© 2016 Zoological Society of JapanZOOLOGICAL SCIENCE 33: 414–425 (2016)

A Stenohaline Medaka, Oryzias woworae, Increases Expressionof Gill Na+, K+-ATPase and Na+, K+, 2Cl– Cotransporter

1 to Tolerate Osmotic Stress

Jiun-Jang Juo1†, Chao-Kai Kang2†, Wen-Kai Yang1†,Shu-Yuan Yang1, and Tsung-Han Lee1,3*

1Department of Life Sciences, National Chung Hsing University, Taichung 402, Taiwan2Tainan Hydraulics Laboratory, National Cheng Kung University, Tainan 709, Taiwan

3Department of Biological Science and Technology, China Medical University,Taichung 404, Taiwan

The present study aimed to evaluate the osmoregulatory mechanism of Daisy’s medaka, O. woworae,as well as demonstrate the major factors affecting the hypo-osmoregulatory characteristics of eury-haline and stenohaline medaka. The medaka phylogenetic tree indicates that Daisy’s medaka belongs to the celebensis species group. The salinity tolerance of Daisy’s medaka was assessed. Our findings revealed that 20‰ (hypertonic) saltwater (SW) was lethal to Daisy’s medaka. However, 62.5% of individuals survived 10‰ (isotonic) SW with pre-acclimation to 5‰ SW for one week. This transfer regime, “Experimental (Exp.) 10‰ SW”, was used in the following experiments. After 10‰ SW-transfer, the plasma osmolality of Daisy’s medaka significantly increased. The protein abun-dance and distribution of branchial Na+, K+-ATPase (NKA) and Na+, K+, 2Cl– cotransporter 1 (NKCC1) were also examined after transfer to 10‰ SW for one week. Gill NKA activity increased significantly after transfer to 10‰ SW. Meanwhile, elevation of gill NKA αα-subunit protein-abundance was found in the 10‰ SW-acclimated fish. In gill cross-sections, more and larger NKA-immunoreactive (NKA-IR) cells were observed in the Exp. 10‰ SW medaka. The relative abundance of branchial NKCC1 protein increased significantly after transfer to 10‰ SW. NKCC1 was distributed in the basolateral membrane of NKA-IR cells of the Exp. 10‰ SW group. Furthermore, a higher abundance of NKCC1 protein was found in the gill homogenates of the euryhaline medaka, O. dancena, than in that of the stenohaline medaka, O. woworae.

Key words: Oryzias woworae, gill, Na+, K+-ATPase, Na+, K+, 2Cl– cotransporter 1, stenohaline, osmotic stress

INTRODUCTION

Teleosts are aquatic vertebrates that cope with osmotic and ionic gradients in aquatic environments with diverse salinities (Hwang and Lee, 2007). Species of genus Oryziasexhibit the ability to adapt to a wide spectrum of environ-mental salinity, although adaptability varies from species to species. Inoue and Takei (2003) reported that O. javanicusand O. dancena exhibited highly salinity adaptability. O. javanicus and O. dancena survived a direct transfer from freshwater (FW) to seawater or to 1/2 seawater. Meanwhile, O. latipes survived subsequent direct transfer to full-seawater(35‰) with pre-acclimation to 1/2 seawater, whereas O. marmoratus was intolerant to SW transfer or 1/2 seawater transfer (Inoue and Takei, 2003).

The ability to adapt to environmental salinity by certain

mechanisms is known as osmoregulation. In general, fresh and marine water-living fish tend to manage a net water influx or efflux in order to keep constant plasma osmolality. In the branchial epithelium, a specialized cell type, iono-cytes, also known as mitochondria-rich cells, are the main site for the active transport of ions. The driving force for active transport is created by Na+, K+-ATPase (NKA), which exchanges two extracellular K+ molecules with three intrac-ellular Na+ via the hydrolysis of one molecule of ATP. Previous studies have demonstrated that NKA is localized specifically to the tubular system (Hootman and Philpott, 1979; Dang et al., 2000). Significant increases in the abun-dance and activity of NKA, as well as the number and size of NKA-immunoreactive cells (NKA-IR cells) were also observed upon salinity challenge in gills of the salmonids (Hiroi and McCormick, 2007) and medaka (Kang et al., 2008). Both euryhaline medakas, O. latipes and O. dancena,exhibit clear seawater adaptation mechanisms on their bran-chial ionocytes. On salinity challenge, enhanced expression of NKA was found in gills of the O. latipes and O. dancena, accompanied by enlarged NKA-IR cell size, increased NKA-IR cell number, and elevation of NKA activity (Kang et al.,

* Corresponding author. Tel. : +886-4-2285-6141;Fax : +886-4-2287-4740;E-mail : thlee@email.nchu.edu.tw

† JJJ, CKK, and WKY contributed equally to this paper.Supplemental material for this article is available online.doi:10.2108/zs150157

Hypo-osmoregulation of Daisy’s medaka 415

2008). Upregulated protein or gene expressions of branchial NKCC1 were found in both O. latipes (Hsu et al., 2014) and O. dancena (Kang et al., 2010) in response to salinity challenge. Previous studies indicated that Cl– secretion in ionocytes was dependent on basolateral Na+, K+, 2Cl–

cotransporter 1 (NKCC1) (Marshall, 2002; Hwang and Lee, 2007; Seo et al., 2013; Chandrasekar et al., 2014). BasolateralNKCC accumulates Cl– intracellularly above its electrochem-ical equilibrium so that Cl– exits passively via anion channels in the apical membrane. The gill ionocytes of euryhaline teleosts exhibited salinity-dependent expression of NKCC in the basolateral membrane upon hyperosmotic stress (Tipsmark et al., 2002; Wu et al., 2003; Scott et al., 2004; Hiroi and McCormick, 2007; Kang et al., 2010). Hiroi and McCormick (2007) reported that NKCC abundance was upregulated after transfer from FW to seawater in parallel with gill NKA activity in three salmonids, lake trout (Salvelinus namaycush), brook trout (Salvelinus fontinalis) and Atlantic salmon (Salmo salar). Interestingly, the Atlantic salmon which shows a 100% survival rate on direct seawater transfer, exhibits a higher gill NKCC abundance than two other salmo-nids. Accordingly, it was speculated that gill NKCC abun-dance is positively correlated with salinity tolerance.

Daisy’s medaka (Oryzias woworae) is a recently described, remarkably colorful species. This species, how-ever, is only known to inhabit FW streams of Sulawesi, Indonesia (Parenti and Hadiaty, 2010). Takehana et al. (2005) have illustrated three phylogenetic groups in the phy-logenetic tree of medakas. Of these, two euryhaline medaka fishes, the Japanese medaka (O. latipes) and the brackish medaka (O. dancena) are respectively classified into the latipes and javanicus species groups (Takehana et al., 2005). On the other hand, the O. marmoratus exhibiting stenohalinity (Inoue and Takei, 2002, 2003) was classified to be a member of celebensis species group (Takehana et al., 2005). According to the experiments of previous studies (Inoue and Takei, 2002; Kang et al., 2010), different mortal-ity rates were observed when Daisy’s medaka were exposed to various environments with a salinity gradient from FW to SW. Previous studies by our group revealed that the Japanese medaka and the brackish medaka shared a similar osmoregulatory mechanism including the elevated NKA activity, increased number of NKA-IR cells, and the enlargement of the NKA-IR cells upon osmotic stress (Kang et al., 2008). To reveal the phylogenetic group of O. woworae, the phylogenetic tree of medakas was reconstructed with genomic DNA sequences of 12S rRNA and 16S rRNA in this study. The present study also evaluated the profiles of gill NKA and NKCC1 abundances in Daisy’s medaka exposed to FW and the tolerating saltwater. In addition, the branchial NKCC1 abundance between Daisy’s medaka and the brackish medaka in the same environmental salinity was compared.

MATERIALS AND METHODS

Ethics statementThe facilities and protocols for experimental animals were

approved by the Institutional Animal Care and Use Committee of the National Chung Hsing University (IACUC approval no. 102–114 to THL).

Fish and experimental environmentsAdult Daisy’s medaka (Oryzias woworae) and brackish

medaka (O. dancena) with an average standard length of 2.5 ± 0.4 cm were obtained from local aquaria and reared in 10-liter aquarium tanks containing air-exposed local tap water for at least four weeks under 14 hr:10 hr light: dark photoperiod at 28 ± 1°C. The water was partially refreshed (50%) every week. For our experiments, 5‰, 10‰,15‰, 20‰, and 35‰ saltwater (SW) were prepared from freshwa-ter with proper amounts of the synthetic sea salt “Instant Ocean” (Aquarium Systems, Mentor, OH, USA). The freshwater (FW) was aerated local tap water. The fish were fed with commercial pellets twice a day. The facilities and protocols for experimental animals were approved by the Institutional Animal Care and Use Committee of the National Chung Hsing University (IACUC approval no. 102–114 to THL). Fish were not fed one day before the following experi-ments, and were anaesthetized with MS-222 (100 mg/l; 3-aminoben-zoic acid ethyl ester, Sigma, St Louis, MO, USA) before sampling.

Genomic DNA extractionPartial caudal fins of Daisy’s medaka were excised and stored

at –80°C. For extracting genomic DNA, caudal fins of Daisy’s medaka were homogenized with PELLET PESTLE Cordless Motor (Kimble Chase, Vineland, NJ) and PELLET PESTLE (Kimble Chase) at maximum speed (3000 rpm) in lysis buffer (100 mM NaCl, 1% SDS, 100 mM EDTA, 50 mM Tris) containing Proteinase K (Roche Molecular Biochemicals, Indianapolis, IN, USA) and heated to 57°C for 1 hr. Phenol/chloroform was added to the lysed mixture and centrifuged at 4°C, 15,000 g for 5 min. The supernatant was removed and mixed with equal volume of isopropyl alcohol and 1/10 volume of 3M sodium acetate followed by cooling at –20°C for 5 min. After subsequent centrifugation at 15,000 g for 10 min, the supernatants were discarded and the pellets were dissolved in ster-ilized water. For constructing a phylogenetic tree, 12S rRNA and 16S rRNA gene sequences of the Daisy’s medaka were amplified by PCR with primers designed according to Takehana et al. (2005). The PCR products were separated by 1% agarose gel electropho-resis, and a single band area of the gel was excised for purification by 1-4-3 DNA Extraction (PROTECH, Taipei, Taiwan). The purified PCR product (12S rDNA, 430 bp; 16S rDNA, 525 bp) was ligated to pOSI-T-vector and then transfected to DH5α competent cells using pOSI-T PCR cloning kit (GeneMark, Taiwan). The transfected competent cells were cultivated on LB agar plates with kanamycin for the selection of successfully transfected cells. When colonies reached optimal size, the colonies were collected and sequenced (ABI 3730 DNA sequencer, Tri-I Biotech Inc., Taipei, Taiwan).

Phylogenetic treeThe gene sequences of 12S rRNA (O. celebensis, AB188691;

O. curvinotus, AB188693; O. dancena, AB188694; O. hubbsi, AB188696; O. javanicus, AB188698; O. latipes, AB188701; O. luzonensis, AB188705; O. marmoratus, AB188706; O. matanensis, AB188707; O. mekongensis, AB188709; O. minutillus, AB188710; O. nigrimas, AB188712; O. profundicola, AB188713; Xenopoecilus oophorus, AB188714, and O. sarasinorum, AB188715) and 16S rRNA (O. celebensis, AB188718; O. curvinotus, AB188720; O. dancena, AB188721; O. hubbsi, AB188723; O. javanicus, AB188725; O. latipes, AB188728; O. luzonensis, AB188732; O. marmoratus, AB188733; O. matanensis, AB188734; O. mekongensis,AB188736; O. minutillus, AB188737; O. nigrimas, AB188739; O. profundicola, AB188740; X. oophorus, AB188741, and O. sarasino-rum, AB188742) of the other medakas were downloaded from the GeneBank, and those of Cololabis saira (AB188689 and AB188716) and Cypselurus pinnatibarbatus japonicus (AB188690 and AB188717) were also downloaded, representing outgroup spe-cies. All gene sequences of 12S rRNA and 16S rRNA of all species described above were then aligned using ClustalW software (available at http://embnet.vital-it.ch/software/ClustalW.html). Subsequently, phy-

J.-J. Juo et al.416

logenetic analysis was conducted with MEGA 5.2 software (Tamura et al., 2011) via maximum likelihood method. Reliability of the tree was assessed by bootstrapping (1000 replications).

Salinity tolerance testsDaisy’s medaka were transferred from FW to FW, 5‰, 10‰,

15‰, 20‰, 35‰ SW, respectively, with 15 individuals used for each experiment. The 7th day was set as the end-point of the exper-iment, from which the number of surviving individuals were summa-rized. In addition, the experimental 10‰ (Exp. 10‰, 342–352 mOsm/kg) SW group of adult Daisy’s medaka were transferred from FW to 5‰ SW for seven days first, and then transferred to 10‰ SW for another seven days. Five individuals were exposed to each medium for seven days (FW, 5‰, 10‰, 15‰, 20‰, 35‰ SW, and Exp. 10). The survival rates for transfer to different salinity SW were deter-mined in triplicate to reveal the salinity tolerance of Daisy’s medaka.

Plasma analysisBlood was collected according to the method of Kang et al.

(2008). Each plasma sample was pooled from the blood of 10 indi-viduals. 70 individuals in total were used for determining the plasma osmolality. After centrifugation at 1,000 g and 4°C for 5 min, the plasma was stored at –80°C. Plasma osmolality was determined by the vapor osmometer 5520 (Wescor, Logan, UT, USA). For deter-mining the concentration of sodium and chloride ions, each plasma sample was collected from one individual, and the sample size was accumulated to seven in this experiment. The concentration of plasma Na+ was determined using a Hitachi Z-8000 polarized Zeeman atomic absorption spectrophotometer (Hitachi, Tokyo, Japan). The concentration of plasma Cl– was determined with the ferricyanide method (Franson, 1985) and a VERSAmax ELISA microplate reader (Molecular Devices, Sunnyvale, CA, USA).

Preparation of gill samplesFish from the FW (control) and Exp. 10‰ groups were anes-

thetized with MS-222 then the gills were excised and immediately stored at –80°C before use. The gills were homogenized in SEID buffer (150 mM sucrose, 10 mM EDTA, 50 mM imidazole, and 0.1% sodium deoxycholate, pH 7.5) containing proteinase inhibitor with a Polytron PT1200E at maximal speed for 10 seconds on ice. The homogenates were then centrifuged at 5500 g at 4°C for 15 min. The supernatants were used for western blotting and the determi-nation of NKA activity.

AntibodiesThe primary antibodies used in this study included: (1,2) Na+,

K+-ATPase (NKA) α-subunit: a mouse monoclonal antibody (α5; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) raised against the α-subunit of the avian NKA and a rabbit monoclonal antibody (EP1845Y; Abcam, Cambridge, UK) raised against the residues near the N-terminus of human NKA; (3) Na+, K+, 2Cl–

cotransporter 1 (NKCC1): a mouse monoclonal antibody (T4; Developmental Studies Hybridoma Bank) raised against the car-boxy terminus of human colonic NKCC; (4) β-actin: a mouse mono-clonal antibody (ab8226; abcam, Cambridge, MA USA) raised against the amino acid residues 1–100 of human beta actin. The secondary antibody used for immunoblots was horseradish peroxi-dase (HRP)-conjugated anti-mouse IgG (Pierce, Rockford, IL, USA). The secondary antibodies used for double immunofluores-cence staining were Dylight-488-conjugated goat anti-Rabbit IgG and Dylight-549-conjugated goat anti mouse IgG (Jackson Immunoresearch, West Baltimore Pike, PA, USA).

Immunoblotting of NKA and NKCC1The protein concentrations of the supernatants were deter-

mined with a Pierce BCA protein assay (Thermo). The pre-stained protein molecular weight marker was purchased from Fermentas

(SM0671; Hanover, MD, USA). Aliquots containing 20 μg of protein from the gill homogenates were heated at 65°C for 25 min and frac-tionated by electrophoresis on SDS-containing 7.5% polyacrylamide gels. Separated proteins were transferred from unstained gels to PVDF (Millipore, Bedford, MA, USA) using a tank transfer system (Bio-Rad, Mini Protean 3). For minimizing non-specific binding, blots were pre-incubated in 5% (v/v) nonfat milk that diluted with Phosphate Buffered Saline Tween-20 (PBST; 137 mM NaCl, 3 mM KCl, 10 mM Na2HPO4, and 0.2% (v/v) Tween 20, pH 7.4) at room temperature for 2 hrs. The blots were then incubated at room tem-perature with the primary antibody α5 (NKA) diluted in PBST (1:4000) or T4 (NKCC1) diluted in PBST (1:500). The blots were washed with PBST, and subsequently HRP-conjugated secondary antibody (1:10,000 dilution) was added. After incubation, the blots were developed using a SuperSignal West Pico Detection Kit (#34082, Pierce) and observed with a Universal hood with a cooling-CCD (charge-coupled device) camera (ChemiDoc XRS+, Bio-Rad) and the associated software (Quantity One version 4.6.8, Bio-Rad).Immunoreactive bands were analyzed using Image Lab software version 3.0 (Bio-Rad). According to previous studies (Kang et al., 2008 and 2010), the target bands of NKA α-subunit and NKCC1 at 110 kDa and 130–170 kDa, respectively, were used for analyses. The bands were converted to numerical values to compare relative protein abundances of the immunoreactive bands.

NKA activityThe method to determine gill NKA activity was modified from

Kang et al. (2008). The assay solution (50 mM imidazole, 0.5 mM ATP, 2 mM phosphoenolpyruvate (PEP), 0.32 mM NADH, 3.3 U LDH mL–1, and 3.6 U PK mL–1, pH 7.5) was mixed with salt solution (189 mM NaCl, 10.5 mM MgCl2, 42 mM KCl, 50 mM imidazole, pH 7.5) in a 3:1 ratio. Before the assay, a standard curve was deter-mined from 0 to 30 nmol ADP per well at 340 nm at 28°C after add-ing 200 μl assay mixture for at least 5 min in a 96-well plate. The slope of the standard curve should be –0.012 to –0.015 absorbance units nmol ADP–1. A 10 μl sample from one fish was loaded in a well, and 200 μl assay mixture was added with or without 1 mM ouabain. Each sample was assayed in triplicate. The plate was read every 15 seconds for up to 10 min in a VERSAmax microplate reader (Molecular Devices) at 340 nm, 28°C. The linear rate from 2 to 10 min for each pair of triplicate wells was determined. Protein concentrations of the samples were determined by the Pierce BCA protein assay (Thermo, Rockford, IL, USA). The NKA activity expressed as μmol ADP per mg protein per hr was calculated as the difference in slope of ATP hydrolysis (NADH reduction) in the presence and absence of ouabain.

Total RNA extraction and reverse transcriptionEach total RNA sample from gills was extracted from four individ-

ual by using the TriPureTM Isolation Reagent (Roche Diagnostics, Mannheim, Germany) following the manufacturer’s instruction. The RNA pellet was dissolved in 50 μl Nuclease-free water (GE Healthcare,Little Chalfont, Buckinghamshire, UK) and treated with the RNA clean-up protocol from the RNAspin Mini RNA isolation kit (GE Healthcare) following the manufacturer’s instructions to eliminate genomic DNA contamination. RNA integrity was verified by 1% agarose gel electrophoresis. Extracted RNA samples were stored at –80°C after isolation.

Quantitative real-time PCR (qPCR)Gill nkcc1a mRNA was quantified with MiniOpticon real-time

PCR system (Bio-Rad Laboratories, Hercules, CA, USA). The nkcc1a primer sequences were as follows (5′ to 3′): forward—CTCTCCACTTCAGCCATCG and reverse—ACCACATACATG-GCAACAGC. The β-actin primer sequences were as follows (5′ to 3′): forward—TCGCTGACAGAATGCAGAAG and reverse—GCTG-GAAGGTGGACAGAGAG. PCR reactions contained 8 μl of cDNA

Hypo-osmoregulation of Daisy’s medaka 417

(200×), 2 μl of either 5 μM nkcc1a-QPCR primer mixture or 5 μM β-actin primer mixture, and 10 μl of 2× FastStart Universal SYBR Green Master (Roche Diagnostics, Mannheim, Germany). The nkcc1a mRNA values were normalized using the expression of the β-actin mRNA (KT031391) from the same DNA samples. The occurrence of secondary products and primer-dimers was inspected using melting curve analysis and electrophoresis to confirm that the amplification was specific. One identical cDNA sample from the 10‰-acclimated fish was used as the internal control among differ-ent groups. For each unknown sample, the comparative Ct method with the formula 2^[(Ctnkcc1a,n-Ctβ-actin,n)-(Ctnkcc1a,c-Ctβ-actin,c)] was used to obtain the corresponding nkcc1a and β-actin values, where Ct corresponded to the threshold cycle number.

Cryosectioning and double immunofluorescence stainingThe excised gills of Daisy’s medaka were fixed with 10% neutral

buffered formalin for 2 hrs. For cryosectioning, the gills were perme-ated with methanol for 30 min at –20°C after phosphate buffer saline (PBS). The samples were then stored in methanol at –20°C before performing the following experiments. The samples were washed with PBS and then infiltrated with O.C.T. (optimal cutting tempera-ture) compound (Sakura, Tissure-Tek, Torrance, CA, USA) over-night at 4°C. Subsequently, the samples were mounted in the O.C.T. compound. Gills were cut in cross-sections of 5 μm thick-ness using a Leica CM3050 S cryostat (Leica Microsystems, Wetzlar, Germany) at –20°C. The sections were placed on 0.01% poly-L-lysine (Sigma) coated slides and kept in slide boxes at –20°C before immunofluorescence staining.

Cryosections were rinsed with PBS, incubated in blocking buf-fer (1.25% BSA and 0.05% sodium azide in PBS) for 30 min, and then washed with PBS and incubated with the monoclonal antibody

T4 diluted in blocking buffer at room temperature for 2 hrs. After incubation, the cryosections were washed several times with PBS, exposed to the secondary antibody (Alexa-flour 488 goat anti-mouse antibody) at room temperature for 1 hr and then washed with PBS again. After the first staining, the cryosections were incubated with the monoclonal anti-NKA antibody (EP1845Y) diluted in block-ing buffer at room temperature for 2 hrs. The cryosections were washed with PBS several times, and then exposed to the secondary antibody (Dylight-549-conjugated goat anti-rabbit antibody) at room temperature for 1 hr, followed by several PBS washes. The sections were then covered by a coverslip with clearmountTM mounting solu-tion (Thermo Fisher Scientific, Carlsbad, CA, USA) and observed with a fluorescence microscope (BX50, Olympus, Tokyo, Japan) or a laser scanning confocal microscope (FV1000, Olympus). Micrographs were taken using the cooling-CCD camera (DP72, Olympus). Only those cross sections of filaments about 135 ± 5 μm in length were randomly selected to minimize the effects of cutting angles on the sections. Ten gill filaments in the field of the fluores-cent microscope were randomly chosen, and the area and counts of NKA-IR cells were averaged to represent the average size and number of ionocytes on a single gill filament of a fish.

Statistical analysisValues were compared with the Student's t test, and P < 0.05

was set as the significance level. Values were expressed as the mean ± S.E.M. (the standard error of the mean). The survival rate was analyzed by one-way analysis of variance followed by Dunnett’s test multiple comparison against a single control.

RESULTS

Phylogenetic treeThe 12S (KM582167) and 16S (KM582168) rRNA

genes were cloned from Daisy’s medaka using prim-ers designed according to Takehana et al. (2005). To clarify the relationship between Daisy’s medaka and the other medakas, a phylogenetic tree of medakas was constructed and then classified into three groups according to Takehana et al. (2005), including thelatipes species group, the celebensis species group, and the javanicus species group. Pair-wise sequence

Fig. 1. (A) Photographs show the phenotype of male (left) and female (right) Daisy’s medaka (Oryzias woworae). (B) Phylogenetic relationships of medaka fishes inferred from the datasets of mitochondrial 12S rRNA and 16S rRNA genes. Daisy’s medaka (shaded) genetically belongs to the celebensis species group. The phylogenetic relationships were analyzed by the maximum-likelihoodmethod. The numbers beside the branches indicate the bootstrap values. Inoue and Takei (2003) revealed that O. latipes, O. dancena, and O. javanicus exhib-ited euryhalinity (*), whereas O. marmoratus exhibited stenohalinity (†).

Fig. 2. Survival rate of Daisy’s medaka transferred directly from fresh water (FW) to FW or salt water (5‰, 10‰, 15‰, 20‰) for 7 days (n = 15 for all groups). “Exp. 10‰” indicates that the Daisy’s medaka were first transferred to 5‰ salt water (5‰) from FW for one week and then transferred to 10‰ salt water (10‰) for another week. The asterisks indi-cate significant difference (P < 0.05) using Dunnett’s test for comparison against a single control (FW) following one-way ANOVA. Values are means ± S.E.M. ND, not detected.

J.-J. Juo et al.418

comparisons of the concatenated 12S and 16S rRNA genes of species in the genus Oryzias indicated that the sequence isolated from O. woworae shared a 94–97% nucleotide sim-ilarity with species in celebensis species group, a 89–91% nucleotide similarity with species in latipes species group, and a 88–90% nucleotide similarity with species in javanicusspecies group. Therefore, Daisy’s medaka should belong to the celebensis species group (Fig. 1).

Salinity tolerance of Daisy’s medakaAfter direct transfer from fresh water (FW), no Daisy’s

medaka survived in 20‰ saltwater (SW) and only 53.3% of tested fish survived in 10‰ SW. The more the water salinity increased, the more the survival rate decreased. After pre-acclimation to 5‰ SW for one week, the survival rate of the medaka in 10‰ SW increased to 62.5% (Fig. 2). For the fol-lowing experiments, the medaka were pre-acclimated to 5‰ SW for one week and subsequently transferred to 10‰ SW before sampling (the “Experimental 10‰ group”).

Plasma analysisThe plasma osmolality of the 10‰ SW medaka was

17% higher than that of fish acclimated to FW (Fig. 3A). On the other hand, 44% higher plasma Na+ concentration was found in the 10‰ SW medaka compared to the FW group (Fig. 3B). The Cl– concentration of the 10‰ SW medaka

Fig. 3. Plasma osmolality, Na+ and Cl– concentrations of the Daisy’s medaka acclimated to fresh water (FW) and 10‰ salt water (10‰). (A) Plasma osmolality of the FW group was significantly higher than the 10‰ SW group (n = 4 for both groups). Concentra-tions of plasma sodium (B) and chloride (C) were also higher in the FW group than in the 10‰ SW group (n = 7 for both groups). The asterisk indicates a significant difference (P < 0.05) using Student’s t test. Values are means ± S.E.M..

Fig. 4. Expression of NKA α-subunit protein and NKA activity in gills of the Daisy’s medaka acclimated to fresh water (FW) and 10‰ salt water (10‰). (A) The representative immunoblot of NKA α-subunit. (B) Relative intensities of the immunoreactive bands of NKA α-subunit between FW and 10‰ SW group (n = 25 for both groups). (C) The NKA activity in FW and 10‰ SW group (n = 10 for both groups). β-actin was used as the loading control. The asterisk indicates a significant difference (P < 0.05) using Student’s t test. Values are means ± S.E.M..

Hypo-osmoregulation of Daisy’s medaka 419

was 43% higher than that of the FW individuals (Fig. 3C).

Salinity effects on gill Na+, K+ -ATPase (NKA)Immunoblots of gill NKA in Daisy’s medaka probed with

the monoclonal antibody (α5) indicated that the immunore-active bands were at 110 kDa (Fig. 4A). Quantification of the immunoreactive bands of different groups revealed that the protein abundance of NKA was significantly increased (approximately 4-fold) in the 10‰ SW group compared with in the FW group (Fig. 4B). The gill NKA activity of fish sig-nificantly increased (approximately 2-fold) after exposure to 10‰ SW when compared with the FW group (Fig. 4C). The micrographs of the gill cross-sections showed that the NKA immunoreactive (NKA-IR) cells were mainly distributed in

the afferent epithelium of the filaments (Fig. 5A and 5B). The average sizes of NKA-IR cells were significantly larger in the 10‰ SW group (61.4 ± 17.6 μm2) than those in the FW group (37.2 ± 12.0 μm2) (Fig. 5C). In addition, the average numbers of NKA-IR cells significantly increased in 10‰ SW group (approximately 1.5-fold) compared to the FW group (Fig. 5D).

Salinity effects on gill Na+, K+, 2Cl– cotransporter 1 (NKCC1)

Quantification of nkcc1a gene in gills of Daisy’s medaka revealed that the mRNA level in the 10‰ SW group was higher (approximately 1.5-fold) than that in the FW group (Fig. 6A). Immunoblots of gill NKCC1 in Daisy’s medaka probed with the monoclonal antibody (T4) revealed the

Fig. 5. Immunofluorescence staining and average size and number of NKA-immunoreactive (IR) cells in the gills of Daisy’s medaka acclimated to fresh water (FW) and 10‰ salt water (10‰) (n = 5 for both groups). Repre-sentative immunofluorescence staining of NKA in the gill filaments in (A) FW and (B) 10‰ SW groups. (C) The average size of NKA-IR cells in the FW and 10‰ SW group. (D) The average number of NKA-IR cells in the FW and 10‰ SW groups. The asterisk indicates a significant difference (P < 0.05) using Student’s t test. C, cartilage; EF, efferent region of the gill filaments. Scale bar, 50 μm.

Fig. 6. Expression of Na+, K+, 2Cl– cotransporter1 (NKCC1) in gills of the Daisy’s medaka acclimated to fresh water (FW) and 10‰ salt water (10‰). (A) The mRNA levels of nkcc1a in the gills of the FW and 10‰ SW Daisy’s medaka (n = 6 for both groups). (B) The representative immunoblot probed with a monoclonal antibody (T4). (C) Relative intensities of immu-noreactive bands of NKCC1 in the FW and 10‰ SW group (n = 12 for both groups). β-actin was used as the loading control. The asterisk indicates a significant difference (P < 0.05) using Student's t test. Values are means ± S.E.M..

J.-J. Juo et al.420

immunoreactive bands ranged from 95 to 170 kDa (Fig. 6B). There were three bands at 95, 110, and 120 kDa, and a smear band at 130–170 kDa in the Fig. 6A. Quantification of the immunoreactive bands (from 130 to 170 kDa) of different groups showed that the protein abundance of NKCC1 was significantly higher in the 10‰ SW group than in the FW group (Fig. 6C). No significant differences were found at that band at 95 kDa between FW and 10‰ SW group. At least 10 gill slides in both experimental conditions were applied to make sure that all the expression patterns were constant. The confocal micro-graphs were taken from the best immuno-fluorescence stained slide. Immunostainingof the gill filaments with the antibody T4 revealed basolateral signals in NKA-IR cells in the 10‰ SW group, while the FW group showed apical signals in NKA-IR cells (Fig. 7).

Comparisons of gill NKCC1 expression between O. dancena and O. woworae

Between the same quantity of total lysates in the gills of O. dancena and O. woworae exposed to 10‰ SW, different abundances of gill NKCC1 protein were

detected and compared. Immunoblots of gill NKCC1 in both O. dancena and O. woworae probed with the antibody T4 indicated that the immunoreactive bands ranged from 95 to 170 kDa (Fig. 8A). Quantification of the immunoreactive bands showed that the basic level of NKCC1 protein of 10‰ SW-acclimated O. dancena was significantly higher than that of 10‰ SW-acclimated O. woworae (approximately 3-fold) (Fig. 8B). In addition, the ratios of gill NKCC1 protein between FW and 10‰ SW in both O. dancena and O. woworae were increased by approximately 2-fold (Fig. 6C, Supplementary Figure S1 online).

DISCUSSION

The phylogenetic tree based on mitochondrial ribosomal RNA (rRNA) is a valid representation of organismal geneal-ogy (Woese, 2000). Phylogenetic trees based on 12S and 16S rRNA genes have been constructed for many teleosts, e.g., Leuciscinae fishes (Bufalino and Mayden, 2010);Loricariinae catfish (Rodriguez et al., 2011); holocephalan fishes (Licht et al., 2012). Takehana (2005) reported that the phylogenetic tree of Oryzias species was separated into three monophylogenetic groups, the O. latipes species

Fig. 7. Confocal micrographs of double immunofluorescence staining with the anti-NCC/NKCC1 (red) (A, D) and anti-NKA α-subunit antibody (green) (B, E) on the afferent regions of the gill filaments in the Daisy’s medaka acclimated to fresh water (FW) and 10‰ salt water (10‰ SW). The merged images revealed that NKCC1 was localized in the basolateral membrane of NKA immunoreactive (NKA-IR) cells in the 10‰ SW group (arrows) (F). However, the antibody T4 detected the apical signal on NKA-IR cells in the FW group (arrow heads) (C). C, cartilage; EF, efferent region of the gill filaments. Scale bar, 20 μm.

Fig. 8. Expression of NKCC1 protein in the gills of O. woworae (OW) and O. dancena (OD) acclimated to 10‰ salt water (10‰ SW). (A) Immunoblots of O. woworae and O. dancena probed with the monoclonal antibody T4. (B) The basic level of NKCC1 protein in 10‰ SW-acclimated O. dancena and O. woworae (n = 6 for each group). β-actin was used as the loading control. The asterisk indi-cates a significant difference (P < 0.05) using Student’s t test. Val-ues are means ± S.E.M..

Hypo-osmoregulation of Daisy’s medaka 421

group, the O. javanicus species group, and the O. celebensisspecies group. Our phylogenetic tree also separated meda-kas into three phylogenetic groups and further confirmed that O. woworae belongs to the O. celebensis species group, which conformed to the phylogenetic tree construc-tion using nucleotide sequence of tDNA-Val, 12S and 16S rDNA (Ngamniyom and Phowan, 2014). O. latipes and O. dancena were separated into different phylogenetic groups, and they both exhibited euryhalinity. O. woworae exhibiting stenohalinity, however, coincidently fell into the third phylo-genetic group, the O. celebensis species group. Accord-ingly, the osmoregulatory mechanism of O. woworae should be different from the two other euryhaline medaka, the Japanese medaka (O. latipes) and the brackish medaka (O. dancena).

Stenohaline freshwater (FW) teleosts typically can survive in distill FW, hard FW, and salt water (SW) with salinities up to approximately 10‰ (Evans and Claiborne, 2006). The survival rates of teleosts following direct or grad-ual transfer between environments with different salinities are generally observed to determine their salinity tolerance (Hiroi and McCormick, 2007; Kang et al., 2010, 2012). Hence, the survival rates of adult Daisy’s medaka (Oryzias woworae) were explored in this study to evaluate the salinity tolerance of this Oryzias species. Pre-acclimation to lower environmental salinity is a helpful method for some teleosts to increase salinity tolerance, including tilapia (Oreochromis mossambicus; Hwang et al., 1989), silver perch (Bidyanusbidyanus; Guo et al., 1995), and O. latipes (Inoue and Takei, 2003). The present study indicates that although Daisy’s medaka is a stenohaline teleost, pre-acclimation to lower salinity also increases its survival rate to environments with higher salinities. Our findings suggest that Oryzias spe-cies exhibit varying salinity tolerance.

The plasma osmolality of O. latipes was constant when transferred from FW to brackish water (BW; 15‰), while it was significantly increased after direct transfer to seawater (35‰). The plasma osmolality of O. dancena in contrast sig-nificantly increased when transferred from FW to BW, but no further increase occurred when the fish was transferred to a higher salinity environment (Kang et al., 2008). In this study, the plasma osmolality and Na+ and Cl– concentrations of Daisy’s medaka significantly increased upon salinity chal-lenge. Similar patterns for these parameters have been found in other stenohaline species, including grass carp (Ctenopharyngodon idella; Maceina et al., 1980), catfish (Heteropneustes fossilis; Goswami et al., 1983), channel catfish (Ictalurus punctatus; Eckert et al., 2001), and Caspian roach (Rutilus caspicus; Kolbadinezhad et al., 2012). Our findings suggest that stenohaline species typi-cally lose control of plasma electrolyte concentrations even in 10‰ SW. The results of survival rate indicate that the 10‰ SW was the survival limitation of the Daisy’s medaka. The higher osmolality (350–360 mOsm/kg) of the 10‰ SW group thus indicated the allostatic state of Daisy’s medaka. In order to keep the homeostasis under osmotic stress, the allostasis comprised changes of the mechanisms from hyperosmoregulation to hypo-osmoregulation.

The gill is a target organ in research of fish osmo- and ionoregulation (Hwang and Lee, 2007; Takei et al., 2014). Several studies have described the ion transporter systems

of ionocytes in gills (Marshall, 2002; Hirose et al., 2003; Evans et al., 2005; Hwang and Lee, 2007). In branchial ion-ocytes, the activity of NKA exchanges 2K+ in and 3Na+ out of the cell with one cost of ATP and sustain a substantial cytosol-negative membrane potential and a chemical gradi-ent across cell membrane, thus provides a driving force for secondary ion-transporting systems (Marshall and Bryson, 1998; Hirose et al., 2003; Hwang and Lee, 2007; Hwang et al., 2011). Upon salinity challenge, Daisy’s medaka increased gill NKA activity when encountered increasing influx of Na+, similar to that of Trichogaster microlepis(Huang et al., 2010). Meanwhile, the gill NKA activity was also found to increase significantly, parallel to the NKA abundance in gills. In addition, Marshall (2002) stated that most euryhaline teleosts exhibit adaptive changes in gill NKA activity following salinity changes. Accumulated evidences had supported this statement, including salmon (Tipsmark et al., 2002), tilapia (Lee et al., 2003), pufferfish (Lin et al., 2004b), sea bream (Sparus aurata L.; Laiz-Carrión et al., 2005) and pearl spot (Chandrasekar et al., 2014). O. latipes and O. dancena were also reported to exhibit adaptive changes in NKA activity upon salinity chal-lenge (Kang et al., 2008). O. latipes, most inhabit in FW, increased gill NKA activity along with increasing environ-mental salinity, whereas O. dancena, most inhabit in BW, revealed the lowest gill NKA activity in the BW group com-pared to the FW and seawater groups. Although 10‰ SW was generally considered isotonic to the teleosts, pointing to a lower need to allocate energy to osmoregulation, the pres-ent study revealed that NKA expression and NKA activity elevated in gills of the Daisy’s medaka in response to 10‰ SW. The increased NKA activity indicated more energy allo-cated to osmoregulation in gills of the Daisy’s medaka to supply more driving force for secondary ion-transporting system. On the other hand, a positive correlation between stress responses and NKA expression has been found in several other teleostean species (Yang et al., 2009; Tine et al., 2010; Tang and Lee, 2013). The present study sug-gested 10‰ SW was stressful to Daisy’s medaka that induced elevation of gill NKA expression. Because NKA is abundant in the ionocytes of teleostean gills (Karnaky et al., 1976; Hirose et al., 2003; Evans et al., 2005; Hwang and Lee, 2007; Tang and Lee, 2013; Chandrasekar et al., 2014), the NKA immunoreactive (NKA-IR) cells in this study repre-sented the ionocytes detected by the same antibody in the immunoblots. The cross-sections of the gill filaments showed that the NKA-IR cells of O. woworae that acclimated to FW and 10‰ SW were distributed mainly in the afferent epithelium and scarcely observed on the lamellar epithelium,similar to the distribution of ionocytes in gills of O. latipesand O. dancena (Kang et al., 2008). Previous studies reported that the size of the NKA-IR cells (ionocytes) increased in seawater-acclimated chum salmon (Onco-rhynchus keta; Uchida et al., 1996), guppy (Poecilia reticulata;Shikano and Fujio, 1998), eel (Anguila japonica; Wong and Chan, 1999), Japanese medaka (O. latipes; Sakamoto et al., 2001), and tilapia (Oreochromis mossanbicus; Shiraishi et al., 1997; Lee et al., 2003). Our results revealed that the size of the NKA-IR cells in the 10‰ SW-exposed O. woworaewas larger than that in the FW group, and the number of NKA-IR cells was also increased in 10‰ SW group. Upon

J.-J. Juo et al.422

salinity challenge, the number of NKA-IR cells was also found to be significantly increased in the gills of the sailfin molly (Poecilia latipinna; Yang et al., 2009), Trichogaster microlepis (Huang et al., 2010), sea bass (Dicentrarchus labrax; Varsamos et al., 2002) and pufferfish (Tetraodon nigroviridis; Tang et al., 2011). In the gills of O. woworae, increased number and size of NKA-IR cells accompanied the higher expression of NKA activity and NKA protein abundance. The expansion of the tubular reticulum and increased cell number could provide more NKA for cellular functions (Hirose et al., 2003). Therefore, in this study, the increased number and size of the NKA-IR cells was found to parallel the protein abundance and enzyme activities of the stenohaline species O. woworae in response to a non-lethal salinity stress from environments with a salinity differ-ent from that in its natural habitat.

The Na+, K+, 2Cl– cotransporter 1 (NKCC1), which is in the epithelial cells located on the basolateral membrane, plays the role of simultaneously transporting Na+, K+, and Cl– into cells and has been considered to be the secretory isoform (Lytle et al., ‘95; Starremans et al., 2003). According to previous review articles, NKCC1 and the cystic fibrosis transmembrane conductance regulator (CFTR) participated in the mechanism underlying Cl– excretion and represented marker transporters in branchial ionocytes of seawater teleosts (Marshall, 2002; Hirose et al., 2003; Hwang and Lee, 2007; Evans, 2008; Seo et al., 2013; Chandrasekar et al., 2014). Our previous study indicated that the trend of nkcc1a gene expression in gill ionocytes of the brackish medaka was salinity-dependent (Kang et al., 2010). In this study, the primers were designed for detecting the con-served region of medaka nkcc1a. In Daisy’s medaka, mRNA levels of branchial nkcc1a also increased with environmentalsalinity. Furthermore, our unpublished data revealed that the lower abundance of Na+, Cl– cotansporter (ncc) mRNA was found in the 10‰ Daisy’s medaka compared to the FW fish. These results indicated that the protein levels of NKCC1 would be hyper-salinity dependent rather than NCC in the gills of the stenohaline medaka. On the other hand, the pro-tein expression of branchial NKCC1 was detected using a monoclonal anti-human NKCC1 antibody (T4) in teleosts (Wu et al., 2003; Hiroi and McCormick, 2007; Tang and Lee, 2007; Katoh et al., 2008; Kang et al., 2010, 2012). In this study, the molecular weights of the immunoreactive bands detected from gill lysates of O. woworae were from 95–170 kDa, was similar to those reported in killifish (Fundulus heteroclitus; Marshall et al., 2002), salmon (Salmo salar; Pelis et al., 2001; Hiroi and McCormick, 2007), pufferfish (Tetraodon nigroviridis; Tang and Lee, 2007), tilapia (Oreochromis mossambicus; Hiroi et al., 2008), brackish medaka (O. dancena; Kang et al., 2010) and sailfin molly (Poecilia latipinna; Yang et al., 2011). The NKCC1 and NCC would be detected by the immunofluorescence staining by the T4 antibody (Wu et al., 2003; Hwang and Lee, 2007; Hiroi et al., 2008; Hsu et al., 2014). However, no study has identified all immunoreactive bands of T4 antibody in the gill lysates. Based on the deduced protein sequence of NKCC1a from the brackish medaka (Kang et al., 2010), its molecular weight was predicted to be 125 kDa. In contrast, the predicted molecular weight of NCC from the Japanese medaka (Oryzias latipes) was 113 kDa and the single immu-

noreactive band was found at 110 kDa by the polyclonal NCC antibody (Hsu et al., 2014). Two potential N-linked gly-cosylation sites were predicted using the peptide sequence of NKCC1 in the other fish. Different degrees of glycosyla-tion might lead to variable molecular weights of NKCC1 in the immunoblots (Tipsmark et al., 2002; Wu et al., 2003; Kang et al., 2010). Furthermore, the 130–170 kDa immuno-reactive band only appeared in 10‰ SW group, but not in the FW group. Therefore, the present study quantified the target bands (130–170 kDa) for indicating that Daisy’s medaka increased gill NKCC1 abundance under osmotic stress. The abundance of branchial NKCC1 protein was also found to increase in parallel to environmental salinity changes in euryhaline teleosts, including killifish (Fundulus heteroclitus; Scott et al., 2004), striped bass (Morone saxatilis;Tipsmark et al., 2004), sea bass (Dicentrarchus labrax; Lorin-Nebel et al., 2006), salmon (Salmon salar; Pelis et al., 2001; Tipsmark et al., 2002; Hiroi and McCormick, 2007; Nilsen et al., 2007), pufferfish (Tetraodon nigroviridis; Tang and Lee, 2007), tilapia (Oreochromis mossambicus; Wu et al., 2003; Tipsmark et al., 2008), goby (Oxyeleotris mamorata;Chew et al., 2009), sturgeon (Acipenser medirostris; Sardella and Kültz, 2009), and brackish medaka (O. dancena; Kang et al., 2010). Kang et al. (2010) reported that the nkcc1a was prominently expressed in the gill iono-cytes of the brackish medaka. The colocalization of T4 sig-nal and NKA in the gills of the 10‰ SW-acclimated O. woworae revealed that NKCC1 was located in the basolat-eral membrane of ionocytes. The distribution of NKCC1 con-formed to the currently accepted model of Cl– secretion via branchial ionocytes in seawater fish (Pelis et al., 2001; Wu et al., 2003; Evans et al., 2005; Hiroi and McCormick, 2007; Katoh et al., 2008; Choi et al., 2011). By immunofluores-cence staining, NKCC1 protein was found to be distributed in the basolateral membrane of ionocytes (Marshall et al., 2002; Marshall et al., 2005). On the other hand, the apical NCC protein was detected by the same antibody (T4) on the NKA-IR cells in gills of FW-acclimated O. woworae, similar to that in gills of O. dancena (Kang et al., 2010), as well as the embryonic skin and gills of tilapia (Wu et al., 2003; Hwang and Lee, 2007; Hiroi et al., 2008). Hiroi et al. (2008) identified that NCC was localized in the apical membrane and NKCC1 was localized in the basolateral membrane of ionocytes on yolk sac membranes of the euryhaline tilapia. Hsu et al. (2014) further confirmed that NCC was on the api-cal membrane of NKA-IR cells of the Japanese medaka as detected by both the antibody T4 and the anti-medaka NCC antibody. Hence, the NCC protein that appeared on the api-cal membrane of ionocytes was suggested to be involved in Cl– uptake. The present study revealed that Daisy’s medaka has mechanisms for both Cl– uptake and excretion, through shifting expression between NCC and NKCC1 protein. When the Daisy’s medaka exposed to the osmotic stress of 10‰ SW, the increased NKA activities could provide more driving force for basolateral NKCC1 to transport Cl– into the gill ionocytes. Contrary to our primary expectation, even though Daisy’s medaka is a stenohaline species, they still conserved the hypo-osmoregulatory capability upon salinity challenge. In addition, the phylogenetic tree of medaka implies that medakas share the same ancestor using NKCC1 protein to conduct osmoregulation in environments

Hypo-osmoregulation of Daisy’s medaka 423

with increasing environmental salinities.The increasing protein levels of gill NKCC1 by quantifi-

cation of immunoreactive bands of the T4 antibody would be an indicator of seawater acclimation. Previous studies reported that gill NKCC1 was upregulated after seawater transfer from FW (Scott et al., 2004; Hiroi and McCormick, 2007; Kang et al., 2010). Hiroi and McCormick (2007) reported that three salmonids—lake trout, brook trout, and Atlantic salmon—living in habitats with different salinity exhibited a salinity tolerance distinct from each other. The survival rates of lake trout, brook trout and Atlantic salmon were 80%, 50% and 100%, respectively, following direct transfer from FW to 30‰ seawater. The basic level of gill NKCC1 protein abundance in the Atlantic salmon was higher than in the other two species and that in the lake trout was the lowest. In addition, our finding showed that O. woworae was categorized to the celebensis species group. Inoue and Takei (2003) evaluated that O. mormoratus, which was also categorized to the celebensis species group (Takehana et al., 2005), cannot survive in either seawater or BW, whereas O. latipes and O. dancena exhibited euryha-linity. In this study, gill NKCC1 abundance was found signif-icantly lower in O. woworae than that in O. dancena at identical gill lysate concentration under 10‰ SW exposure. These results suggested that the euryhaline medaka greatly increases gill NKCC1 in preparing for increased environ-mental salinity, whereas the stenohaline medaka loses much, but not all, of this response on salinity challenge. Hence, different levels of gill NKCC1 expression found in this study were thought to be involved in various salinity tol-erance of medaka species. To sum up, the present study found that the salinity tolerance of medakas were originally habitat-dependent, and the expression level of branchial NKCC1 protein could be an indicator to determine salinity tolerance between medaka species, at least between Daisy’s medaka and the brackish medaka.

This is the first study to evaluate ionoregulatory mecha-nisms in the gills of Daisy’s medaka, and it clearly revealed that Daisy’s medaka is a stenohaline species that shared sodium/chloride excretion mechanism with its congener. Differential expression of branchial NKCC1 abundance under osmotic stress between Daisy’s medaka and the brackish medaka explained the mechanisms underlying lim-ited responses of Daisy’s medaka upon salinity challenge. The present study indicate that Daisy’s medaka is a good stenohaline model for comparison with euryhaline species to investigate the key factor involved in euryhaline capacity of teleosts. Our future work will focus on analyzing the Cl–

excretion efficiency and cell volume manipulation of iono-cytes between Daisy’s and brackish medaka.

ACKNOWLEDGMENTS

The monoclonal antibodies, T4 and α5, were purchased from the Developmental Studies Hybridoma Bank (DSHB) maintained by the Department of Pharmacology and Molecular Sciences, John Hopkins University School of Medicine, Baltimore, MD 2120521205, and the Department of Biological Sciences, University of Iowa, Iowa City, IA 52242, under Contract N01-HD-6-2915, NICHD, USA. This study was supported by a grant from the Ministry of Science and Technology (MOST), Taiwan, to T.H.L. (MOST 103-2311-B-005-004-MY3). JJJ, KCK, WKY, YSY and THL declare that they have no conflict of interest.

REFERENCES

Bufalino AP, Mayden RL (2010) Phylogenetic evaluation of North American Leuciscidae (Actinopterygii: Cypriniformes: Cypri-noidea) as inferred from analyses of mitochondrial and nuclear DNA sequences. Syst Biodivers 8: 493–505

Chandrasekar S, Nich T, Tripathi G, Sahu NP, Pal AK, Dasgupta S (2014) Acclimation of brackish water pearl spot (Etroplus surat-ensis) to various salinities: relative changes in abundance of branchial Na+/K+-ATPase and Na+/ K+/ 2Cl– co-transporter in relation osmoregulatory parameters. Fish Physiol Biochem 40: 983–996

Chew SF, Tng YYM, Wee NLJ, Wilson JM, Ip YK (2009) Nitrogen metabolism and branchial osmoregulatory acclimation in the juvenile marble goby, Oxyeleotris marmorata, exposed to sea-water. Comp Biochem Physiol A 154: 360–369

Dang Z, Balm PH, Flik G, Wendelaar Bonga SE, Lock RA (2000) Cortisol increases Na (+)/K(+)-ATPase density in plasma membranes of gill chloride cells in the freshwater tilapia Oreochromis mossambicus. J Exp Biol 203: 2349–2355

Degnan KJ, Karnaky KJ, Zadunaisky JA (1977) Active chloride transport in the in vitro opercular skin of a teleost (Fundulus heteroclitus), a gill-like epithelium rich in chloride cells. J Physiol 271: 155–191

Eckert SM, Yada T, Shepherd BS, Stetson MH, Hirano T, Grau EG (2001) Hormonal control of osmoregulation in the channel cat-fish Ictalurus punctatus. Gen Comp Endocrinol 122: 270–286

Evans DH (2008) Teleost fish osmoregulation: what have we learned since August Krogh, Homer Smith, and Ancel Keys. Am J Physiol Regul Integr Comp Physiol 295: R704–R713

Evans DH, Claiborne JB (2006) The Physiology of Fishes. 3rd ed. CRC press, Boca Raton, FL, pp 179–180

Evans DH, Piermarini PM, Choe KP (2005) The multifunctional fish gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol Rev 85: 97–177

Franson MAH (1985) Standard Methods for the Examination of Water and Waste Water. 16th ed. American Public Health Association, Washington, DC

Goswami SV, Parwez I, Sundararaj BI (1983) Some aspects of osmoregulation in a stenohaline freshwater catfish, Hetero-pneustes fossilis (Bloch), in different salinities. J Fish Biol 23: 475–487

Guo R, Mather P, Capra M (1995) Salinity tolerance and osmoregu-lation in the silver perch, Bidyanus bidyanus, Mitchell (Teraponidae), an endemic Australian freshwater teleost. Mar Freshwater Res 46: 947–952

Hiroi J, McCormick SD (2007) Variation in salinity tolerance, gill Na+/K+-ATPase, Na+/K+/2Cl– cotransporter and mitochondria-rich cell distribution in three salmonids Salvelinus namaycush, Salvelinus fontinalis and Salmo salar. J Exp Biol 210: 1015–1024

Hiroi J, Yasumasu S, McCormick SD, Hwang PP, Kaneko T (2008) Evidence for an apical Na–Cl cotransporter involved in ion uptake in a teleost fish. J Exp Biol 211: 2584–2599

Hirose S, Kaneko T, Naito N, Takei Y (2003) Molecular biology of major components of chloride cells. Comp Biochem Physiol B 136: 593–620

Hootman SR, Philpott CW (1979) Ultracytochemical localization of Na+, K+-activated ATPase in chloride cells from the gills of a euryhaline teleost. Anat Rec 193: 99–129

Hsu HH, Lin LY, Tseng YC, Horng JL, Hwang PP (2014) A new model for fish ion regulation: identification of ionocytes in fresh-water- and seawater-acclimated medaka (Oryzias latipes). Cell Tissue Res 357: 225–243

Huang CY, Chao PL, Lin HC (2010) Na+/K+-ATPase and vacuolar-type H+-ATPase in the gills of the aquatic air-breathing fish

J.-J. Juo et al.424

Trichogaster microlepis in response to salinity variation. Comp Biochem Physiol A 155: 309–318

Hwang PP, Lee TH (2007) New insights into fish ion regulation and mitochondrion-rich cells. Comp Biochem Physiol A 148: 479–497

Hwang PP, Lee TH, Lin LY (2011) Ion regulation in fish gills: recent progress in the cellular and molecular mechanisms. Am J Phys-iol Regul Integr Comp Physiol 301: R28–R47

Hwang PP, Sun CM, Wu SM (1989) Changes of plasma osmolality, chloride concentration and gill Na−K-ATPase activity in tilapia Oreochromis mossambicus during seawater acclimation. Mar Biol 100: 295–299

Inoue K, Takei Y (2002) Diverse adaptability in Oryzias species to high environmental salinity. Zool Sci 19: 727–734

Inoue K, Takei Y (2003) Asian medaka fishes offer new models for studying mechanisms of seawater adaptation. Comp Biochem Physiol B 136: 635–645

Kang CK, Tsai SC, Lee TH, Hwang PP (2008) Differential expres-sion of branchial Na+/K+-ATPase of two medaka species, Oryzias latipes and Oryzias dancena, with different salinity toler-ances acclimated to fresh water, brackish water and seawater. Comp Biochem Physiol A 151: 566–575

Kang CK, Tsai HJ, Liu CC, Lee TH, Hwang PP (2010) Salinity-dependent expression of a Na+, K+, 2Cl− cotransporter in gills of the brackish medaka Oryzias dancena: A molecular correlate for hyposmoregulatory endurance. Comp Biochem Physiol A 157: 7–18

Kang CK, Liu FC, Chang WB, Lee TH (2012) Effects of low environ-mental salinity on the cellular profiles and expression of Na+, K+-ATPase and Na+, K+, 2Cl− cotransporter 1 of branchial mito-chondrion-rich cells in the juvenile marine fish Monodactylus argenteus. Fish Physiol Biochem 38: 665–678

Kang CK, Yang SY, Lin ST, Lee TH (2015) The inner opercular membrane of the euryhaline teleost: a useful surrogate model for comparisons of different characteristics of ionocytes between seawater-and freshwater-acclimated medaka. Histochem Cell Biol 143: 69–81

Karnaky KJ, Kinter LB, Kinter WB, Stirling CE (1976) Teleost chlo-ride cell. II. Autoradiographic localization of gill Na,K-ATPase in killifish Fundulus heteroclitus adapted to low and high salinity environments. J Cell Biol 70: 157–177

Karnky KJ, Degnan KJ, Zadunaisky JA (1977) Chloride transport across isolated opercular epithelium of killifish: a membrane rich in chloride cells. Science 195: 203–205

Katoh F, Cozzi RF, Marshall W, Goss G (2008) Distinct Na+/K+/2Cl– cotransporter localization in kidneys and gills of two euryhaline species, rainbow trout and killifish. Cell Tissue Res 334: 265–281

Kolbadinezhad SM, Hajimoradloo A, Ghorbani R, Joshaghani H, Wilson JM (2012) Effects of gradual salinity increase on osmo-regulation in Caspian roach Rutilus caspicus. J Fish Biol 81: 125–134

Laiz-Carrión R, Sangiao-Alvarellos S, Guzmán JM, Martín del Río MP, Soengas JL, Mancera JM (2005) Growth performance of gilthead sea bream Sparus aurata in different osmotic condi-tions: Implications for osmoregulation and energy metabolism. Aquaculture 50: 849–861

Lee TH, Feng SH, Lin CH, Hwang YH, Huang CL, Hwang PP (2003) Ambient salinity modulates the expression of sodium pumps in branchial mitochondria-rich cells of Mozambique tilapia, Oreochromis mossambicus. Zool Sci 20: 29–36

Licht M, Schmuecker K, Huelsken T, Hanel R, Bartsch P, Paeckert M (2012) Contribution to the molecular phylogenetic analysis of extant holocephalan fishes (Holocephali, Chimaeriformes). Org Divers Evol 12: 421–432

Lin YM, Chen CN, Lee TH (2003) The expression of gill Na, K-ATPase in milkfish, Chanos chanos, acclimated to seawater,

brackish water and fresh water. Comp Biochem Physiol A 135: 489–497

Lin CH, Huang CL, Yang CH, Lee TH, Hwang PP (2004a) Time-course changes in the expression of Na, K-ATPase and the morphometry of mitochondrion-rich cells in gills of euryhaline tilapia (Oreochromis mossambicus) during freshwater acclima-tion. J Exp Zool A Comp Exp Biol 301: 85–96

Lin CH, Tsai RS, Lee TH (2004b) Expression and distribution of Na, K-ATPase in gill and kidney of the spotted green pufferfish, Tetraodon nigroviridis, in response to salinity challenge. Comp Biochem Physiol A 138: 287–295

Lorin-Nebel C, Boulo V, Bodinier C, Charmantier G (2006) The Na+/K+/2Cl– cotransporter in the sea bass Dicentrarchus labraxduring ontogeny: involvement in osmoregulation. J Exp Biol 209: 4908–4922

Lytle C, Xu JC, Biemesderfer D, Forbush B (1995) Distribution and diversity of Na-K-Cl cotransport proteins: a study with monoclo-nal antibodies. Am J Physiol 269: C1496–C1505

Maceina MJ, Nordlie FG, Shireman JV (1980) The influence of salin-ity on oxygen consumption and plasma electrolytes in grass carp, Ctenopharyngodon idella Val. J Fish Biol 16: 613–619

Marshall WS (2002) Na+, Cl−, Ca2+ and Zn2+ transport by fish gills: retrospective review and prospective synthesis. J Exp Zool 293: 264–283

Marshall WS, Bryson SE (1998) Transport mechanisms of seawater teleost chloride cells: An inclusive model of a multifunctional cell. Comp Biochem Physiol A 119: 97–106

Marshall WS, Bryson SE, Luby T (2000) Control of epithelial Cl(–) secretion by basolateral osmolality in the euryhaline teleost Fundulus heteroclitus. J Exp Biol 203: 1897–1905

Marshall WS, Lynch EA, Cozzi RRF (2002) Redistribution of immun-ofluorescence of CFTR anion channel and NKCC cotransporter in chloride cells during adaptation of the killifish Fundulus heteroclitus to sea water. J Exp Biol 205: 1265–1273

Marshall WS, Ossum CG, Hffmann EK (2005) Hypotonic shock mediation by p38 MAPK, JNK, PKC, FAK, OSR1 and SPAK in osmosensing chloride secreting cells of killifish opercular epi-thelium. J Exp Biol 208: 1063–1077

Martos-Sitcha JA, MartínezRodríguez G, Mancera JM, Fuertes J (2015) AVT and IT regulate ion transport across the opercular epithelium of killifish (Fundulus heteroclitus) and gilthead sea bream (Sparus aurata). Comp Biochem Physiol A Mol Integr Physiol 182: 93–101

Ngamniyom A, Phowan N (2014) Specific primers of Oryzias javanicus, O. dancena, O. minutillus and O. woworae and molecular phylogent using partial mitochondrial DNA sequences. J Fish Aq Sci 9: 33–39

Nilsen TO, Ebbesson LOE, Madsen SS, McCormick SD, Andersson E, Björnsson BT, et al. (2007) Differential expression of gill Na+,K+-ATPaseα - and β-subunits, Na+,K+,2Cl– cotransporter and CFTR anion channel in juvenile anadromous and land-locked Atlantic salmon Salmo salar. J Exp Biol 210: 2885–2896

Parenti LR, Hadiaty RK (2010) A new, remarkably colorful, small ricefish of the genus Oryzias (Beloniformes, Adrianichthyidae) from Sulawesi, Indonesia. Copeia 2010: 268–273

Pelis RM, Zydlewski J, McCormick SD (2001) Gill Na+-K+-2Cl−

cotransporter abundance and location in Atlantic salmon: effects of seawater and smolting. Am J Physiol Regul Integr Comp Physiol 280: R1844–R1852

Rodriguez MS, Ortega H, Covain R (2011) Intergeneric phylogenetic relationships in catfishes of the Loricariinae (Siluriformes: Loricariidae), with the description of Fonchiiloricaria nanodon: a new genus and species from Peru. J. Fish Biol 79: 875–895

Sakamoto T, Uchida K, Yokota S (2001) Regulation of the ion-trans-porting mitochondrion-rich cell during adaptation of teleost fishes to different salinities. Zool Sci 18: 1163–1174

Sardella B, Kültz D (2009) Osmo- and ionoregulatory responses of

Hypo-osmoregulation of Daisy’s medaka 425

green sturgeon (Acipenser medirostris) to salinity acclimation. J Comp Physiol B 179: 383–390

Scott GR, Richards JG, Forbush B, Isenring P, Schulte PM (2004) Changes in gene expression in gills of the euryhaline killifish Fundulus heteroclitus after abrupt salinity transfer. Am J Physiol287: C300–C309

Seo MY, Mekuchi M, Teranishi K, Kaneko T (2013) Expression of ion transporters in gill motochandrion-rich cells in Japanese eel acclimated to a wide range of environmental salinity. Comp Biochem Physiol A 166: 323–332

Shikano T, Fujio Y (1998) Immunolocalization of Na+, K+-ATPase and morphological changes in two types of chloride cells in the gill epithelium during seawater and freshwater adaptation in a euryhaline teleost, Poecilia reticulata. J Exp Zool 281: 80–89

Shiraishi K, Kaneko T, Hasegawa S, Hirano T (1997) Development of multicellular complexes of chloride cells in the yolk-sac mem-brane of tilapia (Oreochromis mossambicus) embryos and lar-vae in seawater. Cell Tissue Res 288: 583–590

Starremans PGJF, Kersten FFJ, van den Heuvel LPWJ, Knoers NVAM, Bindels RJM (2003) Dimeric architecture of the human bumetanide-sensitive Na-K-Cl co-transporter. J Am Soc Nephrol 14: 3039–3046

Takehana Y, Naruse K, Sakaizumi M (2005) Molecular phylogeny of the medaka fishes genus Oryzias (Beloniformes: Adrianichthyi-dae) based on nuclear and mitochondrial DNA sequences. Mol Phylogenet Evol 36: 417–428

Takei Y, Hiroi J, Takahashi H, Sakamoto T (2014) Diverse mecha-nisms for body fluid regulation in teleost fishes. Am J Physiol Regul Integr Comp Physiol 307: R778–R792

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and MaximumParsimony Methods. Mol Biol Evol 28: 2731–2739

Tang CH, Lee TH (2007) The effect of environmental salinity on the protein expression of Na+/K+-ATPase, Na+/K+/2Cl(–) cotrans-porter, cystic fibrosis transmembrane conductance regulator, anion, exchanger 1, and chloride channel 3 in gills of a euryha-line teleost, Tetraodon nigroviridis. Comp Biochem Physiol A 147: 521–528

Tang CH, Lee TH (2013) Freshwater acclimation induces stress responses and expression of brachial Na+/K+-ATPase and pro-liferating cell nuclear antigen in Takifugu niphobles. J Exp Zool A Ecol Genet Physiol 319: 409–421

Tang CH, Hwang LY, Shen ID, Chiu YH, Lee TH (2011) Immunolo-calization of chloride transporters to gill epitheilia of euryhaline teleosts with opposite salinity-induced Na+/K+-ATPase

responses. Fish Physiol biochem 37: 709–724Tine M, Bonhomme F, McKenzie DJ, Durand JD (2010) Differential

expression of the heat shock protein Hsp70 in natural popula-tions of the tilapia, Sarotherodon melanotheron, acclimatised to a range of environmental salinities. BMC Ecol 10: 11

Tipsmark CK, Madsen SS, Seidelin M, Christensen AS, Cutler CP, Cramb G (2002) Dynamics of Na+,K+,2Cl− cotransporter and Na+,K+-ATPase expression in the branchial epithelium of brown trout (Salmo trutta) and atlantic salmon (Salmo salar). J Exp Zool 293: 106–118

Tipsmark CK, Madsen SS, Borski RJ (2004) Effect of salinity on expression of branchial ion transporters in striped bass (Morone saxatilis). J Exp Zoolog A Comp Exp Biol 301: 979–991

Tipsmark CK, Baltzegar DA, Ozden O, Grubb BJ, Borski RJ (2008) Salinity regulates claudin mRNA and protein expression in the teleost gill. Am J Physiol Regul Integr Comp Physiol 194: R1004–R1014

Uchida K, Kaneko T, Yamauchi K, Hirano T (1996) Morphometrical analysis chloride cell activity in the gill filaments and lamellae and changes in Na+, K+-ATPase activity during seawater adap-tation in chum salmon fry. J Exp Zool 276: 193–200

Varsamos S, Diaz JP, Chamrmantier G, Flik G, Blasco C, Connes R (2002) Branchial chloride cells in sea bass (Dicentrarchus labrax) adapted to fresh water, seawater, and bouble concen-trated seawater. J Exp Zool 293: 12–26

Woese CR (2000) Interpreting the universal phylogenetic tree. Proc Natl Acad Sci USA 97: 8392–8396

Wong CK, Chan DK (1999) Isolation of viable cell types from the gill epithelium of Japanese eel Anguilla japonica. Am J Physiol 276: R363–R372

Wu YC, Lin LY, Lee TH (2003) Na+,K+,2Cl–-cotransporter: A novel marker for identifying freshwater- and seawater-type mitochon-dria-rich cells in gills of the euryhaline tilapia, Oreochromis mossambicus. Zool Stud 42: 186–192

Yang WK, Hseu JR, Tang CH, Chung MJ, Wu SM, Lee TH (2009) Na+/K+-ATPase expressionin gills of the euryhaline sailfin molly, Poecilia latipinna, is altered in response to salinity chal-lenge. J Exp Mar Biol Ecol 375: 41–50

Yang WK, Kang CK, Chen TY, Chang WB, Lee TH (2011) Salinity-dependent expression of the branchial Na+/K+/2Cl− cotrans-porter and Na+/K+-ATPase in the sailfin molly correlates with hypo-osmoregulatory endurance. J Com Physiol B 181: 953–964

(Received October 5, 2015 / Accepted February 28, 2016)

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions,research libraries, and research funders in the common goal of maximizing access to critical research.

A Stenohaline Medaka, Oryzias woworae, Increases Expression of Gill Na+, K+-

ATPase and Na+, K+, 2Cl- Cotransporter 1 to Tolerate Osmotic StressAuthor(s): Jiun-Jang Juo , Chao-Kai Kang , Wen-Kai Yang , Shu-Yuan Yang and Tsung-Han LeeSource: Zoological Science, 33(4):414-425.Published By: Zoological Society of JapanDOI: http://dx.doi.org/10.2108/zs150157URL: http://www.bioone.org/doi/full/10.2108/zs150157

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological,and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and bookspublished by nonprofit societies, associations, museums, institutions, and presses.

Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance ofBioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.

Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercialinquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.