occur at asignificant frequency (Lao and Grady, 2011; Network, 2012;Lawrence et al., 2014), and TGFBR2, together with KRASmutations is associated with late adenoma malignanttransformation (Grady et al., 1998). Allelic losses at 18q arm,where SMAD2/4/7 genes are located, occur in up to 60% of thespecimens (Ogino et al., 2009) and contribute to overcomeTGF-b-mediated growth suppression. TGF-b role as regulatorof homeostasis and differentiation strongly depends on thecellular context and microenvironment (Massague, 2012). In

normal epithelial cells, TGF-b predominantly functions as atumor suppressor, promoting growth arrest and pro-apoptoticeffects. Growth arrest involves the repression of growthpromoting factors, such as the MYC proto-oncogene, (Mulderet al., 1988) and the consequent activation of cyclin-dependentkinase (CDK) inhibitors, such as CDKN1A (p21/WAF1) andCDKN2B (p15) (Hannon and Beach, 1994; Datto et al., 1995,Reynisdottir et al., 1995; Claassen and Hann, 2000). MYCdownregulation is mediated by a TGF-b-activated repressor

Manuela Gariboldi and Marco A. Pierotti are the co-last authors.

Contract grant sponsor: Associazione Italiana per la Ricerca sulCancro (AIRC);Contract grant numbers: 10529, 12162.

Correspondence to: Manuela Gariboldi, Department ofExperimental Oncology and Molecular Medicine, FondazioneIRCCS Istituto Nazionale dei Tumori, Milan, Italy.E-mail address: [email protected]

Manuscript Received: 23 September 2014Manuscript Accepted: 19 May 2015

Accepted manuscript online in Wiley Online Library(wileyonlinelibrary.com): 26 May 2015.DOI: 10.1002/jcp.25051

ORIGINAL RESEARCH ARTICLE 3105J o u r n a l o fJ o u r n a l o f

CellularPhysiologyCellularPhysiology

© 2 0 1 5 W I L E Y P E R I O D I C A L S , I N C .

complex consisting of Smad3, E2F4/5, and p107 proteins thatbinds the TIE (TGF-inhibitory element) region of the MYCpromoter thus preventing its transcriptional activation (Chenet al., 2002). Both WNT signaling activation and TGF-binactivation, mostly occurring at early stages of carcinogenesis,converge on transcriptional activation of MYC, which in turnrepresses CDK inhibitors (Claassen and Hann, 2000; Stalleret al., 2001; Seoane et al., 2002). Paradoxically, TGF-b can alsoexert oncogenic properties by favoring cell invasion, cancergrowth and progression when overexpressed by local tumorcells (Stearns et al., 1999; Hasegawa et al., 2001; Massague,2012). Loss of growth inhibitory response to TGF-b andconversion of TGF-b into an oncogenic pathway occur in morethan 70% of CRC cell lines (Grady et al., 1999). However,inactivating mutations at receptors and transducers of TGF-bpathway have been found only in less than half of CRCs, even ifthe majority of them fail to respond to the growth inhibitionstimuli induced by TGF-b (Grady et al., 1998; Grady et al., 1999;Ando et al., 2005). These findings indicate the presence ofalternative events involved in the malignant transformation ofTGF-b, and in this context, the contribution of epigeneticalterations, as well as changes in microRNAs (miRNAs)expression, may modify the responsiveness to TGF-b(Okayama et al., 2012). miRNAs are a class of small non-codingRNAs that regulate mRNA stability through sequence-specificinteractions with their 30-untranslated region (30-UTR),resulting in target mRNA cleavage or inhibition of translation(Lewis et al., 2005).

miRNAs are deregulated in all cancers, including CRC,where they can control expression of crucial genes from theVogelstein model, as well as members of the TGF-b signalingcascade (Slaby et al., 2009; Mestdagh et al., 2010). Theabrogation of the cytostatic effect of TGF-b by miR-106-25cluster in responsive gastric cell lines through a mechanismtargeting the CDKN1A 30-UTR suggested that its paralog, themiR-17-92 cluster, can have a similar effect (Petrocca et al.,2008).We previously reported that the chr13q31 locus, wherethe miR-17–92 cluster maps, is frequently amplified in CRCspecimens (Reid et al., 2009), and we also reported acorrelation of 13q31 amplification with the expression levels ofthe six miRNAs from the cluster (miR-17, miR-18a, miR19a,miR-19b-1, miR-20a, and miR-92a-1) (Reid et al., 2012).

Based on these findings, we hypothesized a potentialinvolvement of miR-20a, a paralog of miR-106b, in theinactivation of TGF-b-mediated growth suppression in CRC.Using a TGF-b-responsive CRC cell line, we examined theeffects of miR-20a on TGF-b signaling and we confirmed thatthe impairment of the p21 expression by this miRNA is criticalfor the reversal of the growth arrest induced by the cytokine.We confirmed the direct binding of miR-20a to CDKN1A30-UTR and identified an additional mechanism, governed bythis miRNA, that disrupts TGF-b-mediated p21/MYCregulation and ultimately impacts on the CDKN1A promotertransactivation. Our findings suggest that distinct miR-20atargets converge on the p21 regulation leading to thebreakdown of cell homeostatic control.

Materials and MethodsCell lines

FET, colon carcinoma cell line, kindly provided by Dr. Michael G.Brattain (University of Nebraska Medical Center, Nebraska, USA)was grown in DMEM/F12 medium supplemented with 10% fetalbovine serum. All the other cell lines used (FET, FHs 74 Int,SW837, SW1116, HCT 116, Caco-2, T84, DLD-1, SW-480,SW1463, HT-29, COLO 205, SW-620, and HEK293T) wereobtained from the American Type Culture Collection and grownin their appropriate media in a humidified incubator with 5% CO2at 37°C.

RNA extraction and real-time qPCR

Total mRNA, including small RNA, was extracted using the Trizolreagent (Invitrogen, Carlsbad, CA) according to themanufacturer’s protocol. Briefly, 30 ng of total RNA were reversetranscribed to cDNA in a final volume of 15mL using aHigh-Capacity cDNA Reverse Transcription Kit andmiRNA-specific primers (Applied Biosystems, Foster City, CA)according to the manufacturer’s instructions. qPCR was doneusing the FAST chemistry (Applied Biosystems) with themanufacturer provided miRNA-specific assay (hsa-miR-20a-5p,#000580) in ABI PRISM 7900 HT Real-Time PCR system (AppliedBiosystems). The expression values of miR-20a were normalizedto RNU6B (#001093). For gene expression analysis, cDNA wassynthesized from 500 ng of total RNA and qPCR was carried outwith gene-specific assays for CDKN1A (hs00355782_m1), E2F5(hs00231092_m1), KLF11 (hs00231614_m1) and RBL1(Hs00765700_m1). The expression levels of the genes analyzedwere normalized to GUSB (hs99999908_m1). Data analysis wasdone using the Sequence Detector version SDS 2.1.

MicroRNA precursor transfection

For transient transfection, FET cells were plated at 30–40%confluence and transfected with Lipofectamine RNAiMAX(Invitrogen) according to the manufacturer’s instructions.Pre-miR-20a (Pre-miRTM miRNA Precursor Moleculehsa-miR-20a, ID: PM10057, mature sequence:UAAAGUGCUUAUAGUGCAGGUAG; Ambion, Foster City,CA) and pre-miR negative control (scramble) (Pre-miRTMmiRNA Precursor Molecule, Negative Control #1, ID:AM17110; Ambion) were transfected at a final concentration of50 nmol/L. Twelve hours after transfection cells were treated with5 ng/ml of recombinant human TGF-b1 (R&D Systems,Minneapolis, MN). Total RNA/protein lysates were collected 48 hafter transfection.

Proliferation assays and cell-cycle analysis

For bromodeoxyuridine (BrdU) incorporation assay, cells wereseeded in 8-well Lab-Tek chamber slides (ThermoScientific,Waltham, MA) at 30–40% of confluence and then transfected withmiR-20a or negative control precursors as described above.Twelve hours after transfection cells were treated with 5 ng/mlTGF-b. After 30 h of stimulation with the cytokine, cells wereincubated for 6 h in presence of 100mMBrdU (R&D Systems). TheBrdU incorporation was evaluated by immunofluorescencestaining with anti-BrdU antibody (347580; BD, Franklin Lakes, NJ)and images were acquired by florescence microscope.

For MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazoliumbromide; Sigma–Aldrich, St. Louis, MO) assay, cells weretransfected with miR-20a or scramble precursors in 6-well plates.Twelve hours after transfection, cells were collected bytrypsinization and seeded in six replicates into a 96-well plate at adensity of 5,000 cells/well and treated with 5 ng/ml TGF-b.Thirty-six hours later, 10% volume of MTT reagent(3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide;Sigma–Aldrich) was added to the cell culture medium, and the cellproliferation rate was measured on a microplate reader (InfiniteM200 TECAN, M€annedorf, Switerzland) at a wavelength of570 nm.

Cell cycle was evaluated in arrested re-stimulated cells.Following transfection with miRNA duplexes, cells at 60%confluence were serum-deprived for 24 h and re-stimulated togrowth for an additional 24 h by serum repletion in presence orabsence of TGF-b plus Nocodazol (Sigma–Aldrich) at 100 ng/ml.Cells were then scraped, fixed in ice-cold 70% ethanol, and stainedaccording to the RNAse/propidium iodide protocol. The effect ofTGF-b effect on cell-cycle progression was evaluated through

JOURNAL OF CELLULAR PHYSIOLOGY

3106 S O K O L O V A E T A L .

flow-cytometric analysis of cellular DNA content by FACSinstrument (Becton & Dickinson, Franklin Lakes, NJ).

Small interfering RNA (siRNA) transfection

FET cells were transfected with a siRNA pool of fouroligonucleotides (ON-TARGETplus SMARTpool; Dharmacon,Lafayette, LO) targeting different portions of CDKN1A(L-003471-00-0005) or MYC (L-003282-00-0005) genes at a finalconcentration of 20 nM using Lipofectamine RNAiMAX(Invitrogen). A non-targeting siRNA Pool#1 (D-001206-13-20;Dharmacon, Lafayette, LO) was used as a control. Twelve hoursafter transfection, cells were treated with 5 ng/ml of recombinanthuman TGF-b1 (R&D Systems), and total RNA/protein lysateswere collected 48 h after transfection.

Western blotting analysis

After transfection and treatments, cells were lysed in RIPA buffer(50mMTris–HCl pH 8.5, 0.15mMNaCl, 1% Triton-X, 0.05% SDS,0.2% sodium deoxycholate, 2mM EDTA, 2mM EGTA, 1mMPMSF, 5mM glycerolphosphate, 50mM NaF, 10mM NaPP)supplemented with protease inhibitors cocktail (Calbiochem,Billerica, MA). To separate the nuclear and cytoplasmic enrichedfractions, cells were lysed with hypotonic buffer (10mM HEPES,pH 7.9, 2.5mM MgCl2, 0.2% NP-40, 10% glycerol, 1mM EDTA,0.5mMDTT, 0.5mM PMSF) and protease inhibitors cocktail. Aftercentrifugation for 5min at 4,000 rpm at 4°C, the supernatantrepresenting the cytoplasmatic fraction was removed andsupplemented with 0.15M NaCl and 1% Triton X-100. Theremaining pellet was lysed in RIPA buffer. Proteins were quantifiedwith the Bradford colorimetric assay. Forty micrograms of proteinextract were separated on 8–12% polyacrylamide gels andtransferred onto nitrocellulose membrane. The following primaryantibodies were used: p21 (C-19; Santa Cruz, Dallas, TX), c-Myc(D84C12; Cell Signaling, Danvers, MA), E2F5 (E-19, Santa Cruz),E2F5 (NBP1-51239; Novus Biologicals, Littleton, CO), E2F5(ab59769; Abcam, Cambridge, UK), KLF11 (NB100-92283; NovusBiologicals), p107 (C-18, Santa Cruz), pSmad2 (138D4, CellSignaling), Smad2 (#3103, Cell Signaling), and TGF-b receptor II(D3A1, Cell Signaling). Anti-Lamin B (C-12, Santa Cruz), anti-Actin(A2066, Sigma–Aldrich), anti-a-Tubulin (B-5-1-2, Sigma–Aldrich),or anti-Vinculin (hVIN-1, Sigma–Aldrich) were used to verify equalloading. Signals were detected using enhanced chemiluminescencesystem (Thermo Scientific).

30-UTR plasmid constructs

The 30-UTR regions of CDKN1A, E2F5, and KLF11 genes containingthe predicted miR-20a binding site were amplified by using theprimers herein reported:

The ampliconswere inserted downstreamof the luciferase geneinto the reporter plasmid pGL3 Promoter (Promega, Madison,WI) through XbaI restriction. FET or 293T cells were transfectedwith 0.1mg of the pLuc 30-UTR construct together with 0.01mg ofRenilla luciferase pRLTK plasmid (Promega), and co-transfectedwith 50 nM of pre-miR-20a or with pre-miR negative controlusing Lipofectamine 2000 (Invitrogen) according to themanufacturer’s instructions. After 24 h, the luciferase activity was

measured using the Dual Luciferase Assay kit (Promega).Luciferase activity was normalized to Renilla activity to control thetransfection efficiency.

Luciferase reporter plasmids

The pCDKN1ALuc, featuring the 2.3-kb proximal promoter, wasfrom Dr. Bert Vogelstein (Johns Hopkins University, Baltimore,MD); the p(CAGA)9Luc, containing tandem Smad3/4-responsivesequence, was from Jean-Michel Gauthier (Glaxo Wellcome,Cedex, France); the p(E2F/TIE)Luc containing the wild-type �367/þ16 promoter sequence, the p(mE2F/TIE)Luc, mutated at the E2Fconsensus site, and the p(E2F/mTIE)Luc mutated at the TIE sitewere from Dr, Mitsuyasu Kato (University of Tsukuba, Tsukuba,Japan). FET cells were co-transfected in triplicate in 24-well formatplate, each well with 200 ng of the reporter vector, 40 ng ofpRL-TK co-reporter (Promega), and 50 nM miR-20a precursor ornegative control using transfection mix of Lipofectamine 2000 andLipofectamine RNAiMAX (Invitrogen, Grand Island, NY).Following the co-transfections, the cells were treated with 5 ng/mlof TGF-b for 48 h and luciferase activity was measured using theDual Luciferase Assay kit (Promega).

DNA transfection

The HA-SMAD3 cDNA was obtained by amplification andsubcloning of the cDNA from the pGEX4T1/SMAD3 construct(from Dr. Rik Derynck, UCSF, San Francisco, CA) into thepcDNA3/HA vector via BglII/EcoRI restriction. pcDNA3/HA-Smad3 construct (250 ng/well) was included in certain assays.The pCDKN1A expression vector (Buscemi et al., 2014) was usedat 500 ng/well.

ResultsFET cells are a suitable model for studying the effectsmiR-20a on TGF-b-induced growth suppression

We previously reported that the six miRNAs from themiR-17–92 cluster are significantly more upregulated in CRCsthan in their paired non-tumor tissues (Reid et al., 2012). Themost significant expression differences were observed formiR-18a and miR-20a (Fig. S1) and since miR-20a has beendemonstrated to target CDKN1A and block p21 expression(Inomata et al., 2009; Hong et al., 2010; Trompeter et al., 2011),we analyzed its effects on the TGF-b signaling pathway in thecontext of CRC.WemeasuredmiR-20a expression levels in 12CRC cell lines, and found that FET cells, possessing an intactTGF-b/Smad signaling cascade (Brattain et al., 1984; Wu et al.,1992), express very low levels of miR-20a, similar to FHs 74 Int,a normal intestinal cell line used as reference value (Fig. 1A).Next, by using MTT viability assay, we tested the response toTGF-b growth-suppressive signals of FET, SW837, and T84cells. As expected, FET cells showed higher inhibition ofproliferation after TGF-b stimulation (P< 0.0001) than SW837(with a single wild-type SMAD4 allele; P¼ 0.0003) and T84 cells(carrying a mutated SMAD4 allele and 18q LOH, whereSMAD4maps; P¼ 0.2) (Fig. 1B). Although induction of miR-20aby TGF-b has been reported in different cell lines (Davis et al.,2010; Tili et al., 2010), we did not observe any significantmodulation in its expression levels after TGF-b treatment inFET cells (Fig. S2). Hence, FET cells appear as a suitable modelto investigate the impact of miR-20a on TGF-b response inCRC. This cell line, isolated from a well-differentiatedearly-stage carcinoma (Brattain et al., 1984) with mutated APC,KRAS, and TP53 genes (Gayet et al., 2001) and a functionalTGF-b response, is poorly tumorigenic and requires disruptionof the TGF-b pathway to gain in vivo tumor-forming capacity(Wu et al., 1992; Ye et al., 1999). Upregulation of p21 by TGF-b

Gene Primer Sequence

CDKN1A(174 bp)

Forward 5-TCTAGAATGAAATTCACCCCCTTTCC-3Reverse 5-TCTAGACTGTGCTCACTTCAGGGTCA-3

E2F5 (206 bp) Forward 5-GCATATTCTAGATCCAAACAGACGTTCACTGC-3Reverse 5-GCATATTCTAGATGTACAGGCATTGGCACATT-3

KLF11(150 bp)

Forward 5-GCATATTCTAGATTCTGAGAACCACAAACCTTG-3Reverse 5-GCATATTCTAGAAAAAGGCTCAAAGTCACAAAAGA-3


T W O M E C H A N I S M S O F p 2 1 R E G U L A T I O N B Y m i R - 2 0 a 3107

in early G1 phase of the cell cycle in association with reductionof cellular proliferation was previously demonstrated in FETcells (Gong et al., 2003). To test whether this mechanism isoperative in asynchronous cell cultures, we determined BrdUincorporation rate after TGF-b stimulation (Fig. 1C) and knock

down of p21 protein expression through siRNA transfection(Fig. 1D). Addition of siCDKN1A resulted in a diminishedgrowth repression induced by TGF-b (�twofold), thusconfirming a key role for this CDK inhibitor in cellularresponse to the cytokine (Fig. 1C).

miR-20a attenuates p21 expression induced by TGF-b inFET cells

We investigated the effects of exogenous administration ofmiR-20a precursor on p21 induction mediated by TGF-b. Atfirst, we confirmed the previously demonstrated directinteraction between miR-20a and the 30-UTR of CDKN1A inHEK293T (Wu et al., 2010; Trompeter et al., 2011) (Fig. S3),and also in FET cells (Fig. 2A). The luciferase activity of thereporter vector containing the wild-type 30-UTR sequence ofCDKN1A was downregulated by miR-20a, compared to itsmutated counterpart (P¼ 0.001) (Fig. 2A). Transfection of FETcells with the miR-20a precursor decreased the endogenousp21, both at mRNA and protein level, significantly more thantransfection with a scramble oligonucleotide.

After treatment with TGF-b, the expression of p21 wasstrongly induced in scramble transfected cells, while in cellsadministered with miR-20a the induction was �2.1-fold lower(P¼ 0.005) (Fig. 2B and C). These data indicate that miR-20ahas strong impact on the TGF-b-mediated p21 induction,which is a critical event for the activation of the TGF-bcytostatic response.

miR-20a opposes the growth inhibitory effect of TGF-b

Based on the above observations, we investigated the impact ofmiR-20a on the TGF-b-induced growth inhibition. Alterationsin the proliferation rates of cells were analyzed by BrdUincorporation assay after exogenous administration of miR-20aprecursor or of a scramble control oligonucleotide, in thepresence or absence of TGF-b. In cytokine-unstimulated cells,there was a 20% increase in the rate of BrdU positive cells inmiR-20a transfected cells compared with cells transfected withthe scramble (Fig. 3A). As expected, TGF-b treatment reducedproliferation by 70% in scramble cells, but cells transfected withmiR-20a precursor showed only a 25% reduction of BrdUincorporation. The results were also confirmed by MTT cellviability assay (Fig. S4A). Co-transfection of miR-20a withCDKN1A expression vector rescued the twofold difference ingrowth reduction observed between miR-20a andscramble-transfected mock cells (Fig. S4B), indicating thatmiR-20a interferes with the TGF-b mediated growth arrest,mostly governed by upregulation of p21.

We then investigated whether the TGF-b-mediated block ofthe G1/S phase in cell-cycle progression, strongly dependenton p21 induction, was affected by miR-20a. Scramble andmiR-20a transfected cells were serum-starved for 24 h toenrich their G0/G1 phase fraction, then released into cell cycleby serum replenishment in the absence or presence of TGF-b,and the cell-cycle distribution was evaluated after 24 h. Themitotic blocker Nocodazole was included in the medium inorder to prevent entry into the second G1 phase (G1

0). FACSanalysis demonstrated that 85% of the TGF-b-untreated cells,both miR-20a and scramble transfected, progressed throughthe cell cycle (Figs. 3B and S4C, upper panel). As expected,addition of the cytokine induced a delay of G1/S transition bothin scramble and miR-20a transfected cells, but this delay wassignificantly reduced in the presence of miR-20a (52.3% cells inG1 phase in scramble transfected vs. 32% in miR-20atransfected cells) (Figs. 3B and S4C, lower panel). The observedresults demonstrate that miR-20a strongly abrogates theTGF-b-mediated growth suppression and G1/S arrest insensitive colon cells.

Fig. 1. FET cell line represents a suitable model for studying theeffects miR-20a on TGF-b induced growth suppression. A:Expression levels of miR-20a measured in a panel of CRC cell linesby qRT-PCR. Values are calculated as 2(�DCt) and normalized to anendogenous control RNU48. B: MTT viability assay done in FET,SW837, and T84 cells after treatment with TGF-b. C: BrdUincorporation assay in FET cells performed after transfection withsiCDKN1A or with a negative control siRNA (siCNTR) andtreatment with TGF-b. D: Western blotting analyses of p21 underthe same conditions confirmed siRNA efficiency. Tubulin was usedas loading control.



mir-20a decreases CDKN1A promoter transactivationinduced by TGF-b by preventing suppression of MYC

Since it has been reported that mir-20a binds the 30-UTR ofTGFBR2 and decreases its expression (Li et al., 2012), weanalyzed the expression of the TGFBR2 in FET cells, but we didnot observe significant differences between miR-20a orscramble transfected cells (Fig. S5). Next, to address whetherthe signals triggered by the ligand are attenuated in FET cellsupon mir-20a transfection, we addressed the trafficking ofSmad2 protein, a sensor of TGF-b ligand/receptor complex,into the nuclear compartment. As shown in Figure 4A, the levelof phosphorylated Smad2 following TGF-b treatment wasincreased in cells administered with miR-20a, with consequentmore efficient Smad2 nuclear accumulation.

In order to investigate if the observed effect of miR-20a onSmad2 phosphorylation could functionally alter theTGF-b-Smad signaling, we investigated the impact of itsoverexpression on the basal signaling cascade to the nucleus.To this aim, we co-transfected the cells with pCAGA9MLPlucreporter vector containing multiple CAGA boxes recognizableby Smad3/Smad4, activated by TGFBR2 (Dennler et al., 1998),and with miR-20a. Ligand stimulation resulted in a significantreporter activation in FET cells that was equivalent in cellsadministered with miR-20a and scramble precursor (Fig. 4B).Thus, by this assay, we were able to exclude miR-20a-mediatedimpairment of the TGF-b downstream signaling.

Next, we evaluated whether miR-20a, in addition to itsinterference with the 30-UTR, can indirectly modulate the

activation of the CDKN1A promoter. We transfected FETcells with pCDKN1Aluc vector containing the CDKN1Apromoter upstream of the luciferase gene and assayed itsactivity. In cells co-transfected with scramble precursor,TGF-b treatment induced the promoter activity of �2.3-fold(P¼ 0.009), but not in cells overexpressing miR-20a (P¼ 0.2)(Fig. 4C). A known inhibitor of the CDKN1A promoter is theoncogenic protein Myc, which directly binds to the CDKN1Apromoter region preventing its Smad-mediated transcriptionalactivation (Claassen and Hann, 2000; Seoane et al., 2002). Weexamined whether the repression of Myc expression mediatedby TGF-b could be affected by miR-20a. The 30-UTR region ofMYC has no predicted binding sites for miR-20a, andconsequently we observed no differences in the endogenousMyc levels between miR-20a and scramble-transfectedunstimulated cells (Fig. 4D). As expected, Myc repression afterstimulation with TGF-b was observed in scramble-transfectedcells, but following administration of miR-20a precursor thisreduction was abolished (Fig. 4D) besides the increasedpSmad2 levels. This result indicates that miR-20a operates anadditional mechanism that ultimately subverts the repressionof Myc, thus indirectly contributing to the reduction of theCDKN1A promoter activity that we observed.

Accordingly, silencing ofMYC resulted in significant increaseof pCDKN1Aluc transactivation (�threefold) (Fig. 4E). MYCdepletion increased p21 expression in these cells, but thisupregulation was far less effective than that achieved uponligand stimulation (Fig. 4F), suggesting that p21 upregulation inFET is mostly driven by TGF-b transcriptional activation and

Fig. 2. miR-20a downmodulates CDKN1A by targeting its 30-UTR and decreases its mRNA and protein levels. A: The 30-UTR of CDKN1Agene containing the wild-type (pLuc CDKN1A WT 30-UTR) or mutated (pLuc CDKN1A mut 30-UTR) predicted binding site for miR-20a wascloned into pGL3-promoter vector. Relative luciferase activity (RLU) of the reporter vectors determined after co-transfection of FET cellswith miR-20a or with the scramble precursors. The presented values are calculated as the ratio of miR-20a RLU compared with the scramble.B: CDKN1A mRNA expression analyzed by qRT-PCR after miR-20 overexpression and treatment with TGF-b. The expression levels arenormalized to GUSB and presented as 2(�DCt). C: Western blotting analyses of p21 after miR-20 overexpression and treatment with TGF-b.Tubulin was used as loading control.



that p21 enhanced stability in the presence of TGF-b signalingplays a key role in mediating its induction (Gong et al., 2003).

miR-20a downmodulates genes from the Myc repressorcomplexes and abrogates the TGF-b-induced repressionof MYC promoter activity

TGF-b induces the activation of a protein complex consisting ofSmad3, E2F4/5 and p107 that binds the TGF-b-inhibitoryelement (TIE) sequence of the MYC promoter, triggering itsrepression (Chen et al., 2002). An alternative Myc repressivecomplex containing KLF11 and Smad3 that binds to the TIEelement in proximity of the E2F5 recognizing site was alsodescribed (Buck et al., 2006). Using computational methods fortarget prediction, we found that p107, E2F5, and KLF11 haveputative miR-20a binding sites in their 30-UTRs (TargetScan,http://www.targetscan.org/). As shown in Figure 5A, we clonedthe E2F5 and KLF11 30-UTRs containing the wild-type ormutated miR-20a binding site downstream of the luciferasegene, and transfected them into HEK293T cells together withmiR-20a precursor. Transfection of miR-20a reduced theluciferase activity (E2F5 P¼ 0.002; KLF11 P¼ 0.003) of bothwild-type constructs. The direct interaction between miR-20aand the 30-UTR of p107 (RBL1) was previously reported(Trompeter et al., 2011).

By analyzing the E2F5mRNAexpression levels, no significantdifferences were observed between miR-20a-transfected and

control cells, suggesting that this miRNA regulates E2F5expression at post-transcriptional level (Fig. S6A). We havebeen unable to determine the protein expression of E2F5 sincethe three different commercial antibodies that we tested failedto detect a protein band at its predicted Molecular Weight(36 kDa). Regarding KLF11, significant reduction in its mRNA(Fig. S6B) and a weak reduction in its protein expression(Fig. S6C) was observed after administration of miR-20a.Finally, we found a reduction of p107 protein and, to someextent, of p107 mRNA (Fig. S6D and E) levels followingmiR-20a transfection.

Next, we examined the functional effects of miR-20a onthe transcriptional activation of the MYC promoter bymeasuring the activity of the Smad-responsive element coresequence (TIE/E2F), containing TGF-b inhibitory element(TIE) recognized by Smad3 and a binding site for E2F, afteradministration of the miRNA. We transfected FET cells withthe reporter construct pE2F/TIEluc, containing the proximalpromoter segment of MYC (�367/þ16 sequence) includingthe TIE/E2F composite sequence (Yagi et al., 2002), togetherwith miR-20a or the scramble precursors. This promoterprovides a useful measure of specific transactivationmediated by either the TIE or the E2F elements determinedupon normalization with their negative controls, pE2F/mTIEluc and pmE2F/TIEluc, that lack binding sites for the corerepressor complex. As shown in Figure 5B, TGF-b-inducedreduction of the specific activity associated with either TIE orE2F elements, both involved in MYC transcriptionalrepression, was abolished in cells transfected with miR-20a.Because of the high mortality observed in FET cells,administration of Smad3 or E2F5 expression vectors wasanalyzed in HEK293 cells. We found that in the presence ofexogenous Smad3, the TIE sequence was responsive tothe inhibitory effect of TGF-b (Fig. 5C), while theE2F-responsive element showed no attenuation when E2F5vector was added (data not shown). Administration ofpre-miR-20a abrogated the TIE specific regulation mediatedby the ligand. However, this effect was reversed byco-transfection of Smad3 (Fig. 5C), suggesting that theattenuation of the TIE-mediated response to TGF-b may becompensated by an excess of Smad3, which is the coremediator of the regulatory complex driving the pre-existingcytoplasmic E2F4/5-p107 complex into the nucleus (Chenet al., 2002), and is also part of the KLF11-mediated Mycrepressive complex (Buck et al., 2006).

Our findings suggest that the impairment of the Mycrepression mediated by miR-20a could be provoked by itsinterference with the expression of factors constituting theMYC repressor complexes induced by the TGF-b/Smadcascade.

Discussion

Mutational inactivation or loss of genes belonging to the TGF-bsignaling pathway, which is frequent in cancer cells, contributesto the failure of the antiproliferative effects of TGF-b. Theobservation that a significant percentage of CRCs carries anintact TGF-b signaling cascade (Grady et al., 1999) points to apossible involvement of epigenetic mechanisms, such as thederegulation of miRNAs leading to pathway inactivation (Dewset al., 2010; Mestdagh et al., 2010; Butz et al., 2012). In fact,genes belonging to the core TGF-b signaling cascade, such asTGFBR2 and almost all SMADs, as well as downstream effectorsof the pathway were identified as targets of different miRNAs(Petrocca et al., 2008; Rogler et al., 2009; Dews et al., 2010);Dews et al., 2010). Moreover, recent reports demonstratedthat Smad proteins couldmodulate miRNA processing throughboth transcriptional and post-transcriptional mechanisms(Davis et al., 2008; Davis et al., 2010), indicating a crosstalk

Fig. 3. Exogenous miR-20a abrogates growth suppression and G1/Sarrest induced by TGF-b. A: BrdU incorporation assay performed inFET cells after transfection with miR-20a or with a negative controlprecursors and treatment with TGF-b. B: Flow cytometric analysisof FET cells done after transfection with miR-20a or with a scrambleprecursor, serum deprivation, and re-stimulation in presence orabsence of TGF-b.



http://www.targetscan.org/

between miRNAs and the components of the TGF-b signalingcascade.

We investigated whether miR-20a, a member of themiR-17-92 cluster, could interfere with the TGF-b-mediatedgrowth inhibition in CRC. Although CDKN1A is a centralmediator of the TGF-b cytostatic program (Gong et al., 2003),

mutations and deletions of this gene are rare in human cancers,and its protein p21 is mainly regulated at transcriptional andpost-transcriptional level (Gartel and Tyner, 1999;Koutsodontis et al., 2002). For its post-transcriptionalregulation, strictly dependent on the cellular conditions,miRNAs seem to represent prominent modulators. Indeed,

Fig. 4. miR-20a decreases CDKN1A promoter transactivation driven by TGF-b and abrogates the c-Myc downregulation induced by TGF-b.A: Nuclear accumulation of Smad proteins following TGF-b treatment of FET cells after transfection with miR-20a or scramble precursorsanalyzed by Western blotting. Cells were lysed with hypotonic buffer, and cross-contamination between nuclear and cytoplasmic fractionswas determined by adequate markers (Actin and Lamin B). B: Relative luciferase activity of pCAGA9MLPluc reporter vector determined afterco-transfection with miR-20a precursor or scramble and TGF-b treatment in FET cells. C: Relative luciferase activity of pCDKN1Alucreporter vector determined after co-transfection with miR-20a precursor or scramble and TGF-b treatment in FET cells. D:Western blottinganalysis of c-Myc after miR-20a overexpression and treatment with TGF-b. The nuclear protein Lamin B was used as loading control for thenuclear fraction of the lysate. E: Relative luciferase activity of pCDKN1Aluc reporter vector determined after co-transfection with siMYC orwith a control siRNA precursors and TGF-b treatment in FET cells. F: Western blotting analysis of p21 and c-Myc after miR-20aoverexpression and treatment with TGF-b. Vinculin was used as loading control.



Wu (2010) demonstrated that 28 miRNAs, including miR-20a,directly bind the 30-UTR of CDKN1A. We confirmed theinteraction between miR-20a and CDKN1A in FET cells, a CRCcell line that has an intact TGF-b-Smad signaling and is unable togrow in vivo unless this signaling cascade is artificiallyinactivated (Ye et al., 1999). miR-20a delivery in FET cellsdecreased endogenous p21 and attenuated its upregulationdriven by TGF-b, thus promoting the escape from theTGF-b-induced G1/S arrest and preventing the activation ofthe cytostatic program mediated by the cytokine. Our resultsdemonstrated that mir-20a, in addition to the direct effect onCDKN1A 30-UTR, also attenuates the transactivation of itspromoter after TGF-b stimulation through a novel mechanism.In fact, miR-20a administration has no effects on theSmad-dependent transcriptional response, as evidenced by the

full activity of a reporter sensing the basal TGF-b-Smadresponse to the nuclear compartment. Interestingly,exogenous miR-20a increased the extent of phosphorylatedSmad2 at its C-terminus. This effect could be more likelyattributed to secondary post-translational mechanismsinvolving large number of proteins described as miR-20atargets. There is no evidence in literature about a similarfunction for miRNAs indicating a new regulatory mechanismthat needs further investigations. Nevertheless, thetranscriptional activity of activated Smad is not affected by thismiRNA, as demonstrated by the full activity of a reportersensing the TGF-b-Smad response. Hence, we suggest that theattenuation of the CDKN1A promoter transactivation is aconsequence of the abrogated TGF-b-mediated repression ofMyc, a direct inhibitor of the CDKN1A transcription (Claassen

Fig. 5. MiR-20a downmodulates genes from the MYC repressor complexes and abrogates the TGF-b-induced repression of MYC promoteractivity. A: The 30-UTRs of E2F5 and KLF11 genes containing the wild-type (pLuc E2F5/KLF11WT 30-UTR) or a mutated sequence (pLuc E2F5/KLF11 MUT 30-UTR) of the predicted binding site for miR-20a were cloned into pGL3-promoter vector. Relative luciferase activity of thereporter vectors determined after co-transfection with miR-20a or with the scramble precursor in HEK293T cells. The presented values arecalculated as ratio of the RLU for miR-20a compared with the scramble. B: Relative luciferase activity of pE2F/TIEluc containing either theintact (WT) or the mutated (m) E2F or Smad (TIE) binding sites (pmE2F/TIEluc, pE2F/mTIEluc) in HEK293T cells measured afterco-transfection with miR-20a or with the scramble precursor. The transactivation of the wild-type promoter is normalized to the activity ofthe pmE2F/TIEluc or pE2F/mTIEluc construct. C: Relative luciferase activity of pE2F/TIEluc containing intact or mutated Smad (TIE) binding site(pE2F/mTIEluc) in HEK293T cells determined after co-transfection with miR-20a or with the scramble precursors and Smad3 expressingconstruct. The transactivation of the wild-type promoter is normalized to the activity of the pE2F/mTIEluc construct.



and Hann, 2000; Seoane et al., 2002), which we observed inpresence of miR-20a. Our results demonstrate that theregulation of p21 and Myc, which are the key components ofthe cytostatic program governed by TGF-b, is counteracted bymir-20a. Loss of the tumor suppressor activity of TGF-b as aconsequence of the disruption of the Myc/p21 regulation is acentral event in many malignancies, including CRC (Mulderet al., 1990; Siegel and Massague, 2003), and miR-20a may, thus,contribute, at early stages of carcinogenesis, to the disruptionof the Myc/p21 regulation mediated by the functional TGF-b.

Two different complexes mediated by TGF-b, Smad3-E2F4/5-p107 and Smad3-KLF11, have been previously described ascrucial forMYC repression (Chen et al., 2002; Buck et al., 2006).We identified two genes belonging to these complexes, E2F5and KLF11, as new target genes for miR-20a, while theinteraction of miR-20a with p107 30-UTR had already beenreported (Trompeter et al., 2011). We propose that thecoordinated targeting of multiple MYC repressor genes allowsmiR-20a to efficiently inhibit its downmodulation. Although wedid not observe a modulation of the abundance of the Mycrepressor complexes by miR-20a (data not shown), wedemonstrated that miR-20a delivery attenuated the repressionof the MYC promoter activity driven by the cytokine.Attenuation of MYC promoter activity is a crucial event forgrowth inhibition, and escape from this repression is a hallmarkof cancer.

The members of miR-17-92 cluster can regulatetranscription factors involved in cancer, including E2Fs and alsoMyc. In addition, the mir-17–92 cluster is directlytransactivated by Myc (O’Donnell et al., 2005), and a complexregulatory network in which Myc, its transcriptional factors(E2F1, -2, and -3), and miR-17-92 members are auto-regulatedhas been described (O’Donnell et al., 2005;Woods et al., 2007,Sylvestre et al., 2007). Depending of the expression levels ofthese elements, the network could have a tumor suppressor oroncogenic outcome. The coordinated repression of themultiple transcriptional factors by miRNAs belonging to thesame cluster, and also the ability of a single miRNA, such asmiR-20a, to regulate multiple mediators belonging to the samesignaling network ensures a finely tuning of the pathwayresponses in a cellular and context specific manner.

The fact that miR-20a is overexpressed at all stages of coloncarcinogenesis (Schetter et al., 2008; Reid et al., 2012) supportsan involvement of miR-20a in the CRC development from theearly stages, when the disruption of the TGF-b-mediatedcytostatic program occurs (Hsu et al., 1994; Engle et al., 1999).This limits the number of cell lines responsive to the cytokineand has hampered us from reproducing these results in othercellular models. Zhang et al. (2013) identifiedmiR-20a as one ofthe six miRNAs constituting amulti-miRNA-based classifier forpredicting recurrence and benefit from adjuvant chemotherapyin stage II CRCs after surgery. This finding is particularlyimportant since about 20–25% of patients with stage II coloncancer still die from tumor recurrence after surgery, and riskfactors or biomarkers able to discriminate patients at high orlow risk of disease recurrence are not yet available (Zhanget al., 2013). Dissecting the mechanisms addressed by miR-20ashould contribute to increase the knowledge of the molecularalterations subverting the TGF-b growth suppression incancer, and favor the development of new therapeuticstrategies to restore the TGF-b homeostasis in cancer.Nanoparticle-based applications for targeting oncomiRNAscould represent a possible novel therapeutic treatment for theearly stages of CRC (Babar et al., 2012).

Acknowledgments

The authors wish to thank Michael Brattain for kindly providingus with the FET cells, Bert Vogelstein for the pCDKN1luc

plasmid, Jean-Michel Gauthier for the pCAGA9Luc plasmid,Mitsuyasu Kato for the p(E2F/TIE)Luc vectors, and Rik Derynckfor pGEX4T1/SMAD3 plasmid; the staff of the IFOM CellCulture and Imaging Facilities and Daniela Majerna from theScientific Directorate for her assistance in the preparation ofthe manuscript. This work was supported by funds obtainedthrough an Italian law that allows taxpayers to allocate 0.5percent share of their income tax contribution to a researchinstitution of their choice.

Literature Cited

Ando T, Sugai T, Habano W, Jiao YF, Suzuki K. 2005. Analysis of SMAD4/DPC4 genealterations in multiploid colorectal carcinomas. J Gastroenterol 40:708–715.

Babar IA, Cheng CJ, Booth CJ, Liang X, Weidhaas JB, Saltzman WM, Slack FJ. 2012.Nanoparticle-based therapy in an in vivo microRNA-155 (miR-155)-dependent mousemodel of lymphoma. Proc Natl Acad Sci USA 109:E1695–E1704.

Brattain MG, Levine AE, Chakrabarty S, Yeoman LC, Willson JK, Long B. 1984.Heterogeneity of human colon carcinoma. Cancer Metastasis Rev 3:177–191.

Buck A, Buchholz M, Wagner M, Adler G, Gress T, Ellenrieder V. 2006. The tumorsuppressor KLF11 mediates a novel mechanism in transforming growth factorbeta-induced growth inhibition that is inactivated in pancreatic cancer. Mol Cancer Res4:861–872.

Buscemi G, Ricci C, Zannini L, Fontanella E, Plevani P, Delia D. 2014. Bimodal regulation ofp21(waf1) protein as function of DNA damage levels. Cell Cycle 13:2901–2912.

Butz H, Racz K, Hunyady L, Patocs A. 2012. Crosstalk between TGF-beta signaling and themicroRNA machinery. Trends Pharmacol Sci 33:382–393.

ChenCR, Kang Y, Siegel PM,Massague J. 2002. E2F4/5 and p107 as Smad cofactors linking theTGFbeta receptor to c-myc repression. Cell 110:19–32.

Claassen GF, Hann SR. 2000. A role for transcriptional repression of p21CIP1 by c-Myc inovercoming transforming growth factor beta-induced cell-cycle arrest. Proc Natl Acad SciUSA 97:9498–9503.

Datto MB, Li Y, Panus JF, Howe DJ, Xiong Y, Wang XF. 1995. Transforming growth factorbeta induces the cyclin-dependent kinase inhibitor p21 through a p53-independentmechanism. Proc Natl Acad Sci USA 92:5545–5549.

Davis BN, Hilyard AC, Lagna G, Hata A. 2008. SMAD proteins control DROSHA-mediatedmicroRNA maturation. Nature 454:56–61.

Davis BN, Hilyard AC, Nguyen PH, Lagna G, Hata A. 2010. Smad proteins bind a conservedRNA sequence to promote microRNA maturation by Drosha. Mol Cell 39:373–384.

Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. 1998. Direct binding of Smad3and Smad4 to critical TGF beta-inducible elements in the promoter of human plasminogenactivator inhibitor-type 1 gene. Embo J 17:3091–3100.

Dews M, Fox JL, Hultine S, Sundaram P, Wang W, Liu YY, Furth E, Enders GH, El-Deiry W,Schelter JM, Cleary MA, Thomas-Tikhonenko A. 2010. The myc-miR-17�92 axis bluntsTGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenicfactors. Cancer Res 70:8233–8246.

Engle SJ, Hoying JB, Boivin GP, Ormsby I, Gartside PS, Doetschman T. 1999. Transforminggrowth factor beta1 suppresses nonmetastatic colon cancer at an early stage oftumorigenesis. Cancer Res 59:3379–3386.

Fearon ER. 2011. Molecular genetics of colorectal cancer. Annu Rev Pathol 6:479–507.Fearon ER, Vogelstein B. 1990. A genetic model for colorectal tumorigenesis. Cell 61:759–767.

Gartel AL, Tyner AL. 1999. Transcriptional regulation of the p21((WAF1/CIP1)) gene. ExpCell Res 246:280–289.

Gayet J, Zhou XP, Duval A, Rolland S, Hoang JM, Cottu P, Hamelin R. 2001. Extensivecharacterization of genetic alterations in a series of human colorectal cancer cell lines.Oncogene 20:5025–5032.

Gong J, Ammanamanchi S, Ko TC, Brattain MG. 2003. Transforming growth factor beta 1increases the stability of p21/WAF1/CIP1 protein and inhibits CDK2 kinase activity inhuman colon carcinoma FET cells. Cancer Res 63:3340–3346.

Grady WM, Myeroff LL, Swinler SE, Rajput A, Thiagalingam S, Lutterbaugh JD, Neumann A,Brattain MG, Chang J, Kim SJ, Kinzler KW, Vogelstein B, Willson JK, Markowitz S. 1999.Mutational inactivation of transforming growth factor beta receptor type II inmicrosatellite stable colon cancers. Cancer Res 59:320–324.

Grady WM, Rajput A, Myeroff L, Liu DF, Kwon K, Willis J, Markowitz S. 1998. Mutation ofthe type II transforming growth factor-beta receptor is coincident with thetransformation of human colon adenomas to malignant carcinomas. Cancer Res 58:3101–3104.

Hannon GJ, Beach D. 1994. P15INK4B is a potential effector of TGF-beta-induced cell cyclearrest. Nature 371:257–261.

Hasegawa Y, Takanashi S, Kanehira Y, Tsushima T, Imai T, Okumura K. 2001. Transforminggrowth factor-beta1 level correlates with angiogenesis, tumor progression, and prognosisin patients with nonsmall cell lung carcinoma. Cancer 91:964–971.

Hong L, Lai M, Chen M, Xie C, Liao R, Kang YJ, Xiao C, Hu WY, Han J, Sun P. 2010. ThemiR-17–92 cluster of microRNAs confers tumorigenicity by inhibiting oncogene-inducedsenescence. Cancer Res 70:8547–8557.

Hsu S, Huang F, Hafez M, Winawer S, Friedman E. 1994. Colon carcinoma cells switch theirresponse to transforming growth factor beta 1 with tumor progression. Cell GrowthDiffer 5:267–275.

Inomata M, Tagawa H, Guo YM, Kameoka Y, Takahashi N, Sawada K. 2009. MicroRNA- 17–92 down-regulates expression of distinct targets in different B-cell lymphoma subtypes.Blood 113:396–402.

Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. 2011. Global cancer statistics. CACancer J Clin 61:69–90.

Koutsodontis G, Moustakas A, Kardassis D. 2002. The role of Sp1 family members, theproximal GC-rich motifs, and the upstream enhancer region in the regulation of thehuman cell cycle inhibitor p21WAF-1/Cip1 gene promoter. Biochemistry 41:12771–12784.

Lao VV, Grady WM. 2011. Epigenetics and colorectal cancer. Nat Rev GastroenterolHepatol 8:686–700.

Lawrence MS, Stojanov P, Mermel CH, Robinson JT, Garraway LA, Golub TR, Meyerson M,Gabriel SB, Lander ES, Getz G. 2014. Discovery and saturation analysis of cancer genesacross 21 tumour types. Nature 505:495–501.



Lewis BP, Burge CB, Bartel DP. 2005. Conserved seed pairing, often flanked by adenosines,indicates that thousands of human genes are microRNA targets. Cell 120:15–20.

Li L, Shi JY, Zhu GQ, Shi B. 2012. MiR-17–92 cluster regulates cell proliferation and collagensynthesis by targeting TGFB pathway in mouse palatal mesenchymal cells. J Cell Biochem113:1235–1244.

Massague J. 2012. TGFbeta signalling in context. Nat Rev Mol Cell Biol 13:616–630.Mestdagh P, BostromAK, Impens F, Fredlund E, Van PeerG, DeAntonellis P, von Stedingk K,

Ghesquiere B, Schulte S, Dews M, Thomas-Tikhonenko A, Schulte JH, Zollo M, SchrammA, Gevaert K, Axelson H, Speleman F, Vandesompele J. 2010. The miR-17–92 microRNAcluster regulates multiple components of the TGF-beta pathway in neuroblastoma.. MolCell 40:762–773.

Mulder KM, Levine AE, Hernandez X, McKnight MK, Brattain DE, Brattain MG. 1988.Modulation of c-myc by transforming growth factor-beta in human colon carcinoma cells.Biochem Biophys Res Commun 150:711–716.

Mulder KM, Zhong Q, Choi HG, Humphrey LE, Brattain MG. 1990. Inhibitory effects oftransforming growth factor beta 1 on mitogenic response, transforming growth factoralpha, and c-myc in quiescent, well-differentiated colon carcinoma cells. Cancer Res50:7581–7586.

NetworkCGA. 2012. Comprehensivemolecular characterization of human colon and rectalcancer. Nature 487:330–337.

O’Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. 2005. C-Myc-regulatedmicroRNAs modulate E2F1 expression. Nature 435:839–843.

Ogino S, Nosho K, Irahara N, Shima K, Baba Y, Kirkner GJ, Meyerhardt JA, Fuchs CS. 2009.Prognostic significance andmolecular associations of 18q loss of heterozygosity: A cohortstudy of microsatellite stable colorectal cancers. J Clin Oncol 27:4591–4598.

OkayamaH, Schetter AJ, Harris CC. 2012. MicroRNAs and inflammation in the pathogenesisand progression of colon cancer. Dig Dis 30:9–15.

Petrocca F, Visone R,Onelli MR, ShahMH,NicolosoMS, deMartino I, Iliopoulos D, Pilozzi E,Liu CG, Negrini M, Cavazzini L, Volinia S, Alder H, Ruco LP, Baldassarre G, Croce CM,Vecchione A. 2008. E2F1-regulated microRNAs impair TGFbeta-dependent cell-cyclearrest and apoptosis in gastric cancer. Cancer cell 13:272–286.

Reid JF, Gariboldi M, Sokolova V, Capobianco P, Lampis A, Perrone F, Signoroni S, Costa A,Leo E, Pilotti S, Pierotti MA. 2009. Integrative approach for prioritizing cancer genes insporadic colon cancer. Genes Chromosomes Cancer 48:953–962.

Reid JF, Sokolova V, Zoni E, Lampis A, Pizzamiglio S, Bertan C, Zanutto S, Perrone F,Camerini T, GallinoG, Verderio P, Leo E, Pilotti S, Gariboldi M, Pierotti MA. 2012. MiRNAprofiling in colorectal cancer highlights miR-1 involvement in MET-dependentproliferation. Mol Cancer Res 10:504–515.

Reynisdottir I, Polyak K, Iavarone A, Massague J. 1995. Kip/Cip and Ink4 Cdk inhibitorscooperate to induce cell cycle arrest in response to TGF-beta. Genes Dev 9:1831–1845.

Rogler CE, Levoci L, Ader T, Massimi A, Tchaikovskaya T, Norel R, Rogler LE. 2009.MicroRNA-23b cluster microRNAs regulate transforming growth factor-beta/bonemorphogenetic protein signaling and liver stem cell differentiation by targeting Smads.Hepatology 50:575–584.

Schetter AJ, Leung SY, Sohn JJ, Zanetti KA, Bowman ED, Yanaihara N, Yuen ST, Chan TL,Kwong DL, Au GK, Liu CG, Calin GA, Croce CM, Harris CC. 2008. MicroRNAexpression profiles associated with prognosis and therapeutic outcome in colonadenocarcinoma. JAMA 299:425–436.

Seoane J, Le HV, Massague J. 2002. Myc suppression of the p21(Cip1) Cdk inhibitorinfluences the outcome of the p53 response to DNA damage. Nature 419:729–734.

Siegel PM, Massague J. 2003. Cytostatic and apoptotic actions of TGF-beta in homeostasisand cancer. Nat Rev Cancer 3:807–821.

SlabyO, SvobodaM,Michalek J, Vyzula R. 2009. MicroRNAs in colorectal cancer: Translationof molecular biology into clinical application. Mol Cancer 8:102.

Staller P, Peukert K, Kiermaier A, Seoane J, Lukas J, Karsunky H,Moroy T, Bartek J, MassagueJ, Hanel F, Eilers M. 2001. Repression of p15INK4b expression by Myc through associationwith Miz-1. Nat Cell Biol 3:392–399.

Stearns ME, Garcia FU, Fudge K, Rhim J, Wang M. 1999. Role of interleukin 10 andtransforming growth factor beta1 in the angiogenesis and metastasis of human prostateprimary tumor lines from orthotopic implants in severe combined immunodeficiencymice. Clin Cancer Res 5:711–720.

Sylvestre Y, De Guire V, Querido E, Mukhopadhyay UK, Bourdeau V, Major F, Ferbeyre G,Chartrand P. 2007. An E2F/miR-20a autoregulatory feedback loop. J Biol Chem 282:2135–2143.

Tili E, Michaille JJ, Liu CG, Alder H, Taccioli C, Volinia S, Calin GA, Croce CM. 2010. GAM/ZFp/ZNF512B is central to a gene sensor circuitry involving cell-cycle regulators, TGF{beta} effectors, Drosha and microRNAs with opposite oncogenic potentials. NucleicAcids Res 38:7673–7688.

Trompeter HI, Abbad H, Iwaniuk KM, Hafner M, Renwick N, Tuschl T, Schira J, Muller HW,Wernet P. 2011. MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulateE2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoSONE6:e16138.

Woods K, Thomson JM, Hammond SM. 2007. Direct regulation of an oncogenic micro-RNAcluster by E2F transcription factors. J Biol Chem 282:2130–2134.

Wu S, Huang S, Ding J, Zhao Y, Liang L, Liu T, Zhan R, He X. 2010. Multiple microRNAsmodulate p21Cip1/Waf1 expression by directly targeting its 30 untranslated region.Oncogene 29:2302–2308.

Wu SP, Theodorescu D, Kerbel RS, Willson JK, Mulder KM, Humphrey LE, Brattain MG.1992. TGF-beta 1 is an autocrine-negative growth regulator of human colon carcinomaFET cells in vivo as revealed by transfection of an antisense expression vector. J Cell Biol116:187–196.

Yagi K, Furuhashi M, Aoki H, Goto D, Kuwano H, Sugamura K, Miyazono K, Kato M. 2002.C-myc is a downstream target of the Smad pathway. J Biol Chem 277:854–861.

Ye SC, Foster JM, LiW, Liang J, Zborowska E, Venkateswarlu S, Gong J, Brattain MG,WillsonJK. 1999. Contextual effects of transforming growth factor beta on the tumorigenicity ofhuman colon carcinoma cells. Cancer Res 59:4725–4731.

Zhang JX, SongW, Chen ZH,Wei JH, Liao YJ, Lei J, Hu M, Chen GZ, Liao B, Lu J, Zhao HW,Chen W, He YL, Wang HY, Xie D, Luo JH. (2013). Prognostic and predictive value of amicroRNA signature in stage II colon cancer: A microRNA expression analysis. LancetOncol 14,1295–1306.

Supporting Information

Additional supporting information may be found in the onlineversion of this article at the publisher’s web-site.



the effects of mir-20a on p21: two mechanisms blocking ...-j-cell... · 1molecular genetics of...

Documents