further sequence requirements for male germ cell-specific

Nucleic Acids Research, Vol. 19, No. 16 4515-4521

Further sequence requirements for male germ cell-specificexpression under the control of the 14 bp promoterelement (/32UE1) of the Drosophila 02 tubulin gene

Frits Michiels+, Andrea Wolk and Renate Renkawitz-Pohl*Genzentrum am MPI fur Biochemie, Am Klopferspitz 18A, D-8033 Martinsried, FRG

Received April 4, 1991; Revised and Accepted July 26, 1991

ABSTRACT

We have investigated a 14 bp promoter element(02UE1) that is required for testls-speclfic expressionof the Drosophila 02 tubulin gene. To further elucidatethe role of the 14 bp element, we fused differentpromoter constructs to the E. coll lacZ gene andestablished transgenic strains with the aid of theDrosophila P-element transformation system. Germ linetransformation experiments with constructs in whichthe element in the 02 tubulin gene promoter wasexchanged for a related sequence from the promoterregion of the Drosophila 03 tubulin gene led to adramatic reduction in the expression of the lacZ genein the testls. Exchanging the 14 bp promoter elementfor a similar sequence from the distal promoter of theDrosophila alcohol dehydrogenase gene abolishedexpression. This might Indicate that the sequencedifferences between the 02UE1 and the /52UE1 -relatedelements reflect functional differences between theseelements. Constructs in which the 02UE1 was fused tothe hsp70 promoter revealed that testis-specificexpression of a marker gene is obtained only when theelement is located at the correct distance from thetranscription initiation site. However, constructs inwhich the 02UE1 was inserted at about the correctposition (between - 4 1 and -54 bp) upstream of atruncated 03 tubulin gene promoter did not show anyexpression. By making 02-03 gene promoter fusions itwas found that both the region surrounding the 03transcription initiation site as well as the first 116 b of03 leader sequences independently reduce testis-specific expression. These findings suggest that thetestis-specific expression of the Drosophila 02 tubulingene underlies a unique regulatory mechanism.

INTRODUCTION

Spermatogenesis results in a highly specialized cell, the motilesperm. Most, if not all, transcriptional activity in differentiating

Drosophila germ cells ceases before the meiotic divisions (1,2).Thus, the transcriptional activity in the primary spermatocyte-stage supplies all the information for postmeiotic spermdifferentiation.

Major components of mature sperm are microtubules. InDrosophila, four genes encode 0 tubulins (3,4), of which at leastthree are expressed in the testes. The 01 tubulin gene (0Tub56D)is expressed during the early stages of germ cell differentiationand its product is incorporated into the mitotic spindles andcytoplasmic microtubules of the gonial cells and maturing primaryspermatocytes (5, 6). The product of the 03 tubulin gene(0Tub6OB) is present in the cyst cells which surround alldescendants of one gonial cell up to the individualization stage(6, 7). While those genes are also expressed at other stages ofDrosophila development (7 -10), the 02 tubulin gene (0Tub85D)is expressed solely during spermatogenesis (5, 11-13), and itsproduct is the only prominant b tubulin isotype in the cytoskeletonof mature primary spermatocytes, in the meiotic spindles andin the sperm axoneme (6). This requires a highly efficienttranscription of the 02 tubulin gene during the meiotic prophase.

We have begun to examine the mechanisms regulating thetranscription of the 02 tubulin gene during spermatogenesis byfusing putative regulator sequences to the E. coli lacZ gene andestablishing transgenic strains with the Drosophila P-elementtransformation system (22). Our previous deletion analysis hadrevealed that a 14 bp promoter element, 02UE1, located at anidentical position in the promoter regions of the D. melanogasterand D. hydei 02 tubulin genes, is essential for the testis-specificexpression of the reporter gene (14). In this report, we testedwhether related sequences, found at similar positions in thepromoter regions of the Drosophila alcohol dehydrogenase(ADH) gene and 03 tubulin gene, both of which are not expressedin the male germ line, can substitute for the 02UE1. Furthermore,to determine whether the 02UE1 can mediate testis-specificexpression on a heterologous promoter, we performed P-elementmediated transformation studies with constructs in which the02UE1 was fused to a truncated Drosophila hsp70 promoter orto the truncated promoter of the 03 tubulin gene. Analyses of

• To whom correspondence should be addressed at: Institut fur Molelculargenetik, Fachbercich Biologie, Philipps-Universitat-Marburg, Postfach 1929, 3550Marburg, FRG

+ Present address: Department of Anatomy and Embryologie, University of Amsterdam, Meibergdreef 15, 1101 AZ Amsterdam, The Netherlands

Downloaded from https://academic.oup.com/nar/article-abstract/19/16/4515/2387572by gueston 11 April 2018

4516 Nucleic Acids Research, Vol. 19, No. 16

stable transformed flies revealed that the /32UE1 can mediatetestis-specific expression only in conjunction with the nsp70 genepromoter. This indicates that other sequence elements from the/32 tubulin gene promoter are not required for testis-specificexpression. We further present evidence that the absence of malegerm cell-specific expression of the jS2UEl-/33-lacZ gene fusionsis caused independently by sequences surrounding the transcrip-tion initiation site as well as by sequences from the 5' untranslatedregion of the /33 tubulin gene.

MATERIALS AND METHODSConstruction of the P-element derivativesThe Mut 11 construct, containing the upstream region of the /32tubulin gene in which the )32UE1 was replaced by the/J2UE1-related sequence from the Drosophila /33 tubulin gene,and the Mut 12 construct, containing the /32UE1 -related sequencefrom the ADH gene of Drosophila, were made analogous to theMut 2 construct (14). The EcoRI-BgLQ fragment of Mut 1 (14;see also Fig. 1A), containing the /52UE1, was replaced by eitherthe double stranded oligonucleotide (only one strand shown):5'-(GAATTC)AAGTCGCAGTCGACT(AGATCT)-3' for Mut11, or5'-(GAATTQAAGTCGACGTCGACT(AGATCT)-3' forMut 12. Shown between brackets are the restriction sites used,EcoRI and BgUI, respectively.

Mut 9 contains the (S2UE1 sequences between —38 and -51bp within the promoter of a hsp70 gene. The hsp70 gene promotersequences were obtained from a Xbal (-255 bp) to PstI ( + 89bp) subclone in pUC8 of plasmid 132E3 which contains a hsp7Ogene derived from the chromosomal location 87C (15). Toconstruct Mut 9, an oligonucleotide containing the doublestranded sequence (only one strand shown) 5'-(CTCGAG)AA-ATCGTAGTAGCCTATAGCTATAAAAACAGACGTGTC-GAT (GTCTAQ-3' (Xhol and AccI restriction sites are shownbetween brackets; the /32UE1 sequences are underlined) wasligated into XhoI-HindlH opened Bluescript 1 KS+ (Stratagene),together with an AccI ( - 1 3 bp) to Hindm (+89 bp) fragmentof the hsp70 gene. The resulting XhoI-HindlH fragment wasligated into the Drosophila P-element transformation vector pW8(16), together with the 3,8 kb Hindm-Xbal fragment of pUClac20(14) containing the E. coli lacZ gene.

Mut 10 contains three copies of the /S2UE1 sequences at —300bp upstream from the hsp70 transcription initiation site. Prior tothe construction of Mut 10, the promoter sequences of theDrosophila hsp70 gene were isolated by Nrul (—50 bp) andHindlQ ( + 89 bp) digestion. This fragment was ligated, togetherwith the 3,8 kb Hindm-Xbal fragment from pUClac20, into pW8.In the resulting plasmid, pWHL, the 5' end of the hsp70-lacZ genefusions are separated from the genomic sequences by a 5,5 kbhsp70-white gene sequence and P-element sequences. This shouldminimize the potential effects of chromosomal position on theexpression of the truncated hsp70 promoter.

To construct Mut 10, a 186 bp Bglll-Pvun fragment from the3' end of the mouse lysozyme M gene (17) was used as a spacer.This fragment was ligated into EcoRV-Bglll restricted plasmidpIC20H (21), resulting in the construct pIClysl. Triploidsequences of the /32UE1 were obtained by self-ligation of thefollowing double stranded, kinased oligonucleotide, containingEcoRI and BgUI compatible ends:

5 '-AATTC AAATCGTAGTAGCCTA-3'3 '-GTTTAGCATC ATCGGATCTAG-5'.

The —60 bp fragment was isolated on a 6% NuSieve agarose

gel (FMC Bioproducts) and ligated into EcoRI and BamHI cutpIClysl. From the resulting construct, the insert was isolated withSphI and Xhol and ligated into pWHL.

For the /S2-/33 promoter fusions, a double strandedoligonucleotide with the sequence (only one strand shown;underlined is the /32UE1; shown between brackets are therestriction sites used, EcoRI and Sail, respectively) (GAATT-C)AAATCGTAGTAGCCTATTTGTGAACATC(GTCGAOwas ligated, together with a 4,1 kb Sall-Xbal fragment from pW/33/lac-0.08 (8) which contains a truncated ( -28 bp to +116 bp)/33 promoter and the lac Z gene, into EcoRI-Xbal opened pW8.

To test the different parts of the /33 promoter for theirinterference with expression in the male germ line, a constructwas made (pW-Artiprom) which contains the /32UE1 at thecorrect distance upstream of the /32 transcription initiation site(from —2 to +8 bp) and which also contains an element fromthe /32 leader region between +51 bp and +68 bp (F.M. andR R.-P., in preparation) relative to the transcription initiationsite. The consensus TATA-box sequence (TATAAA) waspositioned between -27 bp and — 32 bp. All other bases (18)were scrambled, partially to create unique restriction sites. InpW-Artiprom-/33S, the sequences surrounding the #2transcription initiation site from —5 bp to +12 bp wereexchanged for the analogous sequences from the /33 tubulin gene(CGCCGATCAGTTGTGTC). In pW-Artiprom-jS3L, thescrambled leader sequences between + 13bp and +49 bp wereexchanged for the leader sequences of the /33 tubulin gene from+13 bp to +121 bp (for the sequences of the (33 tubulin gene,see 19). For a detailed description of the strategy and theoligonucleotides, please contact F.M.

All sequences were confirmed by sequence analysis of bothstrands. Sequencing reactions were performed on double strandedplasmids (20) using the Sequenase kit (USB).

Establishment of transformed fly strains

For microinjections, plasmids were purified by FJutip-D columns(Schleicher and Schull) as described previously (14). Embryosof the recipient strain w1 were chemically dechorionated andinjected according to Spradling and Rubin (22) with 400 /xg/mlof the pW8 derivatives and 100 /tg/ml of the helper plasmidpir25.7WC (23). Transformed strains were checked for carryingsingle and independent insertions by Southern blottingexperiments (24).

RNA analysisFor SI analysis, testes were isolated and pooled from at least5 independently obtained strains for each construct and RNA wasprepared as described (25). To detect RNAs of the endogenous(32 tubulin gene, we used a Seal to BstEII fragment (-127 bpto +211 bp), radioactively marked at the BstEII site. RNAs fromthe transposed lacZ fusion constructs were detected by hybridizingto a Scal-XhoH (-127 bp to +170 bp) fragment, derived fromthe /32-lacZ gene fusion construct and marked at the XhoII site.

Histochemical stainingStaining for (3-galactosidase activity with X-gal was performedas described (26)

RESULTSFunctional analysis of /32UEl-related sequencesPreviously, we identified a 14 bp element (/32UE1) which islocated between —38 bp and —51 bp in the promoter regions


Nucleic Acids Research, Vol. 19, No. 16 4517

of both the Drosophila hydei and D. melanogaster /32 tubulingenes and which is absolutely required to direct testis-specificexpression of a marker gene from these promoters (14). Thefunctioning of this element is dependent on its position sinceshifting it 37 bp further upstream of the /32 transcription initiationsite completely abolished expression (14). We also found thatit could not mediate expression in testes from the hsp70 genepromoter when positioned between -59 bp and -72 bp relativeto the hsp70 transcription initiation site. The Drosophilamelanogaster /33 tubulin gene and ADH gene contain sequencessimilar to the /32UE1 in their promoter regions (8, 27; seeFig. 1A). The positions of these elements is slightly different:between —46 and —59 bp relative to the /33 transcription initiationsite and between -56 and -69 bp in the ADH promoter. Neitherof these genes, however, is expressed in the male germ line (6,7, 28, 29). The sequences of the /32UE1 from theD. melanogaster ffl tubulin gene and the (32UE1 -related elementof the /33 tubulin gene differ at 4 out of 14 positions, while thereare 5 exchanges between the /32UE1 and the related element ofthe ADH promoter (see Fig. 1A). To determine whether thesesequences can functionally substitute for the /32UE1, weexchanged the /32UE1 in the |32 tubulin gene promoter for therelated sequences (see Fig. 1A and materials and methods) andestablished transformed fly strains. Analysis of the 6 strainsobtained with the Mut 11 construct, containing the /S2UE1-relatedsequences of the /33 tubulin gene, showed that all of themexpressed the lacZ gene specifically in the testes. (see, forexample, Fig. 1C). For all of these strains, however, expressionwas only observed after prolonged incubation with X-gal,suggesting that the level of expression was much lower than thatof the Mut 1 construct, which contains the /32UE1 of the ffltubulin gene. Of the 5 strains obtained from constructs containingthe /32UE1 related sequences of the ADH gene (Mut 12), 4 didnot show any expression. In the fifth strain, a very light stainingof the testes was observed after prolonged incubation with X-gal(see Fig. ID). None of the strains showed ectopic expressionof the transformed lacZ gene in any of the stages analysed(embryos, third instar larvae and adults).

A quantitative comparison of the expression from the differentconstructs is shown in Figure IE. Clearly, exchanging the /32UE1for the (33 related sequences (Mut 11) reduces the expression atleast ten fold, while no detectable signal can be seen afterintroduction of the ADH sequences (Mut 12). These resultssuggest that a unique cis-acting element directs the expressionof the j32 tubulin gene in the male germ line.

The /32UE1 can drive testis-specific expression from the hsp70promoterAs mentioned above, fly strains transformed with constructs inwhich the /32UE1 was inserted between -59 and -72 bpupstream of a truncated hsp70 promoter did not show anyexpression in the male germ line (14). This result could be dueto the increased distance from the hsp70 transcription start site.However, we could not exclude the possibility that other sequenceelements of the 02 tubulin gene are required for testis-specificexpression. Therefore, we introduced the /32UE1 sequencesbetween positions - 3 8 bp and -51 bp relative to the hsp70transcription initiation site and ligated these promoter sequencesinto the P-element transformation vector pW8 (16), using theE. coli lacZ gene as an indicator gene (Mut 9; see Fig. 2A andmaterials and methods). Germ line transformations gave rise to6 independently transformed strains. Staining larvae and adult

flies for £-galactosidase activity revealed that all expressed thelacZ gene. However, expression was not limited to the germ line,as was observed for all #2 tubulin gene fusions (14). Allhsp70-lacZ fusion constructs, with or without the /S2UE1, showedexpression in several other tissues, depending on the integrationsite (see, for example, staining of the wall of the seminal vesiclesin Fig. 2B).

In five of the strains transformed with Mut 9, j3-galactosidasewas detected in germ cells from the primary spermatocyte stageonwards (Fig. 2Q, as is the case for strains carrying the /32-lacZfusion constructs (Fig. IB) and the endogeneous /32 tubulin (6).

AHanoiconstruct

HumtMrofttralna Twtl» •!•< inii•ralynd

.1 . 1 « ATO

«•>•' IRTCGTR0TR6CCTR | -

M

• 1

" « " IflTCGcflGTcGoCTR \-kcZ

+18* ATO

Hutu IgTCGaoGToGaCTn

Fig. 1. Constructs and expression patterns of 02-lacZ fusion genes containingthe/32UEl or 02UEl-related sequences. (A) constructs used for analysis of the/32UE1-related sequences. Mut 1 (14) contains sequences between - 5 3 and+156 bp [relative to the transcription initiation site (arrow)] from the 02 tubulingene, fused to the E. coli lacZ gene (open box). The sequences from the 02UE1are indicated in capital letters. This element is flanked by an EcoRI site at the5' end and a Bgin site at the 3' end. These restriction sites were used to constructMut 11, containing the /32UEl-related sequences of the D. melanogaster 03 tubulingene, and Mut 12, containing the 02UEl-related sequences of the D. melanogasterADH gene. Sequences differing from the /S2UE1 are indicated by lower caseletters. (B-D) 0-galactosidase expression in testes of males transformed with Mut1 (B), Mut 11 (C) and Mut 12 (D). Staining times were 4 hours (B) or 8 hours(C-D). (E) Quantitative comparison of the RNA levels. RNA was isolated froma pooled total of 30 testes from independently transformed strains and analysedby SI nuclease analysis. The RNA level of the endogeneous 02 tubulin geneserved as a standard. Indicated above the lanes are the constructs used fortransformation (see Fig. 1A). White indicates RNA derived from the untransformedwhite strain. The arrows point to the protected fragments of the endogenous 02tubulin gene (211 b) and the protected fragment of the transformed 02-lacZ fusionconstructs (170 b). Abbreviations: T, testis; P, paragonia; S, seminal vesicles.The arrowheads point to the tip of the testes.



Name ofconstruct

pWHL

Mut9

-320MirMO

Number of Expressionstrains Inanalysed germ line

S2UE1 hsp70 lacZ

Fig. 2. Expression patterns from |32UEl-hsp70-lacZ constructs. Testes of transformed mates containing hsp70-lacZ or /32UE1-hsp70-lacZ fusion genes were dissectedand analyzed for 0-galactosidase expression. (A) Constructs used in P-element mediated transformations. For all hsp70-lacZ fusion genes, the upstream sequencesof a hsp70 gene (stippled box), derived from the chromosomal location 87C (15), were fused at position +89 bp in the 5' untranslated region to the E. coli lacZgene (open box) from pUClac20 (14). In pWHL, a Nrul site at -50 bp relative to the transcription initiation site was used for ligation into the P-element transformationvector pW8 (16). In Mut 9, the hsp70 sequences upstream from —37 bp were exchanged for the /S2UE1 sequences (hatched box). Mut 10 contains three copiesof the 02UE1 at around -300 bp relative to the hsp70 transcription initiation site from pWHL. Spacer sequences were from the mouse lysozyme M gene (17)and include polylinker sequences (see materials and methods). (B-D) X-gal staining patterns of testes from males transformed with the pWHL construct (B), Mut9 ( O and Mut 10 (D). In (B) some sperm bundles are stained by X-gal. This feature was observed in several of the strains transformed with the pWHL and pWHL-derived constructs. Testes were incubated with X-gal for 4 hours 8 hours (B-D). Abbreviations: T, testis; P, paragonia; S, seminal vesicles. Trie arrowheads pointto the tip of the testes.

Namaofconstruct

f32UE1-03-64-41-35-30

+1

coral V -+124

—IZ

Numbarofstndnsanalysed

s

ExpressionIngerm fine

02UE1 Saquaneaa of tha 03 tubutln gana laoZ

* - P

Fig. 3. Expression patterns of males transformed with the |J2UEl-/33-lacZ fusion constructs. To further study whether the 02UE1 could induce testis-specific expressionon a heterologous promoter, a construct was made which contained the 02UE1 sequences upstream of a trancated (13 tubulin gene promoter (from - 4 0 bp to +116 bp),fused to the E. coli lacZ gene. This fusion gene (A) was ligated into pW8 and transgenic strains were investigated for lacZ expression by X-gal staining. The stainingpattern in whole males is shown in (B). The absence of expression from the fusion construct in the testes is shown in (Q .



Staining of the primary spermatocytes was not observed in anyof the strains transformed with the hsp70-lacZ fusion constructslacking the 02UE1 or which had the /32UE1 inserted further 5'to the transcription initiation site (14; see also Fig. 2B and 2D).This demonstrates that the /32UE1 can activate the hsp70promoter in primary spermatocytes, indicating that other cis-acting elements from the /32 tubulin gene are not absolutelyrequired. The expression level is much reduced as judged by thetime required for staining, and the mRNA is hardly detectableby SI analysis (data not shown). Nevertheless, these results showthat the 14 bp /J2UE1 is capable of driving expression from aheterologous promoter alone.

Several elements have been described which function only asposition and orientation independent transcription activators(enhancers) when present in multiple copies (30-32). To testwhether the /32UE1, when oligomerized, can drive testis-specificexpression at a gTeater distance from the transcription initiationsite, a construct was made which contains 3 copies of the /32UE1at around — 300 bp relative to the hsp70 transcription start site(Mut 10; see Fig. 2A and materials and methods). None of the5 strains transformed with this construct showed expression ofthe lacZ gene in the male germ line (see Fig. 2D as an example).However, some staining in somatic tissues is observed showingthat the promoter is functional resulting in enhancer trap likestaining. Thus, the distance between the /92UE1 and (an)otherpromoter element(s), presumably the TATA-like element or the

transcription initiation site, is important for testis-specificexpression even when the /32UE1 is present in multiple copies.

The Drosophila jS3 tubulin gene promoter can not be activatedin the male germ lineA second sequence that was used for testing the ability of the/32UE1 to induce testis-specific expression on a heterologouspromoter, was derived from the Drosophila £3 tubulin gene.Using double stranded oligonucleotides, the /32UE1-sequence wasfused to a truncated /33 tubulin gene promoter, thereby deletingthe similar element of the /33 tubulin gene itself. The constructcontains 116 bp of the 5' untranslated region of the /33 tubulingene, at which position the fusion to the E. coli lacZ gene wasmade. The position of the /32UE1 in this /S2-/S3 fusion constructwas between -41 bp and - 5 4 bp in front of the j33 transcriptioninitiation site. The distance between the /32UE1 and the TATA-like element of the /53 tubulin gene (19) was 5 bp, as is the casefor the /32UE1 and a similar element in the j32 tubulin genepromoter (14). Within the /32 tubulin gene promoter, the /32UE1still functions, if it is located between —42 bp and -55 bp (14).

After ligating this fusion construct into the pW8 vector, 5independently transformed strains were established. Staining withX-Gal for lacZ activity revealed that these strains hardly showedlacZ expression in male germ line cells. A light blue colour wasobtained after overnight incubation with X-gal (Fig. 3). Thetransformed strains showed dark blue staining patterns in other

Nam* ofconstruct

Mut1

pW-AP

pW-APp3S

pW-APp3L

Number o) Expression

-51 -M-S2 -27 «41 +98 +158

(trainsanalysed

Ing«rmltne

02UE1 i2LB1 KoZ

B

Fig. 4. Expression patterns of males transformed with the pW-Artiprom construct (pW-AP) and its derivatives. To investigate which part of the upstream regionof the 03 tubulin gene interferes with expression in male germ cells, a construct (pW-Artiprom) was made which contains the 02UE1 element, a consensus TATA-boxsequence, the 02 transcription initiation site and an element from the leader region of the 02 tubulin gene between +51 bp and + 6 8 bp (02LB1; F. M. and R.R.-P.,in preparation). All other nucleotides were derived from the 02 tubulin gene but were scrambled, partially to create unique restriction sites. The region surroundingthe transcription initiation site as well as the leader sequences (except for the 02LB1 -sequences) were subsequently replaced by sequences derived from the 03 tubulingene. (A) shows the constructs used in this study. The /3-galactosidase expression in testes of transformed males was investigated by X-gal staining. (B) shows theexpression from the - 5 3 deletion construct of the 02 tubulin gene (Mut 1). ( Q X-gal staining of testes of males transformed with pW-Artiprom. (D) and (E) analysesof the 0-galactosidase activity in testes of males transformed with the pW-Artiprom-03S and pW-Artiprom-03L constructs, respectively. Abbreviations: T, testis;P, paragonia; S, seminal vesicles. The arrowheads point to the tip of the testes.



adult tissues (data not shown), presumably due to regulatoryelements at the integration sites. We were not able to detect anylacZ-mRNAs in the testes of transformed males by SI protectionanalyses (data not shown). Our conclusion is that the presenceof the /32UE1 between positions —41 bp and -54 bp 5' to atruncated /J3 tubulin gene promoter is not sufficient to induceexpression in the male germ line. Thus, either both the increaseddistance of the /32UE1 to the transcription initiation site and thepresence of the promoter sequences from the (33 tubulin gene,or one of these factors by itself, interferes with expression fromthis construct in primary spermatocytes.

The transcription initiation site and the leader sequences ofthe )S3 tubulin gene independently reduce testis-specificexpressionTo study which part of the upstream region of the /33 gene isinvolved in the inhibition of expression in male germ cells, weconstructed pW-ArtiProm (pW-AP; see Fig. 4A). pW-Artipromcontains the /32UE1 sequences between - 3 8 bp and —51 bp infront of the /32 transcription initiation site from —2 bp to +8 bp,and in which the fusion to the pUClac20 sequences (14) was madeat +69 bp. pW-Artiprom also contains a consensus TAT A-boxsequence between - 2 6 bp and —32 bp and an element from theleader region of the 02 tubulin gene (J32LB1) between +51 bpand +68 bp (see Fig 4A). The presence of the /32LB1 enhancesthe expression level in adult testes, presumably by stabilizing themRNAs (F. M. and R. R.-P., in preparation). All other nucleotideswere derived from the upstream region of the (32 tubulin genebut were scrambled to exclude further structural elements.

Strains, independently transformed with pW-Artiprom, showedcorrect expression of the lacZ gene in male germ cells albeit thelevel of expression was reduced compared to a —53 bp deletionconstruct of the /32 tubulin gene promoter (compare Fig. 4B andFig. 4C). This reduction might be due to the presence of aTAT A-box consensus sequence and to the scrambling of the otherpromoter sequences which, each by itself, reduce testis-specificexpression when introduced in the /?2 tubulin gene promoter (14).

To test which part of the /33 tubulin gene interferes withexpression in the male germ cells, two derivatives of pW-Artiprom were constructed: in pW-Artiprom-/33S, the sequencesof the /32 transcription initiation site between - 5 bp and +12 bpwere exchanged for those of the j33 tubulin gene, and in pW-Artiprom-j33L, the leader sequences were exchanged for thoseof the /33 tubulin gene from +13 bp to +121 bp. The /32LB1was positioned between +125 bp and +142 bp in pW-Artiprom-/33L (see Fig. 4A). For each of these constructs, independentlytransformed strains were established. Analysing males of thesestrains by X-gal staining revealed that neither of them showedany expression of the /3-galactosidase in the male germ cells(compare Fig. 4C with Figs. 4D-E). Most males, and especiallythose transformed with pW-Artiprom-j33L, showed lacZexpression in the remaining parts of the abdomen, also indicatingthat these results are not due to construction artifacts.

In summarizing: the presence of the j32UEl at the correctposition in front of a truncated hsp7O promoter is sufficient forexpresssion from this promoter in male germ cells, showing thatthe /32UE1 is the only element from the |32 tubulin gene promoterthat is absolutely required for testis-specific expression. The/32UE1 does not function when located further 5' to the hsp70promoter, neither as a monomer nor in multiple copies. However,the /32UE1 does not function in front of a truncated (33 tubulingene promoter. It was found that both the sequences surrounding

the /33 transcription initiation site as well as the sequences fromthe leader region of the /33 tubulin gene interfere with expressionin primary spermatocytes.

DISCUSSION

In the present report, we extended our previous study on theregulation of the testis-specific expression of the Drosophila (32tubulin gene (14). A 14 bp promoter element (/J2UE1), whichis indispensible for expression from the /32 tubulin gene promoter,was found to activate transcription from the Drosophila hsp70promoter in the testes when positioned between - 3 8 and — 51 bpupstream of the hsp70 transcription initiation site, but did notdirect testis-specific expression from this position in front of atruncated /33 tubulin gene promoter. Inserting it further upstreamof the hsp70 promoter, either as a monomer (14) or as a trimerdid not lead to detectable lacZ expression in the testes. Thisconfirms our previous conclusion that the /32UE1 is a promoterelement inherently required for testis-specific expression of the/32 tubulin gene. Expression from a hsp70 gene promotercontaining the heat shock responsive elements is barely detectablein the male germ line (26, 41), and the truncated promoter alonedid not drive any expression in primary spermatocytes in anyof the strains analysed. The fact that a single 14 bp element canact as a tissue-specific inducer on this promoter is astonishing.

The truncated (33 tubulin gene promoter could not be activatedin male germ cells by the presence of the /32UE. Even moreremarkable are the results obtained with the pW-Artiprom constructand its derivatives. Although expression of the lacZ gene frompW-Artiprom in the testes was much reduced compared to /32-lacZfusion constructs, no expression was detected after exchanging thesequences surrounding the transcription initiation site or thesequences from the leader region for sequences derived from the/33 tubulin gene in pW-Artiprom-/33S and pW-Artiprom-/33L,respectively. We assume that the sequences from the /33 tubulingene, which is expressed in all mesodermal derivatives (9), containelements which down-regulate the expression in male germ cells,

HUS7FDonxMNIBUrn*Flhyd

tapan#(2)P

mraanau

tapro

Droaopl*riuch coi•1 art

•s

tttgttagtctggtcggttcgtctc

agcact t t t c

• — tc

gcgtc

• navhMmil

cgccg

+1 +10

flTCRTTRTTflflHTflfl6CflTCRCflTTGCTGGRGTTCRCCTCRTTCCRRCRT

RBflTCCflflTTRTTRTCGRTfl

R-UUYRflUT-

RflTTCnflTTC

HTCRKTV—

HTCRGTTGTG

Fig. 5. Conserved sequences surrounding the transcription initiation sites of genesthat are transcribed in the testes of Drosophila. Listed are the Cap-domains ofMsl87F (formerly called mst(3)gl-9 ; 42), gonodai (43), jaws B (44), and the/32 tubulin genes of D. melanogaster (02 mel) and D. hydei 032 hyd) (18), allof which are testis-specifically expressed, and the domains of hsp26 (45, 46) andref(2)P (47), which are non-exclusively expressed in the testes. The consensussequence was constructed at those nucleotides which were conserved in at least6 of the 8 listed genes. As a comparison are shown the region surrounding thehsp70 transcription initiation site (33) and the consensus transcription initiationsequences of Drosophila non-heat shock genes, as compiled by Hultmark el al.(33). Included is also the region surrounding the transcription initiation site ofthe Drosophila 03 tubulin gene (19). Abbreviations: W, A or T; Y, C or T;R, A or G; M, A or C; K, G or T.



either by inhibiting transcription or by lowering the mRNAstability. The nature of these elements is as yet unknown. Thetranscription initiation domain swapping experiment is especialconfusing, since the sequences at the /J3 transcription initiationsite (ATCAGTT) are 100% identical to the Drosophila consensussequence (33), while those of the /32 tubulin gene (AGTTCACC)do not match. Compiling all transcription initiation sites from malegerm cell-specifically expressed genes of Drosophila (Fig. 5)indicates that none of these show much similarity to the consensussequence. Rather, a new consensus sequence for the transcriptioninitiation sites of genes expressed in male germ cells can beconstructed (see Fig. 5). This consensus sequence could reflecta regulatory domain surrounding the transcription initiation site.The region surrounding the transcription initiation site of theterminal deoxynucleotidyltransferase gene was found to besufficient for accurate basic transcription and was termed the'initiator' domain (34). Initiator-like domains have also been foundin other genes (35-37) and they may be involved in the correctpositioning of the CAP-site. It will be of interest to see if differentinitiator domains can contribute to the tissue- or cell type-specificexpression of their genes. The fact that a construct containing only5 bp upstream of the transcription initiation site of the mst(3)-gl-9gene is still capable of testis-specific expression (38; R. Kuhn andM. Schafer, personal communication) seems to support this idea.

Sequences related to the /S2UE1, as found in the promoterregions of the Drosophila ADH and /33 tubulin genes, severelyreduced the testis-specific transcription from the /92 tubulin genepromoter after replacing the /32UE1. Neither of these genes isnormally expressed in male germ cells (6, 7, 28, 29). The/32UE1-related sequence in the ADH gene is part of a regionin the distal promoter which is protected from DNasel digestionby ADF-1, and which is required for optimal in vitro transcriptionfrom this promoter (39, 40). We do not know the function ofthe sequence within the /33 tubulin gene promoter at the moment.The reduced expression in testes from constructs containing the/32UE1-related sequences can be correlated to the reduced abilityof these sequences to compete for binding to the /32UE1 inelectrophoretic mobility shift assays (B.Kaltschmidt and R.R.P.,unpublished results). Furthermore, that the ADH and (33 tubulingenes themselves are not expressed in the male germ line canbe due to the increased distance between the /32UE1 -relatedsequences and their respective transcription initiation sites.

Further analysis of the trans-acting protein(s) that recognizethe /32UE1 will provide more insight into the mechanismsregulating gene expression during Drosophila spermatogenesis.

ACKNOWLEDGEMENTS

We thank Andrea Oswald and Dr. Ronald Mertz for the synthesisof oligonucleotides, Dr. B.Hovemann for the hsp70 construct,Prof. Hollander for the microscope facility, and members of thefly lab and Cathy Schindewolf for stimulating discussions andcritical reading of this manuscript. This research was supportedby the Deutsche Forschungsgemeinschaft (RE 628/4-1) and theBMFT.

REFERENCES1. Lindsley, D. L., and Tokuyasu, K. T. (1980) Spermatogenesis. In: The

genetics and biology of Drosophila, Vol. 2D , Ed: Ashbumer, M., andWright, T. R. F. Academic Press, London, p. 225-294

2. Hackstein, J. H. P. (1987) Spermatogenesis in Drosophila . In: Results andproblems in cell differentiation. Vol. 15, Ed: Hennig, W. Springer-Verlag,Berlin-Heidelberg, p. 63-116

3. Bialojan, S., Falkenburg, D., and Renkawitz-Pohl, R. (1984) EMBOJ., 3,2543-2548

4. Natzle, J. E., and McCarthy, B. J. (1984) Dcv. Biol., 104, 187-1985. Kemphues, K. J., Kaufman, T. C , Raff, R. A., and Raff, E. C. (1982)

Cell, 31, 655-6706. Kaltschmidt, B., Glatzer, K. H., Miduds, F., and Renkawitz-Pohl, R. (1991)

Eur. J. Cell Biol., 54, 110-1207. Kimble, M., Incardona, J. P., and Raff, E. C. (1989) Dev. Biol ., 131,

415-4298. Gasch, A., Hinz, U., and Renkawitz-Pohl, R. (1989) Proc. Nail. Acad

Sci. USA, 86, 3215-32189. Leiss, D., Hinz, U., Gasch, A., Mertz, R., and Renkawitz-PohJ, R. (1988)

Development, 104, 525-53110. Buttgereit, D., Leiss, D., Michiels, F., and Renkawitz-Pohl, R. (1991) Mech.

Develop., 33, 107-11811. Kemphues, K. J., Raff, R. A., Kaufman, T. C , and Raff, E. C. (1979)

Proc. Nat. Acad. Sci. USA, 76, 3991-399512. Fuller, M. T., Caulton, J. H., Hutchens, J. A., Kaufman, T. C , and Raff,

E. C. (1987) J. Cell Bid., 104, 385-39413. FuUer, M. T., Caulton, J. H., Hutchens, J. A., Kaufman, T. C , and Raff,

E. C. (1988)7. Cell Biol., 107, 141-15214. Michiels, F., Gasch, A., Kaltschmidt, B., and Renkawitz-Pohl, R. (1989)

EMBOJ., 8, 1559-156515. Karch, F., Torok, I., and Tissieres, A. (1981)7. Mol. Biol., 148, 219-23016. Klemenz, R., Weber, U., and Gehring, W. J. (1987) Nucleic Acids Res.

15, 3947-395817. Cross, M., Mangelsdorf, I., Wedel, A., Renkawitz, R. (1988) Proc. Nat.

Acad Sci. USA, 85, 6232-623618. Michiels, F., Falkenburg, D., Muller, A. M., Hinz, U., Otto, U., BeUmann,

R., Glatzer, K. H., Brand, R., Bialojan, S., and Renkawitz-Pohl, R. (1987)Chromosome, 95, 387-395

19. Gasch, A., Hinz U., Leiss, D., and Renkawitz-Pohl, R. (1988) Mol. Gen.Genet., 211, 8-16

20. Chen, E. J., and Seeburg, P. H. (1985) DNA, 4, 165-17021. Marsh, J L., Ertle, M., and Weykes, E. J. (1984) Gene, 32, 481-48522. Spradling, A. C , Rubin, G. M. (1982) Science, 218, 341-34723. Karess, R. E., and Rubin, G. M. (1984) Cell, 38, 135-14624. Southern, E. M. (1975) J. Mol. Biol., 98, 503-51725. Steller, H., and Pirotta, V. (1984) EMBOJ., 3, 165-17326. Glaser, R. L., Wolfner, M. F., and Lis, J. T. (1986) EMBOJ., 5, 747-75427. Benyajati, C , Spoerel, N., Haymerle, H., and Ashbumer, M. (1983) Cell,

3, 125-13328. Ursprung, H., Sofer, W. H., and Burroughs, N. (1970) Roux's Arch. Dev.

Biol., 164, 201-20829. Goldberg, D. A., Posakony, J. W., and Maniatis, T. (1983) Cell, 34, 59-7330. Ondek, B., Shepard, A., and Hen, W. (1987) EMBOJ., 6, 1017-102531. Pierce, J. W., Lenardo, M., and Baltimore, D. (1988) Proc. Nat. Acad.

Sci. USA, 85, 1482-148632. Schatt, M. D., Rusconi, S., and Schaffner, W. (1990) EMBOJ., 9,481 -48733. Hultmark, D., Klemenz, R., and Gehring, W. J. (1986) Cell, 44, 429-43834. Smale, S. T., and Baltimore, D. (1989) Cell, 57, 103-11335. Ayer, D. E., and Dynan, W. S. (1988) Mol. Cell. Biol., 8, 2021-203436. Means, A. L., and Farnham, P. J. (1990) Mol. Cell. Biol., 10, 653-66137. Nikovits JR, W., Mar, J. H., and Ordahl, C. P. (1990) Mol. Cell. Biol.,

10, 3468-348238. Schafer, M., Kuhn, R., Bosse, F., and Schafer, U. (1990) EMBOJ., 9,

4519-452539. Heberlem, U., England, B., and Tjian, R. (1985) Cell, 41, 965-97740. Heberiein, U., and Tjian, R. (1988) Nature, 331, 410-41541. Bonner, J. J., Parks, C , Parker-Thomburg, J., Mortin, M. A., and Pelham,

H. R. B. (1984) Cell, 37, 979-99142. Kuhn, R., Schafer, U., and Schafer, M. (1988) EMBOJ., 7, 447-45443. Schulz, R. A., and Butler, B. A. (1989) Genes Dev., 3, 232-24244. Yanicostas, C , Vincent, A. and Lepesant, J.-A. (1989) Mol. Cell. Biol.,

9, 2526-253545. Cohen, R. S., and Meselson, M. (1985) Cell, 43, 737-74646. Glaser, R. L., and Lis, J. T. (1990) Mol. Cell. Biol., 10, 131-13747. Dezelce, S., Bras, F., Contamine, D., Lopez-Ferber, M., Segretain, D.,

and Teninges, D. (1989) EMBO J., 8, 3437-3446


further sequence requirements for male germ cell-specific

Documents